CN115212309A

CN115212309A - Method, application and medicament for preventing cancer recurrence and inhibiting or reversing inflammation and canceration of normal tissues

Info

Publication number: CN115212309A
Application number: CN202210584526.3A
Authority: CN
Inventors: 常智杰; 任芳丽; 王银银; 林玉婷; 王滢
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2022-05-27
Filing date: 2022-05-27
Publication date: 2022-10-21
Also published as: WO2023227081A1

Abstract

The invention discloses a method, application and a medicament for preventing cancer relapse, inhibiting or reversing normal tissue inflammation and canceration by inhibiting CREPT. The invention finds that the expression of CREPT of normal tissues and cells is increased along with the levels of canceration and canceration markers p-ERK, p-p38, p-JNK, p-AKT, p-p65 and beta-catenin, and the inhibition of CREPT can inhibit canceration of normal cells caused by tumor exosomes, so that CREPT is taken as a cancer promoting protein, and the increase of CREPT means that the cells are in a high risk state of canceration and/or relapse. Thus, the present invention may also reduce the risk of relapse in situ in a patient by inhibition of CREPT.

Description

Method, application and medicament for preventing cancer recurrence and inhibiting or reversing inflammation and canceration of normal tissues

Technical Field

The invention relates to the technical field of molecular biology, in particular to a method, application and a medicament for preventing cancer recurrence by inhibiting CREPT (tumor necrosis factor receptor) and a method, application and a medicament for inhibiting or reversing inflammation, canceration, atypical hyperplasia, precancerous lesion, abnormal proliferation and tumor exosome-induced canceration of normal tissues by inhibiting CREPT.

Background

According to the existing research reports, the transformation of normal tissues into cancerous tissues may involve inflammation, atypical hyperplasia, precancerous lesions, abnormal proliferation and canceration, such as near-tumor exosome-induced canceration.

Recurrence of cancer is the process by which normal tissues undergo gradual changes at the genetic, protein, and pathological levels that predispose them to cancer in already cancerous and treated patients. In situ recurrence of cancer is the process of carcinogenesis in normal tissue surrounding a cancerous tissue that has been removed after treatment, such as surgery. One mechanism of cancer recurrence is tumor exosome-induced canceration.

The concept of regional canceration proposed by slauguer in 1953, who studied tumor specimens of 783 patients with oral squamous cell carcinoma, found pathological changes (such as hyperproliferation and keratosis) in all paracancerous regions, and two or more foci in 11.2% of patients (slauguer et al, 1953). The pathological changes of tissues beside cancer that they find are a classic regional canceration phenomenon. It is believed that cells in the cancerous region will possess a phenotype of accelerated proliferation, reduced apoptosis or immune escape.

As regional carcinogenesis is discovered in various solid tumors, it is recognized that previous divisions of pathological boundaries are insufficient to differentiate between cells that have undergone precancerous changes. These precancerous cells may become cancerous in the process of tumor development, resulting in multiple cancer foci, which may lead to drug resistance of the tumor, and may grow into new tumor after the primary tumor is removed, showing in situ recurrence.

Current research generally focuses on exploring what changes have occurred in tissues adjacent to the cancer. In cancers such as pancreatic cancer, prostate cancer and breast cancer, researchers have found by means of sequencing and the like that the gene expression profile of paracancerous seemingly normal tissues has actually changed, and this change is indeed related to the probability of recurrence in situ. In particular, in breast cancer, not only are changes in the transcriptional profile of the paraneoplastic tissues found, changes in telomere length, but also changes in the methylation level of DNA are found, and these changes are related to the distance from the tumor in situ, and also affect the recurrence of the tumor in situ.

Most studies have focused on what changes have occurred in the paracancerous tissues, and no study has focused on the cause of canceration in the paracancerous normal tissues. It has been shown that tumor cells secrete soluble factors such as E-cadherin (Patil et al, 2015) that promote the canceration of normal epithelial cells. In addition, studies have suggested that exosomes (a vesicle) secreted by tumor cells may be involved in regional carcinogenesis of paracancerous tissues (amirad et al, 2020), and that tumor cells may induce carcinogenesis of normal epithelial cells by secreting exosomes (Bertolini et al, 2020, melo et al, 2014 wu et al, 2019, yoon et al, 2022. The multifocal and recurrent nature of bladder cancer is considered to be an effect of regional canceration. Researchers found that non-malignant human urothelial cells SV-HUCs, chronically exposed to bladder cancer extracellular vesicles, can trigger endoplasmic reticulum stress and promote the up-regulation of IRE 1and NF-kB and the down-regulation of the pro-apoptotic protein CHOP, ultimately leading to cellular carcinogenesis (Wu et al, 2019). Various studies have suggested that tumor exosomes may be a carcinogenic agent to induce regional carcinogenesis of paracancerous normal tissues.

Regional carcinogenesis has been reported to be probably caused by an inflammatory or hypoxic environment created by tumor tissue. Also, TNFR2 induces activation of ERK, AKT, NF- κ B, and MLCK in epithelial cells in animal models of chronic inflammation, leading to carcinogenesis (Nagaishi et al, 2016 onizawa et al, 2009. The research on the process of canceration of normal tissues and cells shows that chronic inflammation is a cause of canceration, but the specific mechanism is not clear.

Regional canceration is considered to be closely related to in situ recurrence of the tumor, and cells which suffer from regional canceration may obtain growth advantages after in situ tumor resection, and finally grow into a new tumor which is shown as in situ recurrence. While in situ recurrence of tumors threatens the survival of patients seriously. Therefore, the research on the cause and mechanism of regional canceration has important significance on the prevention and treatment of tumor in-situ recurrence.

Thus, accurate identification and targeted treatment for regional canceration can more accurately prevent cancer recurrence.

There is also a need in the art for methods, uses and medicaments that more precisely prevent cancer recurrence, and inhibit or reverse normal tissue inflammation, carcinogenesis, dysplasia, precancerous lesions, abnormal proliferation and tumor exosome-induced carcinogenesis.

Disclosure of Invention

The technical problem to be solved by the invention is how to more accurately identify tissues at risk of cancer recurrence and at risk of inflammation, canceration, atypical hyperplasia, precancerous lesion, abnormal proliferation and tumor exosome-induced canceration, thereby specifically reducing the probability of tumor recurrence in situ, and inhibiting or reversing normal tissue inflammation, canceration, atypical hyperplasia, precancerous lesion, abnormal proliferation and tumor exosome-induced canceration, for example, by inhibiting regional canceration to achieve more accurate prevention of cancer recurrence, and inhibiting or reversing normal tissue inflammation, canceration, atypical hyperplasia, precancerous lesion, abnormal proliferation and tumor exosome-induced canceration.

In order to solve the above technical problems, the present invention provides, in a first aspect, a method for preventing recurrence of cancer, the method comprising: inhibiting CREPT in a subject in need thereof, preferably the recurrence is in situ recurrence, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In some embodiments of the methods of the invention, inhibition of CREPT is achieved by administering to the subject: vectors carrying nucleic acid fragments that inhibit CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

In some embodiments of the methods of the invention, the inhibition of CREPT is performed systemically or locally in the subject, e.g., in situ following tumor resection.

In some embodiments of the methods of the invention, the cancer or carcinoma is a solid carcinoma, such as cervical, breast, ovarian, melanoma, colon cancer.

In a second aspect, the invention provides the use of a CREPT-inhibiting agent in the manufacture of a medicament for the prevention of recurrence of cancer, preferably in situ.

In some embodiments of the use of the invention, the agent is a vector carrying a nucleic acid segment that inhibits CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

In some embodiments of the use of the invention, the medicament is administered to a subject who has undergone other treatments for cancer.

In some embodiments of the use of the invention, the other treatment of cancer comprises surgery, radiation therapy and/or chemotherapy.

In some embodiments of the use of the invention, the medicament further comprises one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

In some embodiments of the use of the invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

In some embodiments of the uses of the invention, the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

In a third aspect, the invention provides a medicament for preventing the recurrence of cancer, said medicament comprising an agent that inhibits CREPT.

In some embodiments of the agents of the invention, the agents that inhibit CREPT inhibit transcription of a CREPT gene, inhibit expression of a CREPT gene, inhibit function of a CREPT protein, and/or promote degradation of a CREPT protein.

In some embodiments of the medicament of the present invention, the medicament further comprises one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

In some embodiments of the medicament of the present invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

In some embodiments of the medicament of the present invention, the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

In some embodiments of the agents of the invention, the agents are administered concurrently with the one or more cancer therapeutic agents and/or with the one or more inflammation inhibitory agents, or separately, as a combination agent.

By the above methods, uses and medicaments, the present invention can inhibit regional canceration of normal tissues, thereby preventing, in particular, the risk of in situ recurrence.

In a fourth aspect of the invention, there is provided a method of inhibiting or reversing canceration in paracancerous normal tissue, the method comprising: inhibiting CREPT in a paracancerous normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In a fifth aspect of the invention, there is provided a method of inhibiting or reversing inflammation of paracancerous normal tissue, the method comprising: inhibiting CREPT in a paraneoplastic normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In a sixth aspect of the invention, there is provided a method of inhibiting or reversing atypical hyperplasia of normal tissue cells, the method comprising: inhibiting CREPT in normal tissues, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In a seventh aspect of the invention, there is provided a method of inhibiting or reversing a precancerous lesion, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In an eighth aspect of the present invention, there is provided a method of inhibiting or reversing abnormal proliferation of cells in normal tissue, the method comprising: inhibiting CREPT in normal tissues, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In a ninth aspect of the present invention, there is provided a method for inhibiting or reversing canceration of normal tissue cells by tumor exosomes, the method comprising: inhibiting CREPT in normal tissues, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In a tenth aspect of the present invention, there is provided a method of promoting apoptosis of a cancerous or inflammatory tissue, the method comprising: inhibiting CREPT in a cancerous or inflammatory tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In the method of any of the fourth to tenth aspects of the invention, inhibition of CREPT is inhibited by administering to the subject: vectors carrying nucleic acid fragments that inhibit CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

In the method of any of the fourth to tenth aspects of the invention, the inhibition of CREPT is performed systemically or locally in the subject, e.g., in situ after tumor resection.

In the method of any one of the fourth to tenth aspects of the invention, wherein the cancer or carcinomas are solid cancers, such as cervical, breast, ovarian, melanoma, colon cancer.

In an eleventh aspect of the invention, there is provided the use of a CREPT-inhibiting agent in the manufacture of a medicament for inhibiting or reversing canceration in normal tissue.

In a twelfth aspect of the invention, there is provided the use of a CREPT-inhibiting agent in the preparation of a medicament for inhibiting or reversing inflammation in normal tissue.

In a thirteenth aspect of the invention, there is provided the use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting or reversing the atypical proliferation of cells in normal tissue.

In a fourteenth aspect of the invention, there is provided the use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting or reversing pre-cancerous lesions.

In a fifteenth aspect of the invention, there is provided the use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting or reversing abnormal proliferation of cells in normal tissue.

In a sixteenth aspect of the invention, the invention provides an application of a CREPT (tumor necrosis factor inhibiting) inhibiting agent in preparation of a medicament for inhibiting tumor exosomes from cancerating normal tissue cells.

In a seventeenth aspect of the invention, the use of an agent that inhibits CREPT in the preparation of a medicament for promoting apoptosis of cancerous or inflammatory tissue is provided.

In the use of any of the eleventh to seventeenth aspects of the invention, the agent is a vector carrying a nucleic acid fragment that inhibits CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; a macromolecular CREPT-targeted inhibitor, such as an antibody or antibody fragment of CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

In the use of any of the eleventh to seventeenth aspects of the invention, the medicament is administered to a subject who has undergone further treatment of cancer.

In the use of any of the eleventh to seventeenth aspects of the invention, the other treatment of cancer comprises surgery, radiation therapy and/or chemotherapy.

In the use according to any one of the eleventh to seventeenth aspects of the present invention, the medicament further comprises one or more cancer therapeutic agents, and/or one or more inflammation inhibitory agents.

In the use of any of the eleventh to seventeenth aspects of the invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

In the use according to any one of the eleventh to seventeenth aspects of the invention, the one or more inhibitors of inflammation are selected from QNZ (EVP 4593) and JSH-23.

In an eighteenth aspect of the invention, there is provided a medicament for inhibiting or reversing canceration in normal tissues, said medicament comprising an agent that inhibits CREPT.

In a nineteenth aspect of the invention, there is provided a medicament for inhibiting or reversing inflammation in normal tissue, said medicament comprising an agent that inhibits CREPT.

In a twentieth aspect of the invention, there is provided a medicament for inhibiting or reversing atypical hyperplasia of normal tissue cells, said medicament comprising an agent which inhibits CREPT.

In a twenty-first aspect of the invention, there is provided a medicament for inhibiting or reversing pre-cancerous lesions, said medicament comprising an agent that inhibits CREPT.

In a twenty-second aspect of the invention, there is provided a medicament for inhibiting or reversing abnormal proliferation of cells in normal tissue, said medicament comprising an agent that inhibits CREPT.

In a twenty-third aspect of the invention, there is provided a medicament for inhibiting the carcinogenesis of normal tissue cells by tumor exosomes, the medicament comprising an agent that inhibits CREPT.

In a twenty-fourth aspect of the invention, there is provided a medicament for promoting apoptosis in cancerous or inflammatory tissue, said medicament comprising an agent that inhibits CREPT.

In the medicament of any of the eighteenth to twenty-fourth aspects of the invention, the CREPT-inhibiting agent inhibits transcription of a CREPT gene, inhibits expression of a CREPT gene, inhibits function of a CREPT protein, and/or promotes degradation of a CREPT protein.

In the medicament of any one of the eighteenth to twenty-fourth aspects of the invention, the medicament further comprises one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

In the medicament of any one of the eighteenth to twenty-fourth aspects of the invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

In the medicament of any one of the eighteenth to twenty-fourth aspects of the invention, the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

In the medicament of any one of the eighteenth to twenty-fourth aspects of the invention, as a combined medicament, the CREPT-inhibiting agent is administered simultaneously with the one or more cancer therapeutic agents and/or with the one or more inflammation-inhibiting agents, or separately.

Through the above methods, applications and medicaments, the present invention can more accurately inhibit or reverse normal tissue inflammation, carcinogenesis, atypical hyperplasia, precancerous lesion, abnormal proliferation and tumor exosome-induced carcinogenesis, thereby inhibiting carcinogenesis earlier than prior art methods.

Drawings

Embodiments of the present invention are explained with reference to the following drawings, in which,

FIG. 1 shows the results of immunohistochemical staining of CREPT in breast cancer and paracancerous tissues. In fig. 1a CREPT is highly expressed in ductal carcinoma of the breast (a), elevated in paracancerous epithelial tissue near the tumor (b, c), and low in distant normal tissue (d). In fig. 1B, CREPT was highly expressed in breast lobular carcinoma (a), elevated in paracancerous epithelial tissue near the tumor (B, c), and low in distant normal tissue (d).

FIG. 2 shows the results of immunohistochemical staining of CREPT in cervical cancer and colon cancer tissues and tissues adjacent to the cancer. In a of fig. 2, CREPT was highly expressed in cervical cancer (a), elevated in paracancerous epithelial tissue near the tumor (b, c), and low in distant normal tissue (d). In fig. 2B CREPT was highly expressed in colon cancer (a), elevated in paracancerous epithelial tissue near the tumor (B, c), and low in distant normal tissue (d).

FIG. 3 shows the particle size distribution of exosomes. Nanoparticle tracking analysis of exosomes (231 EXO and 4T1 EXO) from MDA-MB-231 (231) and 4T1 cells showed that the size distribution of exosomes was between 30-200 nm.

FIG. 4 shows warp/weft of 1X 10 ⁹ Plate clones of MCF10A (a of fig. 4) or NmuMG (B of fig. 4) cells at 2 weeks after treatment of individual particles/mL 4T1EXO or 231EXO developed crystal violet staining results. Statistical results were analyzed using t-test, representing p-values<0.05。

FIG. 5 shows the Western blot results of 4T1EXO, 231 EXO-induced NMuMG, CREPT, p-ERK, p-p38, p-JNK, p-p65, p-Akt, β -catenin and Actin in MCF10A cells. Using 2X 10 ⁸ particles/mL 231EXO treated MCF10A cells using 1X 10 ⁹ Each particle/mL of 4T1EXO is used for treating NMuMG cells, p-ERK, p-p38, p-JNK, p-p65, p-Akt, akt and beta-catenin in the treated MCF10A and NmuMG cells are subjected to Western blot detection respectively, and Actin is used as an internal reference protein.

FIG. 6 shows that knockout of CREPT affects NMuMG cell proliferation, nude mouse tumorigenesis and apoptosis after 4T1EXO treatment, wherein,

warp/weft of 1X 10 ⁹ NMuMG-WT/-KO cells after 2 weeks of treatment with particles/mL 4T1EXO, CCK-8 in A of FIG. 6, cell proliferation for 5 days (cell number represented by OD450 values normalized by OD450 on day 0, significance analysis using T-test, p-value<0.001,ns represents no significant difference);

in B of FIG. 6, the plate clones developed crystal violet staining results;

in C of fig. 6, the results of statistical analysis of clone sizes in B of fig. 6 (using two-way anova,. Indicates a p-value < 0.05);

in D of fig. 6, nude mouse tumorigenesis results: these cells were injected in situ into the mammary fat pad of nude mice (5 per group) at 1 × 107 cells per spot, and the tumorigenesis was observed after 10 weeks;

in E of fig. 6, the weight statistics for the tumors in D of fig. 6 (using two-way anova,. Indicates p value < 0.01);

in FIG. 6F, western blot detection of NMuMG-WT/-KO cells at 1X 10 ⁹ Protein levels of Caspase3 and cleared Caspase3 after 4T1EXO treatment per mL, actin was used as an internal control protein.

FIG. 7 shows that knockout of CREPT affects clonal formation of MCF10A cells after 231EXO treatment, where

Warp/weft 2X 10 ⁸ particle/mL 231EXO 2 weeks after plate clone formation (crystal violet staining) results for 10A-WT/-KO cells (left), right panel for clone size statistical analysis (using two-way analysis of variance, representing p-value<0.05)。

FIG. 8 shows that CREPT knockdown blocks 4T1EXO, 231 EXO-induced activation of NF-kB, ERK, and AKT in NMuMG, MCF10A cells, wherein,

in A of FIG. 8, western blot detects CREPT, p-ERK, p-Akt, p-p65 and p65 levels of MCF10A-WT and KO cells treated with 231EXO for 0, 1, 3, 6 and 9 days, and Actin is used as an internal reference;

in B of FIG. 8, western blot was used to detect the levels of CREPT, p-ERK, p-Akt, p-p65, and p65 in NMuMG-WT and KO cells treated with 4T1EXO for 0, 1, 3, 6,9, and 11 days, and Actin was used as an internal reference.

FIG. 9 shows that CREPT affects the proliferation of normal epithelial cells, where

A, B and C in figure 9 are Western blot to identify CREPT over-expression and knockout cell lines, and Actin is used as an internal reference protein, wherein A in figure 9 is a CHO cell, B in figure 9 is an NMuMG cell, and C in figure 9 is an MCF10A cell;

fig. 9D, E, F are proliferation experiments of cell lines overexpressing and knocking out CREPT, where D in fig. 9 is CHO cells, E in fig. 9 is NMuMG cells, F in fig. 9 is MCF10A cells, and CCK-8 was used to detect cell proliferation, the number of cells being represented by OD450 values normalized by OD450 value on day 0. The significance analysis used t-tests, with values for p <0.01, p <0.001, and p <0.0001.

FIG. 10 shows the tumorigenic capacity of CHO cells promoted by over-expression of CREPT, wherein

Tumor formation in nude mice by CREPT-overexpressing CHO cells. CHO cells overexpressing CREPT (CHO-OE, lower, n = 8) and its control (CHO-EV, upper, n = 8) were injected subcutaneously in the axilla on both sides of nude mice, 1 × 10 per spot ⁷ Individual cells, tumorigenesis was observed after 5 weeks.

FIG. 11 shows that CREPT knockdown in MCF10A cells blocks 231 EXO-induced upregulation of a portion of the genes in the TNF signaling pathway, wherein,

FIG. 11A is a heatmap of the expression levels of TNF signaling pathway-related genes in MCF10A-WT/KO cells without/with 231EXO treatment. Values are shown in green (0) to red (100) after normalization for each set of maxima. FIG. 11B-F are qPCR measurements of mRNA levels of TNFRSF1B, PIK3CD, JUN, TNF, NOD2, and CSF1 in MCF10A-WT/KO cells at day 16 without/with 231EXO treatment. mRNA levels of Actin serve as an internal control.

FIG. 12 shows that CREPT knockdown in NMuMG cells blocks 4T1 EXO-induced upregulation of portions of the genes in the TNF signaling pathway, wherein,

FIG. 12A is a heatmap of the expression levels of TNF signaling pathway related genes in NMuMG-WT/KO cells without/with 4T1EXO treatment. Values are shown in green (0) to red (100) after normalization for each set of maxima. FIG. 12B-C is a qPCR measurement of mRNA levels of TNFRSF1B and PIK3CD in NMuMG-WT/KO cells at day 16 without/with 4T1EXO treatment. mRNA levels of Actin serve as an internal control.

Figure 13 shows that inhibition of CREPT promotes drug sensitivity of breast cancer cells to tamoxifen endocrine therapy. Among them, CREPT was significantly up-regulated in tamoxifen resistant strains of MCF-7 cells (MCF 7/TAM-R) (A of FIG. 13), while knockdown of CREPT significantly inhibited the proliferation of MCF-7/TAM-R cells (B and C of FIG. 13). In cell proliferation and apoptosis experiments, knockdown of CREPT in MCF-7/TAM-R cells reduced the dose of 4-hydroxyttamoxifen required to induce apoptosis and decreased the IC50 value of 4-hydroxyttamoxifen (D and E of FIG. 13).

Detailed Description

The following non-limiting examples are provided to illustrate the technical aspects of the present invention.

[ definition ]:

CREPT, also known as RPRD1B, is a protein that is highly expressed in tumor tissues but is poorly expressed or not expressed in normal tissues, and high expression of CREPT can promote proliferation of tumor cells. The CREPT coding sequence is shown in Gene ID:58490. The protein sequence of the protein consists of 326aa (see SEQ ID NO: 1), and the UniProt number is Q9NQG5.

Regional canceration: malignant changes in cells surrounding tumor tissue are referred to as regional canceration.

Atypical hyperplasia: the pathological concept means that epithelial cells are abnormally proliferated, and the cells have a certain degree of heterogeneity but are not enough to be diagnosed as cancer. Atypical hyperplasia is classified into mild, moderate and severe atypical hyperplasia according to the degree of cellular heterogeneity.

Tumor exosomes: exosomes are vesicles secreted by tumor cells, and serve as important tools for intercellular communication, so that the behaviors of nutrition supply, angiogenesis, immune escape and the like are influenced.

TNF: tumor Necrosis Factor (TNF) is a pleiotropic cytokine. It is 34kDa in size and plays an important role in carcinogenesis, cancer progression and metastasis, and immunity.

Cancer: as used herein, the terms "cancer," "malignancy," "neoplasm," "tumor," and "carcinoma" are used interchangeably to refer to a disease, disorder or condition in which cells exhibit or exhibit relatively abnormal, uncontrolled and/or autonomous growth, such that they exhibit or exhibit an abnormally elevated proliferation rate and/or abnormal growth phenotype. In some embodiments, for example, as set forth herein, a cancer may comprise one or more tumors. In some embodiments, for example, as set forth herein, a cancer can be or include a precancerous (e.g., benign), malignant, pre-metastatic, and/or non-metastatic cell. In some embodiments, for example, as set forth herein, the cancer may be or comprise a solid tumor. In some embodiments, for example, as set forth herein, the cancer may be or include a hematological tumor. Generally, examples of different types of cancers known in the art include, for example, colorectal cancers, hematopoietic cancers including leukemias, lymphomas (hodgkins and non-hodgkins), myelomas, and myeloproliferative diseases; sarcomas, melanomas, adenomas, solid tissue cancers, squamous cell cancers of the mouth, throat, larynx and lung cancer, liver cancer, cancers of the urogenital system such as prostate cancer, cervical cancer, bladder cancer, uterine cancer and endometrial cancer, as well as renal cell cancers, bone cancers, pancreatic cancer, skin cancers, cutaneous or intraocular melanomas, cancers of the endocrine system, thyroid cancer, parathyroid cancer, head and neck cancer, breast cancer, gastrointestinal cancer and cancers of the nervous system, benign lesions and the like such as papillomas and the like.

Such cancers are all within the scope of the present invention.

Solid tumors: as used herein, the term "solid tumor" refers to an abnormal tissue mass including cancer cells. In various embodiments, for example, as presented herein, a solid tumor is or comprises an abnormal tissue mass that does not contain cysts or liquid areas. In some embodiments, for example, as set forth herein, a solid tumor can be benign; in some embodiments, the solid tumor may be malignant. Examples of solid tumors include carcinomas, lymphomas and sarcomas. In some embodiments, for example, as presented herein, a solid tumor can be or include an adrenal, bile duct, bladder, bone, brain, breast, cervix, colon, endometrium, esophagus, eye, gall bladder, gastrointestinal tract, kidney, larynx, liver, lung, nasal cavity, nasopharynx, oral cavity, ovary, penis, pituitary, prostate, retina, salivary gland, skin, small intestine, stomach, testis, thymus, thyroid, uterus, vagina, and/or vulva tumor.

Such solid tumors are within the scope of the present invention.

Chemotherapeutic agents: as used herein, the term "chemotherapeutic agent," consistent with its use in the art, refers to one or more agents known to be useful for or contributing to the treatment of cancer or having known characteristics for use in or contributing to the treatment of cancer. In particular, chemotherapeutic agents include pro-apoptotic, cytostatic and/or cytotoxic agents. In some embodiments, for example, as set forth herein, a chemotherapeutic agent can be or include an alkylating agent, an anthracycline, a cytoskeletal disrupting agent (e.g., a microtubule targeting moiety, such as a taxane, maytansine, and analogs thereof), an epothilone, a histone deacetylase inhibitor HDAC), a topoisomerase inhibitor (e.g., inhibitor topoisomerase I and/or topoisomerase II), a kinase inhibitor, a nucleotide analog or nucleotide precursor analog, a peptide antibiotic, a platinum drug, a retinoid, a vinca alkaloid, and/or an analog having related antiproliferative activity. In some particular embodiments, for example, as set forth herein, the chemotherapeutic agent may be or include actinomycin, all-trans retinoic acid, auristatin, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chloramphenicol, cyclophosphamide, curcumin, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, maytansine and/or analogs thereof (such as DM 1), nitrogen mustard, mercaptopurine, methotrexate, mitoxantrone, maytansinoids, oxaliplatin, paclitaxel, pemetrexed, teniposide, thioguanine, topotecan, pentostatin, vinblastine, vindesine, vinorelbine, or combinations thereof. In some embodiments, for example, as set forth herein, chemotherapeutic agents may be used in the context of antibody-drug conjugates. In some embodiments, for example, as set forth herein, the chemotherapeutic agent is one found in an antibody-drug conjugate selected from the group consisting of: hLL 1-doxorubicin, hRS7-SN-38, hMN-14-SN-38, hLL2-SN-38, hA20-SN-38, hPAM4-SN-38, hLL1-SN-38, hRS7-Pro-2-P-Dox, hMN-14-Pro-2-P-Dox, hLL2-Pro-2-P-Dox, hA20-Pro-2-P-Dox, hPAM4-Pro-2-P-Dox, hLL1-Pro-2-P-Dox, P4/D10-doxorubicin, gemtuzumab ozotacin, bentuximab, trastuzumab, otuzumab, gemumab, and glytumomab (glytumomab vedotin) SAR3419, SAR566658, BIIB015, BT062, SGN-75, SGN-CD19A, AMG-172, AMG-595, BAY-94-9343, ASG-5ME, ASG-22ME, ASG-16M8F, MDX-1203, MLN-0264, anti-PSMA ADC, RG-7450, RG-7458, RG-7593, RG-7596, RG-7598, RG-7599, RG-7600, RG-7636, ABT-414, IMGN-853, IMGN-529, martin-Wauterotuzumab (voretuzumab) and Moxing-Lovoruzumab (lorvovatuzumab). In some embodiments, as set forth herein, the chemotherapeutic agent may be or comprise farnesyl-thiosalicylic acid (FTS), 4- (4-chloro-2-methylphenoxy) -N-hydroxybutyramide (CMH), estradiol (E2), tetramethoxystilbene (TMS), delta-tocotrienol, salinomycin, or curcumin.

One or more of the above agents may be used in combination with the agents for inhibiting CREPT of the present invention.

Preventing or preventing: the terms "prevent" and "prevention" as used herein in relation to the occurrence of a disease, disorder or condition refer to reducing the risk of the occurrence of the disease, disorder or condition; delaying the onset of a disease, disorder, or condition; delaying the onset of one or more characteristics or symptoms of a disease, disorder, or condition; and/or reducing the frequency and/or severity of one or more features or symptoms of a disease, disorder or condition. Prevention may refer to prevention of a particular subject or to a statistical effect on a population of subjects. Prevention may be considered complete when the onset of the disease, disorder or condition is delayed by a predetermined period of time.

Treatment: as used herein, the term "treating" or "treatment" refers to administering to partially or completely alleviate, ameliorate, alleviate, inhibit, delay the onset of, reduce the severity of, and/or reduce the incidence of one or more symptoms, characteristics, and/or causes of a particular disease, disorder, or condition, or for the purpose of achieving any such result. In some embodiments, for example, as set forth herein, such treatment may be for subjects who do not exhibit signs of the relevant disease, disorder, or condition and/or subjects who exhibit only early signs of the disease, disorder, or condition. Alternatively or additionally, such treatment may be directed to a subject exhibiting one or more defined signs of the associated disease, disorder, and/or condition. In some embodiments, for example, as set forth herein, a treatment can be directed to a subject that has been diagnosed with a related disease, disorder, and/or condition. In some embodiments, for example, as set forth herein, treatment may be directed to a subject known to have one or more susceptibility factors that are statistically correlated with an increased risk of developing the associated disease, disorder, or condition. In various examples, the treatment is for cancer.

In some embodiments, the invention can more effectively and accurately achieve prevention and treatment of cancer recurrence by identifying areas of elevated CREPT expression and specifically inhibiting CREPT.

Variants: as used herein, the term "variant" refers to an entity that exhibits significant structural identity to a reference entity but that differs structurally from the reference entity in the presence, absence, or level of one or more chemical moieties as compared to the reference entity. In some embodiments, for example, the variants are also functionally different from their reference entities, as proposed herein. In general, whether a particular entity is properly considered a "variant" of a reference entity depends on the degree to which it shares structural identity with the reference entity. A variant may be a molecule that is equivalent to, but not identical to, a reference. For example, a variant nucleic acid may differ from a reference nucleic acid at one or more differences in nucleotide sequence. In some embodiments, for example, as set forth herein, a variant nucleic acid exhibits an overall sequence identity of at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99% to a reference nucleic acid. In many embodiments, for example, as set forth herein, a nucleic acid of interest is considered a "variant" of a reference nucleic acid if it has a sequence that is identical to the reference sequence but with a small amount of sequence change at a particular position. In some embodiments, for example, as set forth herein, a variant has 10, 9, 8, 7, 6, 5, 4,3, 2, or 1 substituted residues as compared to a reference. In some embodiments, for example, as set forth herein, a variant has no more than 5, 4,3, 2, or 1 residue additions, substitutions, or deletions compared to a reference. In various embodiments, for example, as set forth herein, the number of additions, substitutions, or deletions is less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and typically less than about 5, about 4, about 3, or about 2 residues.

The inhibition of CREPT in the invention can target CREPT wild-type or CREPT variants as defined above.

Cancer patients are known in the art to have a high risk of in situ recurrence, and studies have reported that exosomes secreted by tumors have a correlation with regional canceration, while tumor exosomes have been reported to induce malignant transformation of normal epithelial cells. The research of the inventor finds that the expression of CREPT in tumor tissues is increased in the process that tumors induce paracancerous normal tissues to generate gradual canceration through exosomes, and the increase of inflammatory factors and subsequent determined cell canceration are involved in the process that the expression of CREPT in normal tissues is increased, so that CREPT can be considered as a potential regulatory factor of regional canceration and possibly become an important target of tumor in-situ recurrence, and a new scheme is provided for preventing and treating the tumor in-situ recurrence. CREPT is a potential regulatory factor for regional canceration, can cause cell malignancy by triggering tissue inflammation and subsequent canceration, so CREPT is involved in an early stage of tumor recurrence in situ, namely, inflammation and canceration can be used as a target for preventing cancer occurrence and/or recurrence in situ at a very early stage.

Under the condition of guessing that tumor exosomes are probably important reasons for generating canceration of a cancer-adjacent tissue area, the invention discovers a mechanism of increasing the expression of CREPT in a tumor tissue.

The research of the invention finds that the CREPT expression level in the cancer side tissue close to the tumor tissue is increased, while the CREPT of the normal tissue far away is still low. The invention provides that the expression of the paracancerous CREPT has a distance effect, namely the paracancerous CREPT is related to the distance of an in-situ tumor, the CREPT expression level of a part which is closer to the in-situ tumor is higher, and the CREPT expression level of a part which is farther from the in-situ tumor is lower, so that the CREPT of a paracancerous tissue is proved to be possibly influenced by a certain factor from the in-situ tumor.

In the case of increased CREPT expression in paracancerous tissues, these tissues with increased CREPT expression include atypical hyperplastic (i.e., pathologically distinct from normal tissues) tissues, and tissues in which the gene expression profile is changed precancerously but the pathology is not yet changed (hereinafter referred to as pathological tissues in which the gene expression is changed precancerously).

The invention discovers that the atypical hyperplastic tissue and the pathological tissue with the gene expression undergoing the precancerous change have the canceration potential, thereby causing the recurrence of the cancer.

Therefore, the invention provides that potential malignant cells can be more accurately identified by identifying the atypical hyperplastic tissue with increased CREPT expression and the pathological tissue with the gene expression with increased CREPT expression undergoing precancerous change, thereby realizing more accurate guidance on the incisional margin of cancer surgery.

As described above, atypical proliferative tissues with increased CREPT expression, as well as pathological tissues with precancerous changes in the expression of genes with increased CREPT expression, have the potential to become cancerous, leading to the recurrence of cancer. Therefore, inhibition of CREPT in paracancerous normal tissues can prevent recurrence of cancer.

TNFR2 induces NF- κ B activation in epithelial cells, thereby leading to carcinogenesis in animal models of chronic inflammation (Nagaishi et al, 2016, unizawa et al, 2009, zuki et al, 2014. Therefore, the expression of TNFR2 is closely related to the degree of malignancy of the cell.

According to the existing research reports, regional canceration may be caused by inflammatory or hypoxic environment created by tumor tissues.

The research of the invention finds that the tumor exosome mainly induces the inflammatory reaction of normal epithelial cells and mainly activates a TNF signal channel. CREPT was subsequently found to modulate signaling pathways such as TNF, MAPK, PI3K-AKT, and the like. Further, it was found that the knockout of CREPT inhibited the increase of TNFR2 expression level in TNF signaling pathway and the activation of NF-kB, ERK, AKT downstream thereof.

Thus, tumor exosomes were found to elicit an inflammatory response in normal epithelial cells and promote expression of CREPT. The high expression of CREPT further promotes the activation of survival-related signals (such as ERK, AKT and NF-kB) at the downstream of a TNF signal channel, thereby improving the viability of cells and breaking the balance of survival and apoptosis. TNF signaling is a "double-edged sword" for cells, but in the presence of CREPT, TNF signaling can promote cell proliferation and even carcinogenesis.

Therefore, the CREPT inhibitor can inhibit the paracancer normal tissue from generating inflammation by inhibiting CREPT in the paracancer normal tissue, thereby inhibiting the relapse of cancer at an earlier stage; and can prevent the recurrence of cancer, particularly in situ recurrence of cancer. Accordingly, the present invention provides the following exemplary embodiments.

[ method for preventing recurrence of cancer ]

In other embodiments of the present invention, there is provided a method of preventing cancer recurrence, the method comprising: inhibiting CREPT in a subject in need thereof, the recurrence preferably being in situ.

Recurrence in situ means that the recurrent tumor is at the same site as or very close to the primary tumor, with or without distant diffuse metastasis. The cancer relapsed in situ belongs to local tumor, and clinically, according to the disease condition of a patient, the method disclosed by the invention can reduce the risk of in situ relapse by adopting local treatment such as surgery and radiotherapy or combined treatment such as chemotherapy and the like, so that the clinical cure time and survival time of the cancer patient are improved.

In some embodiments of the methods of preventing cancer relapse described herein, inhibition of CREPT is achieved by administering to the subject: vectors carrying nucleic acid fragments that inhibit CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; targeting one or more of a small molecule inhibitor of CREPT.

In some embodiments of the invention, the vector carrying the nucleic acid fragment that inhibits CREPT transcription can be a vector used in the art to carry nucleic acid fragments and deliver the nucleic acid fragments into cells or into the human body, and can be, for example, liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses.

Recombinant viral vectors have been used for the transfer of nucleic acids by introducing the nucleic acid into an organism via the entry pathway of the parent virus, thereby effecting interaction of the nucleic acid with a target gene sequence or regulatory sequence in the target cell, resulting in reduced expression of a gene such as CREPT.

Nucleic acids against CREPT, such as interfering RNA, siRNA, shRNA and aptamers. According to the discovery of the prevention of CREPT inhibition of the present invention, bioinformatics can be used to design nucleic acids, such as interfering RNA, siRNA, shRNA and aptamers, against CREPT gene itself or its expression regulatory sequences, that reduce CREPT expression.

Macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT. In addition, according to the discovery of the invention for inhibiting CREPT prevention, a macromolecular inhibitor targeting CREPT can be found as a preventive macromolecular drug based on screening of phage display libraries, animal immunization methods, or antibody, e.g., monoclonal antibody libraries.

Small molecule inhibitors targeting CREPT are, for example, CRi-2 inhibitors. In addition, according to the discovery of preventability of the CREPT inhibition, the CREPT protein active site and the three-dimensional structure can be combined according to chemical biology, bioinformatics and the like, a small-molecule inhibitor targeting CREPT can be designed, and preventable small-molecule drugs can be identified through high-throughput screening.

In some embodiments of the methods of prevention described herein, the inhibition of CREPT is performed locally or systemically in the subject. For example by oral or parenteral administration, which may be in solid or liquid form, for example, by intravenous, subcutaneous, intramuscular, or intraperitoneal injection. The concentration or amount administered can be selected based on the age, weight, particular condition, and route of administration of the patient to achieve a prophylactic effect.

In some embodiments of the methods of preventing according to the invention, the cancer or carcinoma is a solid cancer, such as cervical, breast, ovarian, melanoma, colon cancer.

In some embodiments of the invention, the subject is a human, preferably a human having cancer, preferably a human treated for cancer, preferably a human having undergone surgical resection of cancer.

In some embodiments of the invention, the CREPT variant is a mutant that has greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% homology to CREPT.

[ use of CREPT-inhibiting Agents for the preparation of a medicament for the prevention of cancer recurrence ]

In other embodiments of the invention, there is provided the use of an agent that inhibits CREPT in the preparation of a medicament for the prevention of recurrence of cancer, preferably recurrence in situ.

Recurrence in situ means that the recurrent tumor is at the same site or very close to the primary tumor, with or without distant diffuse metastasis. The cancer relapsed in situ belongs to local tumor, and clinically, according to the disease condition of a patient, the local treatment of operation and radiotherapy or combined treatment such as chemotherapy is adopted, and according to the application of the invention, the CREPT inhibition can reduce the risk of in situ relapse, thereby improving the clinical cure time and survival time of the cancer patient.

In the application of the CREPT-inhibiting agent in the preparation of the drugs for preventing, inhibiting canceration of paracancerous normal tissues or inhibiting inflammation of paracancerous normal tissues, the CREPT-inhibiting agent is a vector carrying a nucleic acid segment for inhibiting CREPT transcription, such as liposome, adenovirus, adeno-associated virus, lentivirus and retrovirus; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; one or more small molecule inhibitors that target CREPT.

In some embodiments of the uses of the invention, the medicament is administered to a subject who has undergone other treatments for cancer.

In some embodiments of the uses of the present invention, the other treatment of cancer comprises surgery, radiation therapy and/or chemotherapy.

In some embodiments of the uses of the invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab.

In some embodiments of the uses of the present invention, the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

[ drugs for preventing cancer recurrence ]

In other embodiments of the invention, there is provided a medicament for preventing the recurrence of cancer comprising an agent that inhibits CREPT.

In some embodiments of the agents of the invention, the CREPT-inhibiting agent inhibits transcription of a CREPT gene, inhibits expression of a CREPT gene, inhibits function of a CREPT protein, and/or promotes degradation of a CREPT protein.

The inhibition of transcription of the CREPT gene is a process of inhibiting transcription of a CREPT or variant-encoding gene thereof into mRNA.

The inhibition of the expression of the CREPT gene is a process of inhibiting the translation of CREPT or a variant-encoding mRNA thereof into CREPT or a variant thereof.

The function of inhibiting CREPT protein comprises inhibiting the activity of CREPT protein or inhibiting the combination of CREPT protein and its target binding agent.

The promotion of degradation of a CREPT protein includes increasing the level and activity of proteases that can degrade the CREPT protein.

In some embodiments of the medicament of the present invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab.

In some embodiments of the medicaments of the present invention, the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

In some embodiments of the agents of the invention, the agents are administered concurrently with the one or more cancer therapeutic agents and/or with the one or more inflammation inhibitory agents, or separately, as a combination drug.

When the CREPT-inhibiting agent is administered separately from the cancer therapeutic/inflammatory inhibitors, the interval between administration of the two agents can be determined according to the particular circumstances of the subject, and can be, for example, 1 hour, 2 hours, 5 hours, 8 hours, 12 hours, 24 hours, 2 days, 3 days, 5 days, 7 days, 14 days, 30 days, etc. apart.

[ method for inhibiting canceration of paracancerous Normal tissue ]

In other embodiments of the present invention, there is provided a method of inhibiting the carcinogenesis of paracancerous normal tissue, said method comprising: inhibiting CREPT in a paracancerous normal tissue, preferably the recurrence is recurrence in situ, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In the present invention, the paracancerous tissue includes dysplastic tissue and/or paracancerous tissue in which the gene expression profile is precancerously altered but the pathology has not been altered. According to the following experimental studies of the present invention, it was confirmed that the expression level of CREPT is increased in the dysplastic tissue at the paracancer site as compared with the normal control tissue; and elevated levels of CREPT expression in paracancerous tissues that have precancerous changes in gene expression profiles but have not changed pathology, and undergo both inflammation and canceration.

In some embodiments of the methods of the invention for inhibiting the development of carcinogenesis in a paracancerous normal tissue, the inhibition of transcription and/or expression of CREPT is performed by administering to the subject: vectors carrying nucleic acid fragments that inhibit CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA, shRNA and aptamers; a macromolecular CREPT-targeted inhibitor, such as an antibody or antibody fragment of CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

In some embodiments of the invention, the vector carrying the nucleic acid fragment that inhibits CREPT transcription can be a vector used in the art to carry nucleic acid fragments and deliver the nucleic acid fragments into cells or into a human, and can be, for example, liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses.

Nucleic acids against CREPT, such as interfering RNA, siRNA, shRNA, and aptamers. According to the discovery that inhibiting CREPT can inhibit canceration of paracancerous normal tissues, bioinformatics can be used to aim at CREPT gene itself or expression regulatory sequences thereof to relate to nucleic acids such as interfering RNA, siRNA, shRNA and aptamer aiming at CREPT and reducing the expression of CREPT.

Macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT. In addition, according to the discovery that inhibiting CREPT can inhibit the canceration of paracancerous normal tissues, a macromolecular inhibitor targeting CREPT can be discovered according to a phage display library, an animal immunization method or screening of an antibody such as a monoclonal antibody library, so that the CREPT can be used as a macromolecular drug for inhibiting the canceration of paracancerous normal tissues.

Small molecule inhibitors targeting CREPT are, for example, CRi-2 inhibitors. In addition, according to the discovery that the CREPT inhibition can inhibit the canceration of the paracancer normal tissue, the CREPT protein active site and the three-dimensional structure can be combined according to the chemical biology, the bioinformatics and the like, the small molecule inhibitor targeting the CREPT is designed, and the small molecule drug capable of inhibiting the canceration of the paracancer normal tissue is identified through high-throughput screening.

In some embodiments of the methods of the invention for inhibiting carcinogenesis of paracancerous normal tissue, inhibition of transcription and/or expression of CREPT is performed locally or systemically in the subject. For example by oral or parenteral administration, which may be in solid or liquid form, for example, by intravenous, subcutaneous, intramuscular, or intraperitoneal injection. The concentration or amount administered can be selected based on the age, weight, particular condition, and route of administration of the patient to achieve a therapeutic effect in inhibiting canceration in paracancerous normal tissues.

In some embodiments of the methods of the invention for inhibiting the development of carcinogenesis from a paracancerous normal tissue, the cancer or carcinoma is a solid cancer, such as cervical cancer, breast cancer, ovarian cancer, melanoma, colon cancer.

In some embodiments of the invention, the subject is a human, preferably a human having cancer, preferably a human treated for cancer, preferably a human having undergone surgical resection for cancer.

[ use of CREPT-inhibiting agent for production of drug for inhibiting canceration of paracancerous normal tissue ]

In other embodiments of the invention, there is provided the use of an agent that inhibits CREPT in the preparation of a medicament for inhibiting canceration in a paracancerous normal tissue.

In the present invention, paracancerous normal tissues are cancerous at a stage where the gene expression profile is precancerously altered but the pathology has not yet been altered.

The increase is induced and promoted by tumor exosome, and belongs to regional canceration or canceration of normal tissues, and the inhibition of CREPT can cancerate paracancerous normal tissues.

In the use of the CREPT-inhibiting agent of the above embodiments of the invention for the preparation of a medicament for reducing cancer recurrence, inhibiting the carcinogenesis of paracancerous normal tissues, or inhibiting the inflammation of paracancerous normal tissues, the agent is a vector carrying a nucleic acid segment that inhibits CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

In some embodiments of the uses of the invention, the medicament further comprises one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

In some embodiments of the uses of the invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

[ drugs for inhibiting canceration of paracancerous normal tissues ]

In other embodiments of the invention, there is provided a medicament for the carcinogenesis of paracancerous normal tissue comprising an agent that inhibits CREPT.

The function of the CREPT protein can be inhibited by inhibiting the activity of the CREPT protein or inhibiting the combination of the CREPT protein and a target combination thereof.

[ method for inhibiting inflammation of a normal tissue adjacent to a cancer ], [ method for inhibiting or reversing atypical proliferation of a normal tissue cell ], [ method for inhibiting or reversing a precancerous lesion ], [ method for inhibiting or reversing abnormal proliferation of a normal tissue cell ], [ method for inhibiting or reversing canceration of a normal tissue cell by a tumor exosome ], [ method for promoting apoptosis of a tissue cell which is cancerated or inflamed ]

In other embodiments of the present invention, there is provided a method of inhibiting inflammation of paracancerous normal tissue, the method comprising: inhibiting CREPT in a paracancerous normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In other embodiments of the present invention, there is provided a method of inhibiting or reversing inflammation in paracancerous normal tissue, the method comprising: inhibiting CREPT in a paraneoplastic normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In other embodiments of the present invention, there is provided a method of inhibiting or reversing atypical hyperplasia of normal tissue cells, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In other embodiments of the present invention, there is provided a method of inhibiting or reversing a precancerous lesion, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In other embodiments of the present invention, there is provided a method of inhibiting or reversing abnormal proliferation of cells in a normal tissue, the method comprising: inhibiting CREPT in normal tissues, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In other embodiments of the present invention, there is provided a method of inhibiting or reversing the carcinogenesis of normal tissue cells by tumor exosomes, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In other embodiments of the present invention, there is provided a method of promoting apoptosis of a cancerous or inflammatory tissue, the method comprising: inhibiting CREPT in a cancerous or inflammatory tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

In some embodiments of the methods of the above embodiments of the invention, the inhibition of transcription and/or expression of CREPT is by administering to the subject: vectors carrying nucleic acid fragments that inhibit CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; a macromolecular CREPT-targeted inhibitor, such as an antibody or antibody fragment of CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

In some embodiments of the methods of the above embodiments of the invention, the vector carrying the nucleic acid fragment that inhibits CREPT transcription can be a vector used in the art to carry nucleic acid fragments and deliver the nucleic acid fragments into cells or into humans, and can be, for example, liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses.

In some embodiments of the methods of the above embodiments of the invention, the recombinant viral vector has been used for nucleic acid transfer by introducing the nucleic acid into an organism via an entry pathway of a parent virus, thereby effecting interaction of the nucleic acid with a target gene sequence or regulatory sequence in a target cell, resulting in reduced expression of a gene, such as CREPT.

In some embodiments of the methods of the above embodiments of the invention, nucleic acids directed to CREPT, such as interfering RNA, siRNA, shRNA, and aptamers. According to the discovery that the CREPT inhibition can inhibit the inflammation of paracancer normal tissues, bioinformatics can be used for aiming at CREPT gene or expression regulatory sequences thereof and relating to nucleic acid which is used for aiming at CREPT and reducing the expression of CREPT, such as interfering RNA, siRNA, shRNA and aptamer.

In some embodiments of the methods of the above embodiments of the invention, a macromolecular inhibitor of CREPT is targeted, e.g., an antibody or antibody fragment of CREPT. In addition, according to the discovery that inhibiting CREPT can inhibit the inflammation of paracancer normal tissues, a macromolecular inhibitor targeting CREPT can be discovered according to a phage display library, an animal immunization method or screening of an antibody such as a monoclonal antibody library, so that the CREPT can be used as a macromolecular drug for inhibiting the inflammation of paracancer normal tissues.

In some embodiments of the methods of the above embodiments of the invention, the small molecule inhibitor of CREPT is targeted, for example, a CRi-2 inhibitor. In addition, according to the discovery that the CREPT inhibition can inhibit the inflammation of the paracancer normal tissue, the CREPT protein active site and the three-dimensional structure can be combined according to chemistry and biology, bioinformatics and the like, a small molecule inhibitor targeting CREPT is designed, and a small molecule drug capable of inhibiting the inflammation of the paracancer normal tissue is identified through high-throughput screening.

In some embodiments of the methods of the above embodiments of the invention, the inhibition of transcription and/or expression of CREPT is performed locally or systemically in the subject. For example, by oral or parenteral administration, which may be in solid or liquid form, e.g., intravenous, subcutaneous, intramuscular, or intraperitoneal. The concentration or amount of administration can be selected based on the age, weight, particular condition of the patient, and the route of administration to achieve a therapeutic effect in inhibiting inflammation of normal tissue adjacent to the cancer.

In some embodiments of the methods of the above embodiments of the invention, the cancer or carcinoma is a solid cancer, such as cervical, breast, ovarian, melanoma, colon cancer.

In some embodiments of the methods of the above embodiments of the invention, the subject is a human, preferably a human having cancer, preferably a human that has been treated for cancer, preferably a human that has been surgically resected for cancer.

In some embodiments of the methods of the above embodiments of the invention, the CREPT variant is a mutant that is more than 85%, more than 90%, more than 95%, more than 98% or more than 99% homologous to CREPT.

[ application of CREPT-inhibiting agent in preparation of drugs for inhibiting inflammation of paracancerous normal tissues ], [ application of CREPT-inhibiting agent in preparation of drugs for inhibiting or reversing atypical hyperplasia of normal tissue cells ], [ application of CREPT-inhibiting agent in preparation of drugs for inhibiting or reversing precancerous lesions ], [ application of CREPT-inhibiting agent in preparation of drugs for inhibiting or reversing abnormal proliferation of normal tissue cells ], [ application of CREPT-inhibiting agent in preparation of drugs for inhibiting tumor exosomes from cancerating normal tissue cells ], [ application of CREPT-inhibiting agent in preparation of drugs for promoting apoptosis of cancerated or inflamed tissue cells ]

In other embodiments of the invention, there is provided the use of an agent that inhibits CREPT in the preparation of a medicament for inhibiting inflammation of paracancerous normal tissue.

In other embodiments of the invention, there is provided the use of an agent that inhibits CREPT in the preparation of a medicament for inhibiting or reversing the atypical proliferation of normal tissue cells.

In other embodiments of the invention, there is provided the use of an agent that inhibits CREPT in the preparation of a medicament for inhibiting or reversing precancerous lesions.

In other embodiments of the invention, there is provided the use of an agent that inhibits CREPT in the preparation of a medicament for inhibiting or reversing abnormal proliferation of cells in normal tissue.

In other embodiments of the invention, there is provided the use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting the carcinogenesis of normal tissue cells by tumor exosomes.

In other embodiments of the invention, there is provided the use of an agent that inhibits CREPT in the preparation of a medicament for promoting apoptosis in cancerous or inflammatory tissue.

In some examples of uses of the above embodiments of the invention, in the use of an agent that inhibits CREPT in the above embodiments of the invention in the preparation of a medicament for reducing cancer recurrence, inhibiting the carcinogenesis of normal tissues adjacent to cancer, or inhibiting the inflammation of normal tissues adjacent to cancer, the agent is a vector carrying a nucleic acid fragment that inhibits CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; one or more small molecule inhibitors that target CREPT.

In some embodiments of the use of the above embodiments of the invention, the medicament is administered to a subject who has undergone other treatments for cancer.

In some embodiments of the use of the above embodiments of the present invention, the other treatment of cancer comprises surgery, radiation therapy and/or chemotherapy.

In some embodiments of the use of the above embodiments of the present invention, the medicament further comprises one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

In some embodiments of the use of the above embodiments of the present invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

In some embodiments of the use of the above embodiments of the present invention, the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

In some embodiments of the use of the above embodiments of the present invention, the subject is a human, preferably a human having cancer, preferably a human having been treated for cancer, preferably a human having been surgically resected for cancer.

In some embodiments of uses of the above embodiments of the invention, the CREPT variants are mutants with greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% homology to CREPT.

[ drugs inhibiting inflammation of paracancerous normal tissues ], [ drugs inhibiting or reversing atypical hyperplasia of normal tissue cells ], [ drugs inhibiting or reversing premalignant lesions ], [ drugs inhibiting or reversing abnormal proliferation of normal tissue cells ], [ drugs inhibiting tumor exosomes from carcinogening normal tissue cells ], [ drugs promoting apoptosis of cancerous or inflammatory tissue cells ]

In other embodiments of the invention, there is provided a medicament for inhibiting inflammation of paracancerous normal tissue, the medicament comprising an agent that inhibits CREPT.

In other embodiments of the invention, there is provided a medicament for inhibiting or reversing the atypical proliferation of cells in normal tissue, said medicament comprising an agent that inhibits CREPT.

In other embodiments of the invention, there is provided a medicament for inhibiting or reversing precancerous lesions, the medicament comprising an agent that inhibits CREPT.

In other embodiments of the invention, there is provided a medicament for inhibiting or reversing abnormal proliferation of cells in normal tissues, said medicament comprising an agent that inhibits CREPT.

In other embodiments of the invention, there is provided a medicament for inhibiting the carcinogenesis of normal tissue cells by tumor exosomes, comprising an agent that inhibits CREPT.

In other embodiments of the invention, there is provided a medicament for promoting apoptosis in cancerous or inflammatory tissue, the medicament comprising an agent that inhibits CREPT.

In some embodiments of the medicaments of the above embodiments of the invention, the CREPT-inhibiting agent inhibits transcription of a CREPT gene, inhibits expression of a CREPT gene, inhibits function of a CREPT protein, and/or promotes degradation of a CREPT protein.

In some embodiments of the medicaments of the above embodiments of the invention, the inhibition of transcription of the CREPT gene is a process of inhibiting transcription of the CREPT or variant encoding gene thereof into mRNA.

In some embodiments of the medicaments of the above embodiments of the invention, the inhibition of the expression of the CREPT gene is a process that inhibits the translation of CREPT or a variant thereof encoding mRNA into CREPT or a variant thereof.

In some embodiments of the medicaments of the above embodiments of the invention said inhibition of the function of a CREPT protein comprises inhibition of the activity of a CREPT protein or inhibition of binding of a CREPT protein to its target conjugate.

In some embodiments of the agents of the above embodiments of the invention, said promoting the degradation of CREPT protein comprises increasing the level and activity of a protease that can degrade CREPT protein.

In some embodiments of the medicament of the above embodiments of the present invention, the medicament further comprises one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

In some embodiments of the medicament of the above embodiments of the present invention, the one or more cancer therapeutic agents are selected from: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

In some embodiments of the medicament of the above embodiments of the present invention, the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

In some embodiments of the medicaments of the above embodiments of the invention, the medicaments are administered as a combination medicament, either simultaneously with the one or more cancer therapeutic agents and/or with the one or more inflammation inhibitory agents, or separately.

In some embodiments of the medicaments of the above embodiments of the invention, when the CREPT-inhibiting agent is administered separately from the cancer therapeutic/inflammatory inhibitors, the interval between administration of the two agents can be determined, for example, 1 hour, 2 hours, 5 hours, 8 hours, 12 hours, 24 hours, 2 days, 3 days, 5 days, 7 days, 14 days, 30 days, etc., as appropriate to the particular subject.

Examples

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results were averaged.

[ test materials ]

1 Experimental animals and cells

7 cell lines are used in total, namely a mouse mammary gland epithelial cell NMuMG, a mouse breast cancer cell 4T1, a hamster ovary epithelial cell CHO, a human mammary gland epithelial cell MCF10A, a human breast cancer cell MDA-MB-231, a human breast cancer cell MCF7 and a human breast cancer tamoxifen drug-resistant cell line MCF7/TAM-R.

The animals used in the experiment are BALB/c nude mice purchased from the experimental animal platform of Qinghua university.

2 plasmid

Myc-CREPT on pcDNA3.1 vector, CRISPR/cas9 mediated CREPT knock-out plasmid PX458 (the gRNA sequence is shown below) and CREPT knock-down shRNA (the sequence is shown below) were used to construct and store in the laboratory.

Knocking out CREPT: CRISPR-CAS9

Guide RNAs (gRNAs): ATCGTCCCGTGTGGCACCG (see, SEQ ID NO: 2); CGTGCCGTCGCTCTTCCCGC (see SEQ ID NO: 3)

Knockdown of CREPT/shRNA

TRCN0000148750 CCGGCGGCAGCAGTATTCTGAAACTCGAGTTTCAGAATATACTGCTGCCGTTTTTTG (see, SEQ ID No.: 4)

TRCN0000149087 CCGGGCACGAAGATTAGGTGCATTTTCGAGAATGCACCTATTCGTTGCTTTTTTG (see, SEQ ID NO: 5)

Knockdown CREPT: siRNA

GCAAGAACGAAGUGUUATT (see, SEQ ID NO. 6)

GUCUGUUACUAGCAGAAUATT (see, SEQ ID NO: 7)

3 antibodies

Antibodies against β -catenin (# 8480), ERK1/2 (# 4695), p-Akt (Ser 473, # 9271), akt (# 9272), p-p38 (Thr 180/Tyr182, # 4511), p38 (# 8690), p-JNK (Thr 183/Tyr185, # 9255), JNK (# 9252), p-p65 (Ser 536, # 3033), p65 (# 8242), and past 3 (# 9662) were purchased from Cell Signaling Technology. anti-p-ERK 1/2 (# sc-7383) antibody was from Santa Cruz Biotechnology. anti-Actin (a 5316) antibody was from Sigma. CREPT antibody (3E 10) was produced by this experiment (Ren et al, 2014). Horseradish peroxidase (HRP) -labeled goat anti-mouse (ZB-2305) and goat anti-rabbit IgG (ZB-2301) were purchased from China fir Jinqiao.

4 reagent

DMEM (C11995500 BT), horse serum (26050088), pancreatin (Trypsin-EDTA, 25200056), penicillin/streptomycin (15140122) and PBS powder (21600044) for cell culture were purchased from Thermo Fisher. Fetal Bovine Serum (FBS) was purchased from BI corporation. Insulin (CC 101), cholera toxin (CC 104), epidermal Growth Factor (EGF) (CC 102), hydrocortisone (CC 103), and phenol red-free DMEM/F12 medium (CM 16405) were purchased from Kyoho (Beijing) science and technology Co.

In addition, an RNA extraction reagent (TRIzol, 15596018), a protein molecular weight marker (protein ladder, 26617) and a chemiluminescent (ECL) substrate (34577) were purchased from Thermo Fisher, and a FastKing cDNA first strand synthesis kit (KR 116) and a fluorescent quantitative detection kit (FP 209) were purchased from Tiangen Biochemical technology (Beijing) Ltd. Efficient eukaryotic transfection reagents Vigofect and dual-luciferase reporter gene detection kits are purchased from Wegener biotechnology (Beijing) Co., ltd. CCK-8 kit (GB 707) was purchased from Dojindo, homopren, japan. The primers were synthesized by Biotechnology of Boxing Ke, beijing Rui.

CREPT qPCR primer

Example 1 immunohistochemical staining indicates elevated CREPT expression in paracancerous dysplastic tissue and in partially pathologically normal tissue

Immunohistochemical staining experiments were performed in different types of tumor sections with para-carcinoma tissues using CREPT antibody (3E 10) (Ren et al, 2014) to detect CREPT expression.

The samples used in the experiment were from ductal breast cancer (a in fig. 1), lobular breast cancer (B in fig. 1), cervical cancer (a in fig. 2) and colon cancer (B in fig. 2).

The immunohistochemical section adopts the steps of section baking, dewaxing and rehydration, section washing, antigen retrieval, sealing, primary antibody combination (the primary antibody of China fir Jinqiao company, the dilution multiple of a CREPT antibody is 50 times), secondary antibody combination (HRP coupling mouse/rabbit universal secondary antibody (Envision) produced by Dako company), DAB dyeing, nucleus staining, dehydration and transparentization, section sealing, and then the section is placed on a section rack to be dried overnight.

Finally, the slices were scanned, and the results are shown in fig. 1a and fig. 1B and fig. 2 a and fig. 2B, and the results were analyzed.

And (4) conclusion:

a phenomenon of elevated CREPT expression levels was found in the paraneoplastic tissue of ductal breast cancer (a of fig. 1). Careful observation of the sections revealed that the CREPT of the tumor tissue appeared positive (a in a of fig. 1); the increase of CREPT expression level occurred in part of cells of a vessel closer to the tumor tissue in the paracarcinoma tissue, and at the same time, the tissue morphology of the vessel was changed-internal consolidation, indicating that the tissue was dysplastic (b in FIG. 1A); slightly distal catheter, which exhibited positive CREPT expression by a peripheral ring of myoepithelial cells (c in a of fig. 1); while more distant normal tissues are completely free of CREPT expression (d in a of fig. 1). Similarly, in breast lobular carcinoma sections, CREPT was found to be highly expressed in tumor tissues (a in B of fig. 1). Increased CREPT expression was observed in both the lobule near the tumor tissue (B in fig. 1B) and the lobule slightly distant (c in fig. 1B) near the tumor tissue, and the part of the lobule near the tumor tissue was hyperplastic. While the more distal leaflet CREPT expression level was lower (d in B of fig. 1). Further, this phenomenon was also found in cervical cancer (a of fig. 2) and colon cancer (B of fig. 2), with elevated CREPT expression levels in the paraneoplastic tissue near the tumor tissue (B, c in a of fig. 2 and B, c in B of fig. 2), while CREPT expression in the more distant normal tissue was negative (d in a of fig. 2 and d in B of fig. 2).

Example 2 inhibition of CREPT inhibits the canceration of tumor exosomes on normal epithelial cells

2.1. Extraction and identification of exosomes

The exosomes used were derived from mouse breast cancer cell 4T 1and human breast cancer cell MDA-MB-231 (purchased from ATCC), and exosome extraction was performed by conventional differential ultracentrifugation, i.e., supernatant was prepared, impurities were removed, exosomes were extracted by ultracentrifugation, and then stored: the PBS resuspended exosomes can be stored briefly at 4 ℃, for functional validation experiments within a week, or for long periods at-80 ℃.

The exosome particle size distribution and particle concentration were analyzed using NanoSight LM14 (Malvern Panalytical, UK) equipped with a Nanoparticle Tracking Analysis (NTA) system. Data acquisition and analysis were performed using NTA analysis software version 3.1. The analysis result shows that the particle size distribution of the extracted product is between 30 and 200nm and accords with the characteristic of the particle size distribution of exosome (figure 3).

2.2. The process of promoting cell cancerization by tumor exosome is accompanied by the increase of CREPT expression level

2.2.1 the effect of tumor exosome treatment on cell clonogenic was assessed by plate clonogenic experiments.

Using PBS or 1X 10 ⁹ Normal mammary epithelial cells NMuMG or MCF10A were treated for two weeks with individual particles/mL 4T1 cell-derived exosomes or MDA-MB-231 derived exosomes, followed by depletion of exosomes and cell culture using normal medium. Clonogenic experiments using cells treated with control PBS or tumor exosomesThe ability of the cells to form clones was judged by the number of colonies formed.

The operation steps comprise: 1. cell suspensions were prepared and 500 or 1000 cells were seeded per well in six-well plates. Each group has 3 multiple holes; culturing for 7-14 days, and changing the liquid every three days; after the formation of colonies visible to the naked eye, the medium was removed, washed once with PBS, and the colonies were stained by addition of 0.1% crystal violet (dissolved in methanol to give a 0.5% stock solution and diluted with distilled water before use); standing at room temperature for 15min, discarding the staining solution, and washing with distilled water to clean the background; airing; records were scanned and analyzed using ImageJ software.

The experimental results show that the breast tumor exosome can promote the clone formation of normal breast epithelial cells, namely, the cell proliferation capacity is enhanced, and the breast tumor exosome is a phenotype of regional canceration (figure 4).

2.2.2 tumor exosomes promote the increase of the levels of CREPT and canceration markers p-ERK, p-p38, p-JNK, p-AKT, p-p65 and beta-catenin in the canceration process of cells

The CREPT expression level, the key cancer promotion signal molecules MAPKs (including ERK, p38 and JNK), the phosphorylation levels of AKT and NF-kB and the protein level of beta-catenin in the treatment process of tumor exosomes are detected by adopting a classical immunoblotting experiment (Western Blotting, WB). The results were visualized, observed and recorded using a MiniChemi610 imaging system (Sagecreation Service For Life Science).

Experimental results show that during the process of inducing normal epithelial cell canceration by tumor exosome, the expression level of CREPT is obviously increased, and the phosphorylation levels of cancer signal molecules MAPKs, AKT and NF-kB and the protein level of beta-catenin are also increased (figure 5).

This means that tumor exosomes can promote canceration of normal epithelial cells, and this process is accompanied by an increase in the expression level of CREPT, which is involved in the process of cell canceration. Thus, elevated CREPT expression is an early molecular indicator and therapeutic target for inflammation and carcinogenesis in tissues adjacent to cancer.

2.3 inhibition of CREPT inhibits the canceration of tumor exosomes on normal epithelial cells

Cell proliferation experiments, colony formation experiments and tumor formation experiments prove that the inhibition of CREPT can inhibit canceration of normal cells caused by tumor exosomes (figure 6 and figure 7). After a wild type NMuMG cell (NMuMG-WT) is treated by a 4T1 exosome (4T 1 EXO), the proliferation capacity of the wild type NMuMG cell is obviously improved; after the CREPT knockout NMuMG (NMuMG-KO) is treated by 4T1EXO, the proliferative capacity of the CREPT knockout NMuMG (NMuMG-KO) is not obviously changed (A in figure 6), namely the response to the stimulation of the exosome is lost. Similarly, the clonogenic capacity of NMuMG-WT was also significantly improved after 4T1EXO stimulation, whereas NMuMG-KO was not significantly changed after 4T1EXO stimulation (FIGS. 6B and C). Similarly, in MCF10A cells treated with MDA-MB-231 exosomes (231 EXO), knockout of CREPT also inhibited the tumor exosome's promoting effect on clonogenic (FIG. 8). Further, a nude mouse tumorigenesis experiment is carried out on NMuMG-WT and NMuMG-KO cells treated by 4T1EXO, and the result shows that 4T1EXO can promote tumorigenesis of NMuMG-WT; NMuMG nodulation was reduced following CREPT knockout, as indicated by a reduction in tumor volume and mass, while 4T1EXO no longer promoted NMuMG nodulation (fig. 6D, E). The three experiments prove that the cancer effect of tumor exosomes on normal epithelial cells can be inhibited by inhibiting CREPT.

In addition, CREPT knock-out also increased the apoptotic marker clear-Caspase 3 in NMuMG cells after 4T1EXO treatment (F in fig. 6), which means CREPT also had an effect on apoptosis of cells. When tumor exosomes treat normal epithelial cells, clear caspase3 is reduced, i.e. apoptosis of the cells is inhibited, which corresponds to reduced apoptosis of the cells during regional canceration. While the knockout of CREPT enhanced apoptosis, i.e., also affected the canceration of the cells.

Meanwhile, the phosphorylation levels of NF-kB, middle ERK and AKT of cells after CREPT knockout are detected. As a result, the knockout of CREPT also inhibits the increase of NF-kB, ERK and AKT phosphorylation stimulated by tumor exosomes.

The above results indicate that inhibition of CREPT can prevent tumor exosome-induced canceration of normal epithelial cells. Similarly, inhibition of CREPT could prevent tumor exosome-induced canceration of paracancerous tissues, i.e., inhibition of CREPT could inhibit tumor recurrence in situ to some extent (fig. 6,7, 8).

Example 3 cell proliferation assay-CREPT knockdown affects the proliferative capacity of normal epithelial cells; CREPT overexpression promotes tumorigenesis in CHO cells in mice.

Respectively overexpress CREPT with Myc label in CHO cells, NMuMG cells and MCF10A cells, and obtain the product by neomycin screeningStably overexpressed cell lines(CHO-OE, NMuMG-OE, MCF10A-OE, the control is CHO-EV, NMuMG-EV, MCF10A-EV respectively), in addition, CRISPR-Cas9 system is used to establishCREPT knockout cell lines(CHO-KO, NMuMG-KO, MCF10A-KO, controls CHO-WT, NMuMG-WT, MCF10A-WT, respectively) (A, B, C in FIG. 9).

This example uses the routine protocol in the art to perform a CCK-8 (Cell Count Kit-8) experiment.

Growth curves were plotted in days on the abscissa by the CCK-8 experiment to examine the proliferative capacity of these cells. The results showed that overexpression of CREPT promoted cell proliferation, while knockout of CREPT inhibited cell proliferation (D, E, F in FIG. 9). Surprisingly, the tumorigenic capacity of CHO cells was promoted when CREPT was overexpressed in hamster ovary epithelial CHO cells (fig. 10), meaning that overexpression of CREPT promoted malignant transformation of CHO cells. The above results indicate that CREPT not only affects the proliferative capacity of normal cells but also promotes canceration of normal cells.

CREPT was found in cell proliferation experiments as a tumor-promoting protein and tumor marker, and its increase means that normal cells are likely to undergo malignant changes (FIGS. 5, 9, 10). Unpublished data in the laboratory indicate that the early canceration of normal cells is accompanied by an increase in the expression level of CREPT during tumorigenesis. The CREPT over-expression can promote the proliferation and tumorigenicity of normal epithelial cells, and combined with the phenomenon that tissues with increased paracancerous CREPT expression are accompanied by atypical hyperplasia, the fact that the increased CREPT expression level promotes regional canceration of normal tissues, and the regional canceration of normal cells means that the cells are at a very high canceration risk is proved.

Example 4 involvement of CREPT in the inflammatory response regulated by tumor exosome-induced TNF signaling pathway

Changes in the transcriptome of CREPT knockout cells following tumor exosome stimulation were compared to changes in the transcriptome of wild type cells. As a result, 2140 (94.0%) of the 2276 upregulated genes of MCF10A cells were no longer significantly elevated after CREPT knockout, and 380 (56.8%) of the 669 upregulated genes of nmugg cells were not upregulated after CREPT knockout, and the inventors considered that these genes that were not upregulated after CREPT knockout were regulated directly or indirectly by CREPT.

Subsequently, the 2140 genes and 380 genes are respectively analyzed by KEGG, and signal channels of CREPT participating in regulation and control in the process of stimulating normal epithelial cell canceration by tumor exosomes are explored. The results indicate that the Pathways affected by both of them are the Pathways related to inflammation such as Cytokine-receptor interaction (Cytokine-Cytokine receptor interaction), TNF signaling pathway (TNF signaling pathway), AGE-RAGE signaling pathway (AGE-RAGE signaling pathway), and the Pathways related to tumorigenesis and development of tumors such as cancer signaling pathway (pathway in cancer), MAPK signaling pathway (MAPK signaling pathway), PI3K-AKT signaling pathway (PI 3K-AKT signaling pathway).

There were 31 genes upregulated in the TNF signaling pathway after stimulation with 231EXO in MCF10A, and 28 of them were regulated by CREPT, and the expression levels of these genes were plotted as a heat map (A in FIG. 11). The mRNA levels of TNFRSF1B, PIK3CD, JUN, TNF, NOD2 and CSF1 were examined and it was found that CREPT knock-out did suppress the increase in expression levels of these genes (FIG. 11B-F).

Similarly, nmugg cells were stimulated with 4T1EXO to upregulate 19 genes in the TNF signaling pathway, 8 of which were regulated by CREPT (fig. 12 a). The expression levels of TNFRSF1B and PIK3CD were affected by CREPT knock-out as verified by qPCR (B-C of fig. 12).

TNFR2 is one of two receptors for TNF, and is expressed on the surface of some tumor cells and some immunosuppressive cells, thereby promoting tumor proliferation and immune escape. TNFR2 promotes the development of tumors mainly by activating ERK, AKT, NF-kB, MLCK and the like, so that the activation of NF-kB, ERK and AKT can also be influenced by CREPT knockout.

Through Western blot detection, the phosphorylation levels of NF-kB, ERK and AKT in normal epithelial cells are obviously increased along with the increase of the treatment days of tumor exosomes, and the phosphorylation levels of NF-kB, ERK and AKT are obviously inhibited after CREPT knockout (figure 8). The results show that CREPT mainly participates in the activation of TNF signaling pathway in the process of inducing inflammatory reaction of normal epithelial cells by tumor exosomes.

Thus, tumor exosomes were found to elicit an inflammatory response in normal epithelial cells and promote expression of CREPT. The high expression of CREPT further promotes the activation of survival-related signals (such as ERK, AKT and NF-kB) at the downstream of a TNF signal pathway, thereby improving the survival capability of cells and breaking the balance of survival and apoptosis. That is, TNF signaling can promote cell proliferation and even carcinogenesis in the presence of CREPT.

Therefore, it is suggested that by inhibiting CREPT, inflammation of the paracancerous tissue can be reduced, thereby preventing cancer recurrence at an earlier stage.

Example 5 inhibition of CREPT can promote drug sensitivity of breast cancer cells to tamoxifen endocrine therapy.

The development of resistance to the first-line drug tamoxifen therapy remains a serious clinical problem in breast cancer management. Thus, the role of CREPT in tamoxifen resistant era positive breast cancer cells was first studied. It was found that CREPT was significantly up-regulated in tamoxifen-resistant strains of MCF-7 cells (MCF 7/TAM-R) (a of fig. 13), while knockdown of CREPT significantly inhibited the proliferation of MCF-7/TAM-R cells (B, C of fig. 13). Cell proliferation and apoptosis experiments showed that knocking down CREPT in MCF-7/TAM-R cells reduced the dose of 4-hydroxyttamoxifen required to induce apoptosis and decreased the IC50 value of 4-hydroxyttamoxifen (D, E of FIG. 13). The results indicate that inhibition of CREPT in combination with tamoxifen enhances the sensitivity of breast cancer drug treatment.

Thus, the present invention also encompasses regimens in which the CREPT inhibitor is combined with other anti-cancer agents, such as tamoxifen, to enhance the therapeutic effect.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

List of references:

amirad, F., pytak, P.A., sadeghiani-Pear, N., nguyen, J.P.T., double, E.L., jones, A.C., and Bisoffi, M. (2020).

Bertolini, I.S., ghosh, J.C., kossenkov, A.V., mulugu, S.S., krishn, S.R., vaira, V., qin, J.S., plow, E.F., languino, L.R., and Altieri, D.C. (2020) Small excellar vehicle Regulation of Mitochondrial Dynamics reproduction a Hypoxic turbine Microenviron.Dev. 55,163-177 e166.

Melo, s.a., sugimoto, h., O' Connell, j.t., kato, n., villanueva, a., vidal, a., qiu, l., vikin, e., perelman, l.t., melo, c.a., et al. (2014) Cancer exosomes per Cell-independent microRNA biogenesis and promoter tissue growth. Cancer Cell 26,707-721.

Nagaishi, t., watabe, t., jose, n., tokai, a., fujii, t., matsuoka, k., nagahori, m., ohtsuka, k., and Watanabe, m. (2016). B Activation in Influmormatory Bowel Diseases and collagen-Associated Cardigenesis, dictionary 93,40-46.

Onizawa, M.J., nagaishi, T.A., kanai, T.A., nagano, K.A., oshima, S.A., nemoto, Y.A., yoshioka, A.A., totsuka, T.A., okamoto, R.A., nakamura, T.A., 2009, et al (2009), signaling pathway via TNF-alpha/NF-kappa B in endogenous expression cells from a direct injected in color-analyzed carbon emission.

Patil,P.U.,D'Ambrosio,J.,Inge,L.J.,Mason,R.W.,and Rajasekaran,A.K.(2015).Carcinoma cells induce lumen filling and EMT in epithelial cells through soluble E-cadherin-mediated activation of EGFR.J Cell Sci 128,4366-4379.

Quail, D.F., and Joyce, J.A. (2013). Microenvironmental regulation of tumor progression and metastasis. Nat. Med 19,1423-1437.

Ren, F., wang, R., zhang, Y., liu, C., wang, Y., hu, J., zhang, L., and Chang, Z. (2014). Characterisation of a monoclonal antibody CREPT, a novel protein high expression expressed in tumors, monoclonal antibodies in immunological diagnosis and immunotherapy 33,401-408.

Slaugerter, D.P., southwick, H.W., and Smejkal, W. (1953.) Field localization in organic modified square epidermis; cancer 6,963-968.

Suzuki, m., nagaisi, t., yamazaki, m., onizawa, m., watabe, t., sakamaki, y, ichino, s, totsuka, m., osihima, s, okamoto, r., et al, (2014) myoin light chain enzyme expression induced vitamin tissue factor receptor 2 signaling in the exogenous cells regulation, plos e 9, eu88.

Wu, C.H., silver, C.R., messing, E.M., and Lee, Y.F. (2019) blade pigment isolated vehicles drive regulating by using the unfolded protein stress in end plastic diagnostic um of nonradioactive cells J Biol Chem 294,3207-3218.

Yoon, J.H., choi, B.J., nam, S.W., and Park, W.S. (2022) scientific cancers exosomes distribution to the field cancerization of scientific epitaxial cells with scientific cancers: of the International scientific Cancer Association and the Japanese scientific Cancer Association.

Yuan, d. Huang, s., berg, e., liu, l., gross, n., heinzmann, f., ringer han, m., connor, t.o., stadler, m., meister, m., et al (2017) Kupffer Cell-Derived Tnf triggerers chloingiocellular tungnesis through JNK due to Chronic mitochonic michrondrial Dysfunction and ros. Cancer Cell 31,771-789e776.

Sequence listing

<110> Qinghua university

<120> method, use and medicament for preventing recurrence of cancer, inhibiting or reversing inflammation and canceration of normal tissue

<130> GAI22CN4873

<160> 17

<170> PatentIn version 3.5

<210> 1

<211> 326

<212> PRT

<213> CREPT protein sequences

<223> human

<400> 1

Met Ser Ser Phe Ser Glu Ser Ala Leu Glu Lys Lys Leu Ser Glu Leu

1 5 10 15

Ser Asn Ser Gln Gln Ser Val Gln Thr Leu Ser Leu Trp Leu Ile His

20 25 30

His Arg Lys His Ala Gly Pro Ile Val Ser Val Trp His Arg Glu Leu

35 40 45

Arg Lys Ala Lys Ser Asn Arg Lys Leu Thr Phe Leu Tyr Leu Ala Asn

50 55 60

Asp Val Ile Gln Asn Ser Lys Arg Lys Gly Pro Glu Phe Thr Arg Glu

65 70 75 80

Phe Glu Ser Val Leu Val Asp Ala Phe Ser His Val Ala Arg Glu Ala

85 90 95

Asp Glu Gly Cys Lys Lys Pro Leu Glu Arg Leu Leu Asn Ile Trp Gln

100 105 110

Glu Arg Ser Val Tyr Gly Gly Glu Phe Ile Gln Gln Leu Lys Leu Ser

115 120 125

Met Glu Asp Ser Lys Ser Pro Pro Pro Lys Ala Thr Glu Glu Lys Lys

130 135 140

Ser Leu Lys Arg Thr Phe Gln Gln Ile Gln Glu Glu Glu Asp Asp Asp

145 150 155 160

Tyr Pro Gly Ser Tyr Ser Pro Gln Asp Pro Ser Ala Gly Pro Leu Leu

165 170 175

Thr Glu Glu Leu Ile Lys Ala Leu Gln Asp Leu Glu Asn Ala Ala Ser

180 185 190

Gly Asp Ala Thr Val Arg Gln Lys Ile Ala Ser Leu Pro Gln Glu Val

195 200 205

Gln Asp Val Ser Leu Leu Glu Lys Ile Thr Asp Lys Glu Ala Ala Glu

210 215 220

Arg Leu Ser Lys Thr Val Asp Glu Ala Cys Leu Leu Leu Ala Glu Tyr

225 230 235 240

Asn Gly Arg Leu Ala Ala Glu Leu Glu Asp Arg Arg Gln Leu Ala Arg

245 250 255

Met Leu Val Glu Tyr Thr Gln Asn Gln Lys Asp Val Leu Ser Glu Lys

260 265 270

Glu Lys Lys Leu Glu Glu Tyr Lys Gln Lys Leu Ala Arg Val Thr Gln

275 280 285

Val Arg Lys Glu Leu Lys Ser His Ile Gln Ser Leu Pro Asp Leu Ser

290 295 300

Leu Leu Pro Asn Val Thr Gly Gly Leu Ala Pro Leu Pro Ser Ala Gly

305 310 315 320

Asp Leu Phe Ser Thr Asp

325

<210> 2

<211> 20

<212> DNA

<213> knockout CREPT: CRISPR-CAS9 Guide RNAs

<400> 2

atcgtctccg tgtggcaccg 20

<210> 3

<211> 20

<212> DNA

<213> knockout CREPT: CRISPR-CAS9 Guide RNAs

<400> 3

cgtgccgtcg ctcttcccgc 20

<210> 4

<211> 59

<212> DNA

<213> knockdown CREPT: shRNA

<400> 4

ccggcggcag cagtatattc tgaaactcga gtttcagaat atactgctgc cgttttttg 59

<210> 5

<211> 59

<212> DNA

<213> knockdown CREPT: shRNA

<400> 5

ccgggcacga agattaggtg catttctcga gaaatgcacc taatcttcgt gcttttttg 59

<210> 6

<211> 20

<212> DNA

<213> knockdown CREPT: siRNA

<400> 6

gcaagaacga aguguuautt 20

<210> 7

<211> 21

<212> DNA

<213> knockdown CREPT: siRNA

<400> 7

gucuguuacu agcagaauat t 21

<210> 8

<211> 20

<212> DNA

<213> qPCR primer CREPT _ F1

<400> 8

tgtccctttg gctcatccac 20

<210> 9

<211> 20

<212> DNA

<213> qPCR primer CREPT _ R1

<400> 9

catctgcctc tctggcaaca 20

<210> 10

<211> 20

<212> DNA

<213> qPCR primer CREPT _ F2

<400> 10

ctccgcaaag ccaaatcaaa 20

<210> 11

<211> 20

<212> DNA

<213> qPCR primer CREPT _ R2

<400> 11

cgccatacac acttcgttct 20

<210> 12

<211> 21

<212> DNA

<213> qPCR primer CREPT _ F3

<400> 12

gctccgcaaa gccaaatcaa a 21

<210> 13

<211> 20

<212> DNA

<213> qPCR primer CREPT _ R3

<400> 13

gccgccatac acacttcgtt 20

<210> 14

<211> 22

<212> DNA

<213> qPCR primer CREPT _ F4

<400> 14

tgaatctgtc cttgtggatg ct 22

<210> 15

<211> 19

<212> DNA

<213> qPCR primer CREPT _ R4

<400> 15

tgtatgaact cgccgccat 19

<210> 16

<211> 19

<212> DNA

<213> qPCR primer CREPT _ F5

<400> 16

ggacccatcg tctccgtgt 19

<210> 17

<211> 19

<212> DNA

<213> qPCR primer CREPT _ R5

<400> 17

gccgccatac acacttcgt 19

Claims

1. A method of preventing cancer recurrence, the method comprising: inhibiting CREPT in a subject in need thereof, preferably the recurrence is in situ recurrence, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

2. The method of claim 1, wherein inhibition of CREPT is effected by administering to the subject: vectors carrying nucleic acid fragments that inhibit CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

3. The method of claim 1 or 2, wherein the inhibition of CREPT is performed systemically or locally in the subject, e.g., in situ after tumor resection.

4. The method of claim 1 or 2, wherein the cancer or carcinoma is a solid carcinoma, such as cervical, breast, ovarian, melanoma, colon cancer.

5. Use of an agent that inhibits CREPT in the manufacture of a medicament for the prevention of recurrence of cancer, preferably in situ recurrence.

6. Use according to claim 5, wherein the agent is a vector carrying a nucleic acid segment that inhibits CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

7. The use of claim 5 or 6, wherein the medicament is for administration to a subject who has undergone additional treatment for cancer.

8. The use of claim 7, wherein said other treatment of cancer comprises surgery, radiation therapy and/or chemotherapy.

9. The use of claim 5 or 6, wherein the medicament further comprises one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

10. The use of claim 9, wherein the one or more cancer therapeutic agents are selected from the group consisting of: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

11. The use of claim 9, wherein the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

12. A medicament for preventing the recurrence of cancer comprising an agent that inhibits CREPT.

13. The medicament of claim 12, wherein the CREPT inhibiting agent inhibits the transcription of CREPT gene, inhibits the expression of CREPT gene, inhibits the function of CREPT protein, and/or promotes the degradation of CREPT protein.

14. The medicament of claim 12, further comprising one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

15. The medicament of claim 14, wherein the one or more cancer therapeutic agents are selected from the group consisting of: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

16. The medicament of claim 14, wherein the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

17. The medicament of claim 14, as a combination medicament, wherein the CREPT-inhibiting agent is administered simultaneously with, or separately from, the one or more cancer therapeutic agents and/or the one or more inflammation inhibitor agents.

18. A method of inhibiting or reversing canceration in normal tissue, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

19. A method of inhibiting or reversing inflammation in normal tissue, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

20. A method of inhibiting or reversing atypical hyperplasia of normal tissue cells, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

21. A method of inhibiting or reversing a precancerous lesion, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

22. A method of inhibiting or reversing abnormal proliferation of cells of a normal tissue, the method comprising: inhibiting CREPT in normal tissues, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

23. A method of inhibiting the canceration of normal tissue cells by tumor exosomes, the method comprising: inhibiting CREPT in normal tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

24. A method of promoting apoptosis in cancerous or inflammatory tissue cells, the method comprising: inhibiting CREPT in a cancerous or inflammatory tissue, said inhibition of CREPT comprising inhibition of transcription of a CREPT gene, inhibition of expression of a CREPT gene, inhibition of function of a CREPT protein, and/or promotion of degradation of a CREPT protein.

25. The method of any one of claims 18 to 24, wherein inhibition of CREPT is effected by administering to a subject: vectors carrying nucleic acid fragments that inhibit CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses, and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; macromolecular inhibitors of CREPT, such as antibodies or antibody fragments to CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

26. The method of any one of claims 18 to 24, wherein inhibition of CREPT is performed systemically or locally in the subject, e.g., in situ following tumor resection.

27. The method of any one of claims 18 to 24, wherein the method is directed against cancer or carcinoma, e.g. solid cancer, e.g. cervical, breast, ovarian, melanoma, colon cancer.

28. Use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting or reversing canceration in normal tissue.

29. Use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting or reversing inflammation in normal tissue.

30. Use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting or reversing the atypical proliferation of cells in normal tissue.

31. Use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting or reversing precancerous lesions.

32. Use of an agent that inhibits CREPT in the manufacture of a medicament for inhibiting or reversing abnormal proliferation of cells in normal tissue.

33. Application of CREPT (tumor necrosis factor inhibiting) agent in preparation of medicine for inhibiting tumor exosomes from cancerating normal tissue cells.

34. Use of an agent which inhibits CREPT in the manufacture of a medicament for promoting apoptosis in cancerous or inflammatory tissue.

35. The use according to any one of claims 28 to 34, wherein the agent is a vector carrying a nucleic acid segment that inhibits CREPT transcription, such as liposomes, adenoviruses, adeno-associated viruses, lentiviruses and retroviruses; nucleic acids against CREPT such as interfering RNA, siRNA and aptamers; a macromolecular CREPT-targeted inhibitor, such as an antibody or antibody fragment of CREPT; small molecule inhibitors targeting CREPT; one or more of the agents that perform CRISPR-Cas9 against CREPT.

36. The use of any one of claims 28 to 34, wherein the medicament is administered to a subject who has undergone other treatment for cancer.

37. The use of claim 36, wherein the other treatment of cancer comprises surgery, radiation therapy and/or chemotherapy.

38. The use of any one of claims 28 to 34, further comprising one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

39. The use of claim 38, wherein the one or more cancer therapeutic agents are selected from the group consisting of: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

40. The use of claim 38, wherein the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

41. A medicament to inhibit or reverse canceration in normal tissue comprising an agent that inhibits CREPT.

42. A medicament to inhibit or reverse inflammation in normal tissue comprising an agent that inhibits CREPT.

43. An agent that inhibits or reverses atypical hyperplasia of normal tissue cells comprising an agent that inhibits CREPT.

44. A medicament to inhibit or reverse precancerous lesions, the medicament comprising an agent that inhibits CREPT.

45. An agent that inhibits or reverses abnormal proliferation of cells in normal tissue, said agent comprising an agent that inhibits CREPT.

46. A medicament for inhibiting the carcinogenesis of normal tissue cells by tumor exosomes, comprising an agent that inhibits CREPT.

47. A medicament for promoting apoptosis in cancerous or inflammatory tissue, said medicament comprising an agent that inhibits CREPT.

48. The medicament of any one of claims 41 to 47, wherein said CREPT inhibiting agent inhibits transcription of a CREPT gene, inhibits expression of a CREPT gene, inhibits function of a CREPT protein, and/or promotes degradation of a CREPT protein.

49. The medicament of any one of claims 41 to 47, further comprising one or more cancer therapeutic agents, and/or one or more inflammation inhibitors.

50. The medicament of claim 49, wherein the one or more cancer therapeutic agents are selected from the group consisting of: asparaginase, hydroxyurea, cisplatin, cyclophosphamide, altretamine, bleomycin, actinomycin D, doxorubicin, etoposide, teniposide, paclitaxel, plicamycin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, fludarabine, pentostatin, cyctrabine, and fludarabine; bevacizumab, trastuzumab, cetuximab, tamoxifen.

51. The medicament of claim 49, wherein the one or more inflammation inhibitors are selected from the group consisting of QNZ (EVP 4593) and JSH-23.

52. The medicament of claim 49, as a combination medicament, wherein the CREPT-inhibiting agent is administered concurrently with, or separately from, the one or more cancer therapeutic agents and/or the one or more inflammation-inhibiting agents.