CN115216537A - Primer group, kit and method for detecting ATTCT (atactic terminal sequence) repetitive sequence dynamic mutation of ATXN10 gene - Google Patents
Primer group, kit and method for detecting ATTCT (atactic terminal sequence) repetitive sequence dynamic mutation of ATXN10 gene Download PDFInfo
- Publication number
- CN115216537A CN115216537A CN202211007697.6A CN202211007697A CN115216537A CN 115216537 A CN115216537 A CN 115216537A CN 202211007697 A CN202211007697 A CN 202211007697A CN 115216537 A CN115216537 A CN 115216537A
- Authority
- CN
- China
- Prior art keywords
- attct
- atxn10
- primer
- gene
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of molecular biology, in particular to a primer group, a kit and a method for detecting ATTCT (atattc test) repetitive sequence dynamic mutation of an ATXN10 gene, wherein a specific primer group is designed, a sample is subjected to PCR amplification to generate PCR products with different fragment lengths, one end of each product contains FAM (fluorescence amplified polymorphic nucleic acid), the PCR products are subjected to capillary electrophoresis, the number of repeats of ATTCT is analyzed, and the error does not exceed 1 repeat; the SCA10 is evaluated by detecting the number of ATTCT repeats in the ATXN10 gene, the number of ATTCT pentanucleotide repeats of the ATTCT 10 gene of the spinocerebellar ataxia 10 can be rapidly detected and evaluated, the detection process is short in time consumption, and the detection efficiency is high.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to a primer group, a kit and a method for detecting ATTCT (atatin-transferase-terminal transferase) repetitive sequence dynamic mutation of an ATXN10 gene.
Background
Spinocerebellar ataxia 10 (abbreviated SCA 10), which is a 10-mutation subtype of Spinocerebellar ataxia, is a chronic progressive cerebellar ataxia, usually beginning with poor balance and gait instability, followed by upper limb ataxia, abnormal eye movement, scanningly dysarthria, dysphagia, and the like. The reports of recurrent episodes following the onset of gait ataxia vary in frequency among different families. Some people have cognitive disorders, behavioral disorders, mood disorders, mild pyramidal and peripheral neuropathies. The age of onset is between 12 and 48 years of age.
SCA10 is more prevalent in mexico, brazil, argentina, and venezuela. In mexico and brazil, SCA10 represents the second common type of autosomal dominant hereditary cerebellar ataxia. Rasmussen et al (2001) reported that 18 patients from 4 mexico families proposed gait ataxia, dysarthria, variable limb ataxia and dysoculomotor. Of 18, 13 had generalized motor seizures, and 6 had partial seizures. Other symptoms include mood disorders, pyramidal signs, electroencephalogram abnormalities, and sensorimotor neuropathy. The SCA10 may affect a variety of tissues. However, since few methods for determining SCA10 are disclosed at present, the development of a gene detection method for SCA10 is of great significance for the clinical auxiliary diagnosis of spinocerebellar ataxia.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a primer group, a kit and a method for detecting the dynamic mutation of ATTCT repetitive sequence of ATXN10 gene, so as to provide a basis for judging the clinical auxiliary diagnosis of spinocerebellar ataxia by detecting the dynamic mutation condition of ATTCT repetitive sequence of ATXN10 gene.
In order to solve the problems, the invention adopts the following technical scheme:
in a first aspect, the invention provides a primer group for detecting ATTCT (atactic trinitrotoluene) repetitive sequence dynamic mutation of an ATXN10 gene, wherein the primer group comprises a primer SCA10P1, a primer SCA10P2, a primer SCA10P3 and a primer SCA10P4; the 5' end of the primer SCA10P1 is marked by a fluorescent group;
the nucleotide sequence of the primer SCA10P1 is GAAGACAATAGAAAACAGATGGCA;
the nucleotide sequence of the primer SCA10P2 is TACGCATCCAGTTTGAGACG;
the nucleotide sequence of the primer SCA10P3 is TACGCATCCAGTTTGAGACGGAATAGAATAGAATAATAGAATAGAATAGAATAATAGAATAAG;
the nucleotide sequence of the primer SCA10P4 is GACTTCCCGAAACACCGTC.
Further, the 5 'end of the primer SCA10P1 is provided with a 5' -FAM fluorescent group.
In a second aspect, the invention provides a kit for detecting dynamic mutation of ATTCT repetitive sequence of ATXN10 gene, which comprises a primer group for detecting dynamic mutation of ATTCT repetitive sequence of ATXN10 gene.
In a third aspect, the present invention provides a method for detecting dynamic mutations in ATTCT repeat sequence of ATXN10 gene, which comprises:
s1, extracting DNA to be detected;
s2, performing PCR amplification on the extracted DNA to be detected by using the primer group;
s3, performing capillary electrophoresis on the product obtained after PCR amplification in the S2;
and S4, analyzing the ATTCT repetition condition in the ATXN10 gene.
Specifically, the PCR amplification in S2 comprises:
preparing an amplification reaction solution mixed solution according to the number of DNA detection samples, wherein the amplification reaction solution mixed solution comprises: 2XGoldStar Best Master Mix reagent dosage 12.5 Xn. Mu.l, SCA10P1 primer concentration 10. Mu.M dosage 1 Xn. Mu.l, SCA10P2 primer concentration 10. Mu.M dosage 1 Xn. Mu.l, SCA10P3 primer concentration 10. Mu.M dosage 0.1 Xn. Mu.l, SCA10P4 primer concentration 10. Mu.M dosage 1 Xn. Mu.l, DMSO dosage 1 Xn. Mu.l and ddH 2 The dosage of O is 7.4 Xn mul; wherein n = number of detection samples +1; mu.l of DNA was added to 24. Mu.l of the amplification reaction mixture; PCR amplification was performed.
Specifically, the PCR amplification comprises:
firstly, denaturing at 95 ℃ for 1 minute in a PCR instrument; the following cycles were run for 35 more times: denaturation at 94 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds and extension at 72 ℃ for 1 minute; finally, the extension was carried out at 72 ℃ for 5 minutes and the cells were stored at 4 ℃.
Specifically, the S3 includes:
after PCR amplificationThe product was diluted in ddH 2 Adding a diluted PCR amplified product into the O;
mixing an ABI GS500-LIZ internal standard and HIDI according to the volume ratio of 1: 250 to obtain a mixed solution, and mixing the mixed solution with the diluted PCR amplified product to prepare an upper computer mixed solution;
running the on-machine mixed solution on a PCR instrument at 95 ℃ for 3 minutes, cooling for 5 minutes, and performing denaturation treatment at 0 +/-1 ℃;
detection was performed in an ABI3730xl sequencer using G5 color grouping.
Specifically, S4 includes:
judging the typing result by adopting genemaker ID v2.6.3 software, defining 166bp as ATTCT1 after checking and correcting internal standard peaks, and calculating the number of ATTCT repeats according to the number of fluorescence string peaks appearing every 5 bp.
In a fourth aspect, a system for detecting dynamic mutation of ATTCT repetitive sequence of ATXN10 gene comprises: the device comprises a DNA extraction module to be detected, a PCR amplification module, a capillary electrophoresis module and an analysis module;
the DNA extraction module to be detected is used for extracting DNA to be detected;
the PCR amplification module is used for carrying out PCR amplification on the extracted DNA to be detected by the primer group;
the capillary electrophoresis module is used for performing capillary electrophoresis on a product after PCR amplification;
the analysis module is used for analyzing the ATTCT repetition condition in the ATXN10 gene; and if the number of ATTCT repeats in the ATXN10 gene is 10-32, the detection result of the DNA to be detected is normal.
In a fifth aspect, the invention provides an application of the primer group for detecting the dynamic mutation of ATTCT repetitive sequence of ATXN10 gene or the kit for detecting the dynamic mutation of ATTCT repetitive sequence of ATXN10 gene in the preparation of a diagnosis agent for spinocerebellar ataxia 10 type disease sample.
The invention has the beneficial effects that: according to the primer group, the kit and the detection method provided by the invention, a sample is subjected to PCR amplification by designing a specific primer to generate a series of PCR products with different fragment lengths, one end of each product contains FAM fluorescence, and the PCR products are subjected to capillary electrophoresis, so that the number of repeats of ATTCT in the products can be clearly seen, and the error does not exceed 1 repeat; the SCA10 is evaluated by detecting the number of (ATTCT) n repeats in the ATXN10 gene, the number of ATTCT pentanucleotide repeats of the ATXN10 gene of spinocerebellar ataxia 10 can be rapidly detected and evaluated, the detection process is short in time consumption, and the detection efficiency is high.
Drawings
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be further described in detail with reference to the accompanying drawings, in which:
FIG. 1 is a diagram showing the results of the detection of a blood sample 1 according to an embodiment of the present invention.
FIG. 2 is a diagram showing the results of the blood sample 2 according to the embodiment of the present invention.
FIG. 3 is a diagram showing the result of testing a simulated positive plasmid sample according to an embodiment of the present invention.
Detailed Description
The present invention will be described in further detail with reference to specific examples.
It should be noted that these examples are only for illustrating the present invention, and not for limiting the present invention, and the simple modification of the method based on the idea of the present invention is within the protection scope of the present invention.
The invention designs a pair of specific primers aiming at ATTCT five-nucleotide repetition of an ATXN10 gene. The primers are used for carrying out PCR amplification on a sample to generate a series of PCR products with different fragment lengths, one end of each product contains FAM fluorescence, and capillary electrophoresis is carried out on the PCR products, so that the repetition number of ATTCT in the products can be clearly seen, and the error is not more than 1 time of repetition.
Example 1 primer design
Aiming at ATTCT five-nucleotide repetition of the ATXN10 gene, a group of specific primers are designed, wherein the 5' end of a forward primer SCA10P1 is marked by a fluorescent group, and the primer sequences are as follows:
SCA10P1-FAM：GAAGACAAATAGAAAACAGATGGCA
SCA10P1：GAAGACAAATAGAAAACAGATGGCA
SCA10P2：TACGCATCCCAGTTTGAGACG
SCA10P3：
TACGCATCCCAGTTTGAGACGGAATAGAATAGAATAGAATAGAATAGAATAGAATAGAATAG
SCA10P4：GACTTCCCGAAACACCGTC。
EXAMPLE 2 gDNA extraction of blood samples
The blood sample is extracted by adopting a magnetic bead method universal genome DNA extraction kit (DP 705-02) produced by Tiangen Biochemical technology (Beijing) Limited company:
1. adding 250 μ l of blood sample into 2ml centrifuge tube, adding 20 μ l of protease K solution and 300 μ l of lysate GHL, shaking, mixing, and lysing at 75 deg.C for 15min, and mixing 3 times each time by reversing during the period. When the number of samples is large, the lysate GHL and the protease K can be mixed in advance and prepared as required.
2. Add 300. Mu.l of isopropanol and mix well with shaking for 10sec.
3. Adding 15 μ l magnetic bead suspension GH, shaking and mixing for 1min, standing for 9min, and shaking and mixing for 1min every 3 min.
4. The centrifuge tube was placed on a magnetic stand and allowed to stand for 30sec, and after the magnetic beads were completely adsorbed, the liquid was aspirated.
5. Add 900. Mu.l buffer GDZ and mix well with shaking for 2min.
6. The centrifuge tube was placed on a magnetic stand and allowed to stand for 30sec, and after the magnetic beads were completely adsorbed, the liquid was aspirated.
7. Add 500. Mu.l buffer GDZ and mix well for 2min with shaking.
8. And (4) placing the centrifugal tube on a magnetic frame, standing for 30sec, and adsorbing the liquid after the magnetic beads are completely adsorbed.
9. Taking off the centrifuge tube from the magnetic frame, adding 900 μ l rinsing solution PWD (before use, checking whether absolute ethanol has been added), and shaking and mixing for 2min.
10. The centrifuge tube was placed on a magnetic stand and allowed to stand for 30sec, and after the magnetic beads were completely adsorbed, the liquid was aspirated.
11. Taking off the centrifugal tube from the magnetic frame, adding 300. Mu.l of rinsing solution PWD, and shaking and mixing for 2min.
12. The centrifuge tube was placed on a magnetic stand and allowed to stand for 30sec, and after the magnetic beads were completely adsorbed, the liquid was aspirated.
13. Placing the centrifuge tube on a magnetic frame, and air drying at room temperature for 10-15min. The ethanol residue can inhibit subsequent enzyme reaction, so that the ethanol is completely volatilized during air drying.
14. The tube was removed from the magnetic stand, 50. Mu.l of elution buffer TB was added, mixed by shaking, incubated at 56 ℃ for 10min, and the mixture was inverted and mixed 3 times for 3-5 times.
15. Transferring the gDNA solution into a new centrifuge tube, measuring the concentration of the gDNA solution by using nanodrop, concentrating or diluting the gDNA solution to 20 ng/mu L according to the measured concentration, and then carrying out subsequent experiments, wherein the extracted gDNA is recommended to be immediately subjected to PCR amplification or directly stored at-20 +/-5 ℃, and the storage time is not more than one month.
Example 3 PCR amplification of extracted DNA
The PCR amplification of the blood sample and the plasmid sample (20 ng/. Mu.L) with positive simulation by using the primer pair can generate a series of PCR products with different fragment lengths, and one end of each product contains fam fluorescence;
the PCR was performed using a commercially available PCR kit, which was named 2XGoldStar Best MasterMix with a brand name of CW0656S.
1. Reagent preparation: preparing an amplification reaction liquid mixed solution according to the number of DNA detection samples, wherein the dosage of reagents in the amplification reaction liquid mixed solution is as follows:
| composition (I) | Dosage of |
| 2xGoldStar Best MasterMix | 12.5μl×n |
| SCA10P1 | 1μl×n |
| SCA10P2 | 1μl×n |
| SCA10P3 | 0.1μl×n |
| SCA10P4 | 1μl×n |
| DMSO | 1μl×n |
| Nuclease-free purified water | 7.4μl×n |
| Total volume | 24μl×n |
Where n = the number of detection samples +1.
2. Sample adding: mu.l DNA was added to 24. Mu.l of the amplification reaction mixture;
3. amplification: the PCR amplification procedure was performed in a PCR machine as follows:
firstly, denaturing at 95 ℃ for 1 minute in a PCR instrument; the following cycles were run for 35 more times: denaturation at 94 ℃ for 30 seconds, annealing at 59 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute; after 72 ℃ extension for 5 minutes, 4 ℃ storage.
Example 4 capillary electrophoresis of PCR products
1. Sample dilution: 100-fold sample dilution of PCR product at 99. Mu.lddH 2 To O, 1. Mu.l of the PCR amplification product was added.
2. Preparing an upper machine mixed solution: mixing ABI GS500-LIZ internal standard and HIDI according to the volume ratio of 1: 250, and mixing 9 mu l of mixed solution with 1 mu l of diluted PCR amplification product to prepare on-machine mixed solution.
3. Pre-denaturation: and (3) running the prepared on-machine mixed solution on a PCR instrument at 95 ℃ for 3 minutes, and then carrying out denaturation treatment on the mixed solution in an ice-water mixture for 5 minutes at a very high speed.
4. Capillary electrophoresis: the upper computer mixed liquid is detected in an ABI3730xl sequencer, grouping is carried out by adopting G5 color, and the grouping parameters in the ABI3730xl sequencer are set as shown in the following table.
Detecting constant Temperature OVEN _ Temperature of 60 ℃ and Buffer Temperature Buffer _ Temperature of 35 ℃; the pre-electrophoresis Voltage PreRun _ Voltage 15kV and the pre-electrophoresis Time PreRun _ Time 180s; the Injection Voltage Injection _ Voltage is 1.5kV; injection Time Injection _ Time is 15s; the First reading First _ ReadOut _ Time 300ms; second reading Second _ ReadOut _ Time 300ms; electrophoretic Voltage Run _ Voltage 15kV; the Number of sudden jump steps, voltage _ Number _ of _ steps, is set to 10 steps; the kick Voltage _ steps _ Interval is set to 20s; the Voltage Tolerance Voltage _ Tolerance is set to 0.6kV; the Current _ Stability is 30uA, and the temperature-variable Delay Ramp _ Delay is 1s; date Delay Data _ Delay 600s; electrophoresis Time Run _ Time 1600s.
Implementation 5 detection System
A system for detecting the dynamic mutation of the ATTCT repetitive sequence of the ATXN10 gene is designed by using the detection method related in the embodiment 1-4, and comprises the following steps: the device comprises a DNA extraction module to be detected, a PCR amplification module, a capillary electrophoresis module and an analysis module;
the DNA extraction module to be detected is used for extracting the DNA to be detected;
the PCR amplification module is used for carrying out PCR amplification on the extracted DNA to be detected by the primer group;
the capillary electrophoresis module is used for carrying out capillary electrophoresis on the product after PCR amplification;
the analysis module is used for analyzing the ATTCT repetition condition in the ATXN10 gene; and if the number of ATTCT repeats in the ATXN10 gene is 10-32, the detection result of the DNA to be detected is normal.
Example 6 data analysis
Judging the typing result by using genemarker v2.6.3 software after the typing of the 3730xl sequencer is finished, checking an internal standard peak, defining that 166bp is ATTCT1 after the internal standard peak is corrected, adding 8 ATTCT repeats contained in an SCA10P3 primer according to the number of fluorescence string peaks appearing every 5bp, and judging the number of ATTCT repeats, wherein the number of ATTCT repeats in the sample 1 is 9+8=17 as shown in figure 1; referring to FIG. 2, the number of ATTCT repeats in this sample 2 is 10+8=18; referring to FIG. 3, the number of ATTCT repeats in this mock-positive plasmid was approximately 146, consistent with the plasmid synthetic sequence. Normally, the number of ATTCT repeats is 10-32.
Finally, it is noted that the above-mentioned embodiments illustrate rather than limit the invention, and that, while the invention has been described with reference to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.
Claims (10)
1. A primer group for detecting ATTCT repetitive sequence dynamic mutation of an ATXN10 gene is characterized by comprising a primer SCA10P1, a primer SCA10P2, a primer SCA10P3 and a primer SCA10P4; the 5' end of the primer SCA10P1 is marked by a fluorescent group;
the nucleotide sequence of the primer SCA10P1 is GAAGACAATAGAAAACAGATGGCA;
the nucleotide sequence of the primer SCA10P2 is TACGCATCCAGTTTGAGACG;
the nucleotide sequence of the primer SCA10P3 is TACGCATCCAGTTTGAGACGGAATAGAATAGAATATAGAATAGAATAGAATAGAATAATAATAGATAAG;
the nucleotide sequence of the primer SCA10P4 is GACTTCCCGAAACACCGTC.
2. The primer group for detecting the dynamic mutation of the ATTCT repetitive sequence of the ATXN10 gene as claimed in claim 1, wherein the 5 'end of the primer SCA10P1 is provided with a 5' -FAM fluorescent group.
3. A kit for detecting the dynamic mutation of ATTCT repetitive sequence of ATXN10 gene, which is characterized in that the kit comprises the primer group for detecting the dynamic mutation of ATTCT repetitive sequence of ATXN10 gene as claimed in claim 1 or 2.
4. A method for non-disease diagnosis of dynamic mutations in the ATTCT repeat of the ATXN10 gene, comprising:
s1, extracting DNA to be detected;
s2, performing PCR amplification on the extracted DNA to be detected by using the primer group in claim 1;
s3, performing capillary electrophoresis on the product obtained after PCR amplification in the S2;
and S4, analyzing the ATTCT repetition condition in the ATXN10 gene.
5. The method for detecting dynamic mutation of ATTCT repeat sequence of ATXN10 gene according to claim 4, wherein the PCR amplification in S2 comprises:
preparing an amplification reaction liquid mixed solution according to the number of DNA detection samples, wherein the amplification reaction liquid mixed solution comprises: 2XGoldStar Best Master Mix reagent dosage 12.5 Xn. Mu.l, SCA10P1 primer concentration 10. Mu.M dosage 1 Xn. Mu.l, SCA10P2 primer concentration 10. Mu.M dosage 1 Xn. Mu.l, SCA10P3 primer concentration 10. Mu.M dosage 0.1 Xn. Mu.l, SCA10P4 primer concentration 10. Mu.M dosage 1 Xn. Mu.l, DMSO dosage 1 Xn. Mu.l and ddH 2 The dosage of O is 7.4 Xn mul; wherein n = number of detected samples +1; add 1. Mu.l DNA into 24. Mu.l amplification reaction mixture; PCR amplification was performed.
6. The method for detecting dynamic mutations of ATTCT repeat sequence of ATXN10 gene according to claim 5, wherein the PCR amplification comprises:
firstly, denaturing at 95 ℃ for 1 minute in a PCR instrument; the following cycles were run for 35 more times: denaturation at 94 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds and extension at 72 ℃ for 1 minute; finally, the extension was carried out at 72 ℃ for 5 minutes and the cells were stored at 4 ℃.
7. The method for detecting the non-disease diagnosis of ATTCT repeated sequence dynamic mutation of ATXN10 gene according to claim 4, wherein the S3 comprises:
the PCR amplified product was diluted in ddH 2 Adding a diluted product after PCR amplification into the O;
mixing an ABI GS500-LIZ internal standard and HIDI according to the volume ratio of 1: 250 to obtain a mixed solution, and mixing the mixed solution with the diluted PCR amplified product to prepare an on-machine mixed solution;
running the on-machine mixed solution on a PCR instrument at 95 ℃ for 3 minutes, cooling for 5 minutes, and performing denaturation treatment at 0 +/-1 ℃;
detection was performed in an ABI3730xl sequencer using G5 color grouping.
8. The method for detecting the non-disease diagnosis of ATTCT repeated sequence dynamic mutation of ATXN10 gene according to claim 4, wherein S4 comprises:
judging the typing result by adopting genemarker ID v2.6.3 software, defining 166bp as ATTCT1 after checking and correcting internal standard peaks, and calculating the number of ATTCT repetition according to the number of fluorescence string peaks appearing every 5 bp.
9. A system for detecting dynamic mutation of ATTCT repetitive sequence of ATXN10 gene, which is characterized by comprising: the device comprises a DNA extraction module to be detected, a PCR amplification module, a capillary electrophoresis module and an analysis module;
the DNA extraction module to be detected is used for extracting DNA to be detected;
the PCR amplification module is used for carrying out PCR amplification on the extracted DNA to be detected by utilizing the primer group in claim 1;
the capillary electrophoresis module is used for carrying out capillary electrophoresis on a product after PCR amplification;
the analysis module is used for analyzing the ATTCT repetition condition in the ATXN10 gene; and if the number of ATTCT repeats in the ATXN10 gene is 10-32, the detection result of the DNA to be detected is normal.
10. Use of the primer set for detecting dynamic mutation of ATTCT repeat sequence of ATXN10 gene according to claim 1 or 2 or the kit for detecting dynamic mutation of ATTCT repeat sequence of ATXN10 gene according to claim 3 in preparation of diagnosis agent for spinocerebellar ataxia 10 type disease sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211007697.6A CN115216537A (en) | 2022-08-22 | 2022-08-22 | Primer group, kit and method for detecting ATTCT (atactic terminal sequence) repetitive sequence dynamic mutation of ATXN10 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211007697.6A CN115216537A (en) | 2022-08-22 | 2022-08-22 | Primer group, kit and method for detecting ATTCT (atactic terminal sequence) repetitive sequence dynamic mutation of ATXN10 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115216537A true CN115216537A (en) | 2022-10-21 |
Family
ID=83616433
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211007697.6A Pending CN115216537A (en) | 2022-08-22 | 2022-08-22 | Primer group, kit and method for detecting ATTCT (atactic terminal sequence) repetitive sequence dynamic mutation of ATXN10 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115216537A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115851915A (en) * | 2022-12-13 | 2023-03-28 | 长沙金域医学检验实验室有限公司 | Primer group and method for detecting hereditary ataxia disease-causing gene |
-
2022
- 2022-08-22 CN CN202211007697.6A patent/CN115216537A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115851915A (en) * | 2022-12-13 | 2023-03-28 | 长沙金域医学检验实验室有限公司 | Primer group and method for detecting hereditary ataxia disease-causing gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Timken et al. | A duplex real-time qPCR assay for the quantification of human nuclear and mitochondrial DNA in forensic samples: implications for quantifying DNA in degraded samples | |
| JP5680304B2 (en) | Rapid forensic DNA analysis | |
| CN107354149B (en) | Kit for extracting trace DNA and extraction method | |
| US20110118151A1 (en) | Multiple displacement amplification | |
| CN112029903B (en) | Primer group and kit for SARS-CoV-2 virus nucleic acid detection and application thereof | |
| CN111690640A (en) | Virus preservation solution highly compatible with paramagnetic particle method virus nucleic acid extraction kit | |
| CN107022651B (en) | Kit for rapidly detecting hepatitis C virus nucleic acid and detection method thereof | |
| CN112899270A (en) | Method for extracting nucleic acid for removing metagenome of pathogenic microorganism in alveolar lavage | |
| CN115216537A (en) | Primer group, kit and method for detecting ATTCT (atactic terminal sequence) repetitive sequence dynamic mutation of ATXN10 gene | |
| WO2021043139A1 (en) | Primer group for obtaining cfdna standard product, pcr amplification positive standard product and preparation method therefor, and kit and application | |
| CN116083555A (en) | Biomarker combination for predicting or detecting keratoconus, detection agent and application | |
| CN115725725A (en) | Primer group, kit and method for detecting dynamic mutation of GGCCTG (GGCCTG) repetitive sequence of NOP56 gene | |
| CN111961709A (en) | Reagent and kit for oral swab direct fluorescence PCR amplification | |
| CN114182006A (en) | Primer pair, kit and detection method for detecting JPH3 gene | |
| CN116463408A (en) | ABO gene amplification primer, amplification system, amplification method, sequencing library construction method and sequencing method | |
| CN115595362A (en) | Primer group, kit and method for detecting dynamic mutation of GGGGCC (GGGGC-like C9orf72 gene) repetitive sequence | |
| CN115198007A (en) | Primer group, kit and system for detecting BEAN1 and TK2 gene TGGAA repetition | |
| CN116004775A (en) | Primer probe composition, kit and method for quantifying copy number of human motor neurons | |
| CN110273004B (en) | Reagent, method and kit for detecting gene methylation | |
| CN110305947B (en) | Detection method for chromosome long fragment insertion and long fragment insertion detection method based on MassARRAY platform | |
| CN113322317A (en) | Primer pair, probe set and kit for mitochondrial obesity gene mutation detection | |
| CN113832148B (en) | Quick typing detection method for human SERPINB7 gene mutation | |
| ALLELES | Biology of STRs: stutter products, non-template addition, microvariants, null alleles and mutation rates | |
| CN114807448B (en) | Primer combination for detecting CHIKV, DENV, ZIKV parting region genome and detection method | |
| WO2023108865A1 (en) | Primer pair, kit and detection method for detecting mitochondrial loop gene mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |