CN115212154B

CN115212154B - Preparation method of vine tea fermentation filtrate and application of vine tea fermentation filtrate in cosmetics

Info

Publication number: CN115212154B
Application number: CN202210987203.9A
Authority: CN
Inventors: 李荷; 许津; 任奕飞
Original assignee: Guangzhou Huashuo Biotechnology Co ltd
Current assignee: Guangzhou Huashuo Biotechnology Co ltd
Priority date: 2022-08-17
Filing date: 2022-08-17
Publication date: 2023-09-19
Anticipated expiration: 2042-08-17
Also published as: CN115212154A

Abstract

The invention discloses a preparation method of vine tea fermentation filtrate and application thereof in cosmetics, wherein the fermentation filtrate is prepared by fermenting vine tea serving as a raw material through a fermentation system containing novel cellulase Cel 906 and saccharomycetes. The invention has the advantages that: the preparation method is simple and consumes little energy, the fermentation filtrate is rich in active substances such as flavone, polyphenol, polysaccharide and the like, has the effects of resisting oxidation, resisting inflammation, whitening and the like, and can be used as a novel, green and efficient cosmetic additive raw material.

Description

Preparation method of vine tea fermentation filtrate and application of vine tea fermentation filtrate in cosmetics

Technical Field

The invention relates to the field of microbial fermentation, in particular to a saccharomycete fermentation technology.

Background

Vine tea is a tea product prepared by deactivating enzyme, rolling and drying tender stems and leaves of Ampelopsis grossedentata (Ampelopsis grossedentata) plant of Ampelopsis in Vitaceae, and is also called as strawberry tea, mao Yan enzyme, snow tea, white tea, sweet tea, and manna tea, etc., which is widely distributed in Hunan, guangxi Zhuang autonomous region, guizhou, hubei, jiangxi, fujian, guangdong, etc. The vine tea can be used as food processing raw materials through the food safety standard and monitoring evaluation of the national health buddhist, and the dried leaves and stems of the vine tea are always important plant resources for medical food research. Vine tea is a health-care tea and Chinese herbal medicine widely applied in southern China, has thousands of years of application history in folks, has sweet, light and cool taste, has the effects of clearing heat and detoxicating, detumescence and relieving sore throat, resolving carbuncles and resolving hard masses and the like, and is commonly used for treating stomatocace, sore throat, cold and fever, damp-heat jaundice, conjunctival congestion and swelling and pain, carbuncles and sores and furuncles and the like. The vine tea contains various effective substances including flavonoid, polyphenol, polysaccharide, volatile oil and other chemical components, and has obvious functions of resisting oxidation, resisting virus, resisting bacteria, resisting inflammation, regulating immunity and the like.

The medicinal plant fermented cosmetics are the extension of natural cosmetics, and are prepared through slow fermentation of natural plant material with microbe to release active matters from plant, modification or decomposition with microbial enzymes to obtain small molecular matters favorable to skin absorption and to raise skin care effect.

With the development of metabolic engineering, system biology and synthetic biology technologies, saccharomycetes have the potential of becoming various compound cell factories, and can transform and structurally reform the compound through reactions such as methylation, demethylation, dehydroxylation, hydroxylation, glycosylation, dehydrogenation, hydrogenation and the like, so that the content of effective substances is improved or new active substances appear; in addition, the saccharomycetes can secrete a plurality of enzymes such as cellulase, xylanase, pectinase and the like, and the enzymes have strong decomposition capacity, can catalyze and degrade plant cell walls, and can effectively reduce the obstruction of the cell walls to the extraction of the effective components of the Chinese herbal medicines, thereby improving the utilization rate. Compared with most bacterial strains, the saccharomycete has the advantages of acid resistance and difficult pollution by bacteriophage and other strains, and has been widely applied to the fields of food, brewing, medicine, chemical industry and the like. Therefore, the saccharomycete has potential of producing fermentation strain as raw material of cosmetics, and has important effect on extraction and precipitation of natural substances in medicinal and edible plants.

Enzyme preparations have been widely used in the food industry, textile industry, animal husbandry, active substance extraction, drug conversion, etc., and commonly used enzyme preparations include cellulases, xylanases, esterases, etc. Among them, cellulases have the ability to destroy plant cell walls and are commonly used for extraction of plant active substances.

If the vine tea can be fermented by utilizing the combination of cellulase and saccharomycetes, the precipitation of effective substances is improved, and the structure of the active substances is changed, so that the vine tea can be applied to the production of raw materials for producing cosmetics, and can bring important economic value to the cosmetic industry.

Disclosure of Invention

The invention aims to provide a preparation method of vine tea fermentation filtrate and application of the vine tea fermentation filtrate in cosmetics, so as to solve the problems of low extraction rate of plant active substances and the like under the prior art condition, and achieve the purpose of replacing chemical raw materials in the cosmetics with natural active ingredients.

In order to achieve the above purpose, the invention adopts the following technical scheme:

a vine tea fermentation filtrate is prepared by fermenting vine tea serving as a raw material by a fermentation system containing novel cellulase Cel 906 and saccharomycetes;

the saccharomycete is provided by the university of medical science, university of Guangdong, national institute of science and biological pharmacy.

The novel cellulase Cel 906 is obtained by screening a microbial metagenome library constructed by taking soil of a Xinjiang Pascal basin Ferula asafetida partition (45 degrees 40'N,85 degrees 30' E) as a sample in the laboratory, and the gene sequence number is submitted to the national center for biotechnology information database (NCBI) in the United states, and the gene accession number is MW076177. The optimal temperature of the enzyme is 35 ℃, the optimal pH value is 7, and the enzyme has good tolerance to most metal ions and salt solution, and is similar to the fermentation condition of vine tea.

The invention provides a fermentation system for preparing vine tea fermentation filtrate, which comprises the following components: comprises an aqueous solution of vine tea, saccharomycetes, novel cellulase Cel 906, a carbon source required by fermentation and a nitrogen source required by fermentation.

Further, the composition comprises: comprises an aqueous solution of vine tea, a saccharomycete liquid with the volume fraction of 1-9% relative to the total volume of a fermentation system, novel cellulase Cel 906, a carbon source with the weight fraction of 0-5% relative to the weight fraction of the materials, and a nitrogen source with the weight fraction of 0-0.5% relative to the weight fraction of the materials;

the pH of the fermentation system is 3-12;

the feed liquid ratio is 40g/L-200g/L;

the enzyme activity of the novel cellulase Cel 906 is 2596.29U/L, and the ratio of the volume to the weight of the added novel cellulase Cel 906 is 4-6mL:7-9g.

Further, the composition comprises: the novel rattan tea fermentation liquid comprises an aqueous solution of rattan tea, yeast liquid with the volume fraction of 3% relative to the total volume of fermentation, novel cellulase Cel 906, a carbon source with the weight fraction of 2% relative to the weight fraction of the material, and a nitrogen source with the weight fraction of 0.3% relative to the weight fraction of the material;

the pH of the fermentation system is 7;

the feed liquid ratio is 133.35g/L;

the enzyme activity of the novel cellulase Cel 906 is 2596.29U/L, and the ratio of the volume to the weight of the added novel cellulase Cel 906 is 6mL:7.5g.

The invention also provides a preparation method of vine tea fermentation filtrate by using the fermentation system, which comprises the following steps:

activating and culturing yeast in an enlarged manner, and fermenting according to the following conditions: the fermentation time is 24-240 h; the fermentation temperature is 25-50 ℃.

More preferably, the fermentation time is 96 hours; the temperature of the fermentation was 35 ℃.

More preferably, the culture medium for the activation and expansion culture is prepared by the following method: 20g peptone, 10g yeast extract, 70mL molasses, 1g MgSO ₄ ·7H ₂ O、0.5g KH ₂ PO ₄ 、2g FeSO ₄ ·7H ₂ O was dissolved in a suitable amount of double distilled water, 15mL of 0.2% adenine solution was added, and the volume was then set to 1L and autoclaved at 120℃for 15min.

More preferably, the conditions for activation and expansion culture are 36 ℃, 220rpm and 48 hours, and the activation culture is carried out until the OD600 = 0.6-0.8.

The application also provides application of the vine tea fermentation filtrate in cosmetics.

The application also provides application of the vine tea fermentation filtrate in cosmetics with antioxidant, whitening and anti-inflammatory effects.

The advantages of the application include: the preparation method of the vine tea fermentation filtrate is simple, efficient, low in energy consumption, green and pollution-free; the probiotics are adopted to ferment the medicinal and edible plants, so that the plant is harmless to human bodies; can promote the sufficient precipitation of effective substances of vine tea, and convert macromolecular substances into small molecules which are favorable for human body absorption; the fermentation filtrate is rich in active substances such as flavone, polyphenol, polysaccharide and the like, and replaces the application of chemical raw materials in cosmetics; provides a new method for the research of vine tea fermentation products and a new idea for the application of cosmetics.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and constitute a part of this specification, are incorporated in and constitute a part of this specification and do not limit the application in any way, and in which:

FIG. 1 is a statistical chart of DPPH radical scavenging rate (hereinafter referred to as "scavenging rate") of vine tea fermentation filtrate of different strain groups;

FIG. 2 is a statistical chart of the flavone content experiment of the vine tea fermentation filtrate of different strain groups;

FIG. 3 is a graph showing experimental statistics of polyphenol content of vine tea fermentation filtrate of different strain groups;

FIG. 4 is a statistical chart of polysaccharide content experiment of vine tea fermentation filtrate of different strain groups;

FIG. 5 is a graph showing experimental statistics of clearance of vine tea fermentation filtrate at different fermentation times;

FIG. 6 is a statistical chart of the clearance of vine tea fermentation filtrate at different fermentation temperatures;

FIG. 7 is a graph showing experimental statistics of clearance of vine tea fermentation filtrates at different fermentation system pH values;

FIG. 8 is a statistical chart of the clearance of vine tea fermentation filtrate with different feed liquid ratios;

FIG. 9 is a graph showing experimental statistics of clearance of ampelopsis grossedentata fermentation filtrate with different carbon source addition amounts;

FIG. 10 is a graph showing experimental statistics of clearance of ampelopsis grossedentata fermentation filtrate with different nitrogen source addition amounts;

FIG. 11 is a graph showing experimental statistics of clearance of ampelopsis grossedentata fermentation filtrate with different strain addition amounts;

FIG. 12 is a rutin standard chart;

FIG. 13 is a statistical chart of the extraction rate of flavone in the vine tea fermentation filtrate of examples 10-12;

FIG. 14 is a gallic acid standard curve;

FIG. 15 is a statistical graph of polyphenol extraction rate from the vine tea fermentation filtrate of examples 10-12;

FIG. 16 is a glucose standard graph;

FIG. 17 is a statistical chart of polysaccharide extraction rate in the vine tea fermentation filtrate of examples 10-12;

FIG. 18 is a statistical graph of the effect of vine tea fermentation filtrate at different concentrations on B16-F10 cell viability;

FIG. 19 is a statistical graph of tyrosinase activity inhibition by vine tea fermentation filtrate at various concentrations for B16-F10 cells;

FIG. 20 is a statistical graph of melanin synthesis inhibition by vine tea fermentation filtrate at different concentrations for B16-F10 cells;

FIG. 21a is an experimental graph of the inhibition of inflammatory cell aggregation in a zebra fish tail inflammatory model by ampelopsis grossedentata fermentation filtrate at different concentrations;

FIG. 21b is a statistical plot of inflammatory cell counts from experiments of inhibiting inflammatory cell aggregation in a zebra fish tail inflammatory model with different concentrations of ampelopsis grossedentata fermentation filtrate;

FIG. 22a is a statistical plot of the effect of different concentrations of Ampelopsis grossedentata fermentation filtrate on cell viability of RAW264.7 cells;

FIG. 22b is a graph of the standard TNF- α content;

FIG. 22c is a statistical plot of the inhibition of TNF- α production in RAW264.7 cells from ampelopsis grossedentata fermentation filtrate at various concentrations;

FIG. 23 is a statistical plot of the effect of different concentrations of ampelopsis grossedentata fermentation filtrate on the cell viability of HSF cells;

FIG. 24 shows different concentrations of H ₂ O ₂ Cell viability statistics of the treated HSF cells;

FIG. 25 is a graph showing cell viability statistics of cell oxidation models of the effect of ampelopsis grossedentata fermentation filtrate at different concentrations;

FIG. 26 is a graph showing experiments after different concentrations of Teng tea fermentation filtrate and negative control contacted chick embryo allantoic membrane (CAM) for 3 min;

FIG. 27 is an experimental plot of the positive control and the reference control after 3min exposure to chick embryo allantois (CAM);

fig. 28 is a schematic diagram of the inventive concept.

Detailed Description

The present invention will now be described in detail with reference to the drawings and the specific embodiments thereof, which are illustrative embodiments and illustrations of the invention, but are not to be construed as limiting the invention.

1. Experimental materials, reagents and apparatus

Experimental materials: vine tea, produced from guangxi Guilin; fermentation strains (red ganoderma, tremella, bacillus subtilis, lactobacillus plantarum, saccharomycetes) provided by the university of guangdong medicine science student's life science and biological pharmacy, which are activated and passaged in the laboratory; novel cellulase Cel 906 is provided by the university of Guangdong university of medical science basic institute molecular biology laboratory. The gene sequence of the novel cellulase Cel 906 has been submitted to the national center for Biotechnology information database (NCBI), accession number MW076177, the nucleotide sequence is shown below:

ATGATATGCGCAGTAGCACGGGCCGATGTCCCTGCTTTAACTGTCGAGGGTAATCAAATTTTGAGTGGTGGCGAGGCTAAAAGCTTCGCCGGTAACAGCTTATTTTGGAGCAATAACGGCTGGGGCGGCGAGGCCTTCTACACGGCGGGTGCAGTGGAGTGGCTCAAGAATGATTGGAACTCAACGCTGGTCCGTGCCGCTATGGGCGTAGAAGATGATGGCGGTTACCTGGACGATCCCGTCGCTAACAGGGAGCGCGTTATTACGGTAGTTGATGCCGCCATTGCCAATGATCTTTATGTCATTATTGATTGGCACTCACACCACGCGGAAGACTACCAGTCAGAGGCGATCAGCTTCTTCCAGGATATGGCCACCCGCTATGGTGACTACAACAATGTGATCTATGAGATTTACAACGAGCCACTGCAAATTTCCTGGAACAATAACATCAAGCCCTACGCCGAGGCAGTCATTTCGGCGATACGGGAAATAGACTCTGACAATCTGATCATCGTCGGCACCCCGACCTGGTCGCAGGACGTTGACATAGCGTCCAATGATCCCATCACCGGCTATGACAATATTGCCTATACACTGCACTTTTATGCCGGTACACATGGTGAGAGCCTGCGCAACAAAGCGCGTACTGCTATGAACAATGGCATCGCCCTGATGGCAACGGAGTGGGGGACAGTGAATGCCAACGGTGATGGCAGTGTCGCACAGGCGGAAACCGATGCCTGGATGAACTTTTTTGCCGAGCACAATATTAGTCACGCCAACTGGTCTATCAACGACAAAGCCGAAGGGGCCTCTGCGCTGCAACCCGGTGCGAGCCCGACCGGCGGCTGGAATGATTCGGACCTTACGGACTCAGGTCGCTATGTGAAAGGCATTGTTTTC

experimental reagent: DPPH (1, 2-diphenyl-2-picrylhydrazyl), ethanol, feSO ₄ 30% hydrogen peroxide, glucose, phenol, gallic acid, folin reagent, anhydrous Na ₂ CO ₃ Concentrated sulfuric acid, sodium nitrite, aluminum nitrate, sodium hydroxide, methanol, phosphate buffer, citric acid monohydrate, sodium dihydrogen phosphate dodecahydrate, and sodium polyoxyethylene lauryl ether sulfate all purchased from Guangzhou Su Cheng Guangdong trade Co., ltd; deionized water, distilled water and double distilled water are self-made by molecular biology laboratory of the university of Guangdong medical university.

Experimental instrument: the device comprises an analytical balance, an ultraviolet-visible light spectrophotometer, a desk type high-speed refrigerated centrifuge, a constant temperature and humidity incubator, a digital chick embryo incubator, a double single-sided purification workbench, a high-pressure steam sterilization pot, a water bath pot, a pH meter and an electrothermal blowing drying oven.

2. Experimental procedure

The invention develops an optimal preparation method of vine tea fermentation filtrate, which comprises the following steps:

s1: spores or bacterial colonies are respectively picked from the preservation inclined planes of all the tested strains (red ganoderma bacteria, tremella bacteria, bacillus subtilis, lactobacillus plantarum and saccharomycetes) and inoculated on respective activation culture mediums for activation, so that activated strains are obtained.

The activation culture medium of the ganoderma lucidum and tremella is Potato Dextrose Agar (PDA) culture medium, and is prepared by the following method: taking 40.1g of PDA culture medium, adding 1L of distilled water, stirring, heating, boiling to dissolve completely, sterilizing at 121 ℃ for 20min under high pressure, pouring into a flat-plate culture dish, solidifying, and storing at room temperature. The activation conditions were 36℃for 48 hours.

The bacillus subtilis activation culture medium is a nutrient agar culture medium and is prepared by the following method: 10.0g of peptone, 5.0g of sodium chloride, 3.0g of beef extract powder and 15.0g of agar are added with 1L of distilled water, autoclaved at 121 ℃ for 20min, poured into a flat-plate culture dish, solidified and stored at room temperature. The activation conditions were 32℃for 28h.

The activating culture medium of the lactobacillus plantarum is MRS broth culture medium and is prepared by the following method: 10.0g of peptone, 10.0g of meat extract, 5.0g of yeast extract powder, 20.0g of glucose, 2.0g of dipotassium hydrogen phosphate, 2.0g of diammonium hydrogen citrate, 5.0g of sodium acetate, 0.58g of magnesium sulfate, 0.25g of manganese sulfate, 0.5g of cysteine and 801.0g of tween-801.0 g, adding distilled water 1L, autoclaving at 121 ℃ for 20min, storing at room temperature, and activating at 32 ℃ at 200rpm for 48h.

An activating culture medium of saccharomycetes, which is prepared by the following method: 20g peptone, 10g yeast extract, 70mL molasses, 1g MgSO ₄ ·7H ₂ O、0.5g KH ₂ PO ₄ 、2g FeSO ₄ ·7H ₂ O was dissolved in a suitable amount of double distilled water, 15mL of 0.2% adenine solution was added, and the volume was then set to 1L and autoclaved at 120℃for 15min. The activation conditions were 36℃and 220rpm for 48 hours.

S2: inoculating the activated strains obtained in S1 into respective seed culture media, and culturing to OD ₆₀₀ =0.6 to 0.8, giving speciesSub-liquid;

the preparation method of the seed culture medium of the ganoderma lucidum and the tremella is the same as that of the activation culture medium of the ganoderma lucidum and the tremella in the step S1. The culture conditions were 36℃and 200rpm for 48 hours.

The preparation method of the lactobacillus plantarum seed culture medium is the same as that of the lactobacillus plantarum activation culture medium in the step S1. The culture conditions were 32℃at 200rpm for 48 hours.

The preparation method of the seed culture medium of the saccharomycetes is the same as that of the activating culture medium of the saccharomycetes in S1. The culture conditions were 36℃and 200rpm for 48 hours.

The seed culture medium of the bacillus subtilis is LB liquid culture medium and is prepared by the following method: 10.0g of tryptone, 10.0g of sodium chloride, 5.0g of yeast extract powder and 1L of distilled water are added, and the mixture is sterilized by high-pressure steam at 121 ℃ for 20min. The culture conditions were 32℃at 200rpm for 28 hours.

S3: grinding Ampelopsis grossedentata, mixing with water to obtain an aqueous solution containing Ampelopsis grossedentata, wherein the water can be deionized water, distilled water or double distilled water, taking out the seed solution obtained in S2, inoculating the seed solution into the aqueous solution containing Ampelopsis grossedentata, fermenting to obtain an experimental group, and fermenting without adding strain to obtain a blank control group. After the fermentation is finished, filtering by using a 0.22 mu m filter membrane to obtain vine tea fermentation filtrate. And screening out the optimal fermentation strain according to the comparison of the free radical clearance, the total flavone content, the total polyphenol content and the total polysaccharide content of the fermentation filtrate.

S4: and (3) optimizing fermentation conditions according to the strains which are screened in the step (S3) and are most suitable for vine tea fermentation. Comprises seven factors of fermentation time, fermentation temperature, pH value of a fermentation system, feed-liquid ratio, optimal nitrogen source and addition amount, optimal carbon source and addition amount and bacterial strain inoculation amount. And optimizing the optimal fermentation conditions according to the comparison of the free radical clearance, the total flavone content, the total polyphenol content and the total polysaccharide content of the seven-factor fermentation experiment.

S5: and (3) adding novel cellulase Cel 906 under the optimal vine tea fermentation condition obtained in the step (S4) to perform combined fermentation, and finally obtaining vine tea fermentation filtrate.

3. Test method

1) Determination of the free radical removal from fermentation filtrate by DPPH method

DPPH reagent preparation: putting 8mg of DPPH which is accurately weighed into a 100mL brown volumetric flask, firstly using a little absolute ethyl alcohol to shake and dissolve, then transferring into the 100mL volumetric flask to fix the volume, and keeping the storage time for not more than 4 hours.

(1) Mixing 1ml fermentation filtrate with DPPH reagent in equal volume, water-bathing at 37deg.C in dark condition for 30min, collecting 200 μl of the mixture, and measuring absorbance at 517 nm-Ai

(2) Mixing 1ml of fermentation filtrate with absolute ethanol in equal volume, performing water bath at 37deg.C in dark condition for 30min, collecting 200 μl of the mixture, and measuring absorbance at 517nm as Aj

(3) Mixing 1mL DPPH reagent with absolute ethanol in equal volume, water-bathing at 37deg.C in dark condition for 30min, measuring absorbance value at 517nm with 200 μl mixed solution

The radical clearance I is calculated according to the formula:

2) Flavone content determination

(1) Reagent(s)

Ethanol solution: the volume fraction was 60%.

Sodium hydroxide solution: 200g/L, 20.0g of sodium hydroxide is weighed and the volume is fixed to 100mL by water.

Sodium nitrite solution: 5.0g of sodium nitrite is weighed out at 50g/L, dissolved in water and then fixed to 100mL.

Aluminum nitrate solution: 100g/L, 10g of aluminum nitrate is weighed, dissolved in water and then fixed to 100mL.

Rutin standard solution: weighing 0.2g of rutin standard substance, drying under reduced pressure at 120 ℃ to constant weight, placing into a 100mL volumetric flask, and dissolving with ethanol solution to scale.

(2) Experimental procedure

Drawing a standard curve: sucking 0.00, 0.20, 0.40, 0.60, 0.80 and 1.00mL of rutin standard solution, supplementing water to 2mL, adding 0.2mL of sodium nitrite solution, uniformly mixing, standing for 6min, adding 0.2mL of aluminum nitrate solution, uniformly mixing, standing for 6min, adding 0.8mL of sodium hydroxide solution, adding water to 5mL, shaking, and standing for 15min. Absorbance values were measured at 490 nm. And drawing a standard curve by taking absorbance as an ordinate and rutin standard liquid concentration as an ordinate.

And (3) measuring: sucking 2mL of fermentation liquor sample liquid, adding 0.2mL of sodium nitrite solution, uniformly mixing, standing for 6min, adding 0.2mL of aluminum nitrate solution, uniformly mixing, standing for 6min, adding 0.8mL of sodium hydroxide solution, adding water to 5mL, uniformly shaking, and standing for 15min. Absorbance values were measured at a wavelength of 510 nm. And (5) comparing the absorbance value with a standard curve equation, and calculating the content of total flavonoids in the fermentation filtrate.

3) Determination of polyphenol content

(1) Reagent(s)

Preparing ferrous tartrate solution: 0.1g of ferrous sulfate heptahydrate and 0.5g of potassium sodium tartrate are weighed, dissolved by using steam room water and fixed to 100mL.

phosphate buffer pH7.5, 0.0667mol/L Na ₂ HPO ₄ Solution and KH of 0.0667mol/L ₂ PO ₄ Mixing the solution according to the ratio of 8mL to 15mL, and adjusting pH to 7.5.

Gallic acid solution preparation, namely weighing 0.025g of gallic acid to a constant volume in a 50mL volumetric flask to obtain 0.5mg/mL gallic acid standard solution.

(2) Experimental procedure

Drawing a standard curve, namely absorbing 0, 0.2, 0.4, 0.6, 0.8 and 1mL of gallic acid standard solution into a 10mL test tube with a plug, adding 2mL of ferrous tartrate solution, adding pH7.5 phosphate buffer solution to 5mL, adding water to 10mL, shaking uniformly, measuring the absorbance at 540nm, and drawing the standard curve by using gallic acid concentration as a reference absorbance.

To 1mL of the fermentation filtrate, 2mL of a ferrous tartrate solution, pH7.5 phosphate buffer solution was added to 5mL, water was added to 10mL, shaking was performed, and the absorbance at 540nm was measured. And (5) comparing the absorbance value with a standard curve equation, and calculating the content of total polyphenol in the fermentation filtrate.

4) Determination of polysaccharide content

(1) Reagent(s)

Accurately weighing 50mg of glucose, preparing 0.1mg/mL mother liquor in a 500mL volumetric flask, and preparing 0, 0.02, 0.04, 0.06, 0.08 and 0.1mg/mL glucose standard solution respectively by distilled water.

(2) Experimental procedure

Drawing a standard curve: 1mL of 0, 0.02, 0.04, 0.06, 0.08 and 0.1mg/mL glucose standard solution are sucked, 1mL of 5% phenol is respectively added, 5mL of concentrated sulfuric acid is rapidly added, and the mixture is kept stand for 10min. Shaking uniformly, standing at 30deg.C for 30min, measuring OD value at 490nm, taking glucose content as abscissa, and OD value as ordinate, and drawing standard curve.

Sample content determination: 1.0mL of fermentation broth sample liquid is sucked, OD values are measured according to the steps, and the OD values are substituted into a standard curve to calculate the total sugar content in the sample.

Example 1

This example is a control group. The method comprises the following steps:

the aqueous solution containing vine tea is fermented according to the following fermentation conditions: the fermentation temperature is 37 ℃, the fermentation pH is 7, the feed-liquid ratio is 100g/L, and the fermentation time is 48h.

Example 2

The present example discusses dominant species. The content is as follows:

S1-S2 are the same as S1-S2 of "2, experimental procedure" above;

s3: taking out the seed liquid obtained in the step S2, and respectively inoculating the seed liquid into an aqueous solution containing vine tea;

s4: the fermentation conditions are as follows: the fermentation temperature is 37 ℃, the fermentation time is 48 hours (yeast fermentation group, ganoderma lucidum fermentation group and tremella fermentation group), 72 hours (lactobacillus plantarum fermentation group) and 60 hours (bacillus subtilis fermentation group), the pH of a fermentation system is 7, the feed-liquid ratio is 100g/L, and the seed-liquid inoculation amount is 1% (the ratio of the volume of seed liquid to the total volume of the fermentation system); and after the fermentation is finished, measuring the free radical clearance, the total flavone content, the total polyphenol content and the total polysaccharide content according to the experimental method 3. The experimental results are shown in figures 1-4, and the most suitable strain for vine tea fermentation is saccharomycete.

Example 3

This example discusses optimal fermentation time. The content is as follows:

s1: inoculating spore or colony on the slant for culturing yeast to OD ₆₀₀ =0.6, resulting in an activated strain.

S2: inoculating the activated strain obtained in the step S1 into a seed culture medium for expansion culture to obtain seed liquid;

s3: taking out the seed liquid obtained in the step S2, and inoculating the seed liquid into an aqueous solution containing vine tea;

s4: the fermentation conditions are as follows: the fermentation temperature is 37 ℃, the pH of the fermentation system is 7, the feed-liquid ratio is 100g/L, the strain inoculation amount is 1% (the ratio of the volume of seed liquid to the total volume of the fermentation system), and the fermentation time is 0h, 24h, 48h, 72h, 96h, 120h, 144h and 168h respectively; the free radical scavenging rate of the fermentation filtrate was determined according to "3, experimental methods". The experimental results are shown in FIG. 5, and it can be seen that the optimal fermentation time is 96 hours.

Example 4

The present example discusses the optimal fermentation temperature. The content is as follows:

S1-S3 are as in example 3;

s4: the fermentation conditions are as follows: the fermentation temperature is 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, the pH of the fermentation system is 7, the feed-liquid ratio is 100g/L, the seed inoculum size is 1% (the ratio of the volume of seed liquid to the total volume of the fermentation system), and the fermentation time is 96 hours; the free radical scavenging rate of the fermentation filtrate was determined according to "3, experimental methods". The results of the experiment are shown in FIG. 6, and it can be seen that the optimal fermentation temperature is 35 ℃.

Example 5

This example discusses the optimal fermentation pH. The content is as follows:

S1-S3 are as in example 3;

s4: the fermentation conditions are as follows: the fermentation temperature is 35 ℃, the pH of a fermentation system is 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12, the feed-liquid ratio is 100g/L, the seed inoculum size is 1% (the ratio of the volume of seed liquid to the total volume of the fermentation system), and the fermentation time is 96 hours; the free radical scavenging rate of the fermentation filtrate was determined according to "3, experimental methods". The results of the experiment are shown in FIG. 7, and it can be seen that the pH of the optimal fermentation system is 7.

Example 6

The present example discusses the optimal fermentation feed liquid ratio. The content is as follows:

S1-S3 are as in example 3;

s4: the fermentation conditions are as follows: the fermentation temperature is 35 ℃, the pH of the fermentation system is 7, the feed-liquid ratio is 50g/L-200g/L, the strain inoculum size is 1% (the ratio of the volume of seed liquid to the total volume of the fermentation system), and the fermentation time is 96 hours; the free radical scavenging rate of the fermentation filtrate was determined according to "3, experimental methods". As shown in FIG. 8, the optimal fermentation liquid-to-liquid ratio was 133.35g/L.

Example 7

The present example discusses the optimal carbon source addition for fermentation. The content is as follows:

S1-S3 are as in example 3;

s4: the fermentation conditions are as follows: the fermentation temperature is 35 ℃, the pH of a fermentation system is 7, the feed-liquid ratio is 133.35g/L, the strain inoculation amount is 1% (the ratio of the volume of seed liquid to the total volume of the fermentation system), the fermentation time is 96 hours, and the carbon source addition amounts are 0, 1.00%, 2.00%, 3.00%, 4.00% and 5.00% respectively; the free radical scavenging rate of the fermentation filtrate was determined according to "3, experimental methods". As a result of the experiment, it was found that the optimum amount of carbon source added for fermentation was 2% (weight of carbon source to weight of feed).

Example 8

The present example discusses the optimum amount of nitrogen source to be added for fermentation. The content is as follows:

S1-S3 are as in example 3;

s4: the fermentation conditions are as follows: the fermentation temperature is 35 ℃, the pH of a fermentation system is 7, the feed-liquid ratio is 133.35g/L, the strain inoculation amount is 1% (the ratio of the volume of seed liquid to the total volume of the fermentation system), the fermentation time is 96 hours, the carbon source addition amount is 2.00%, and the nitrogen source addition amounts are 0, 0.10%, 0.20%, 0.30%, 0.40% and 0.50% respectively; the free radical scavenging rate of the fermentation filtrate was determined according to "3, experimental methods". As a result of the experiment, as shown in FIG. 10, it was found that the optimum nitrogen source addition amount for fermentation was 0.30% (weight of nitrogen source to weight of feed).

Example 9

This example discusses the optimal inoculum size for the fermentation strain. The content is as follows:

S1-S3 are as in example 3;

s4: the fermentation conditions are as follows: the fermentation temperature is 35 ℃, the pH of a fermentation system is 7, the feed-liquid ratio is 133.35g/L, the seed liquid volume and the total volume of the fermentation system are respectively 1%, 3%, 5%, 7% and 9%, the fermentation time is 96 hours, the carbon source addition amount is 2.00% (the weight of the carbon source to the weight of the material), and the nitrogen source addition amount is 0.30% (the weight of the nitrogen source to the weight of the material); the free radical scavenging rate of the fermentation filtrate was determined according to "3, experimental methods". The results of the experiment are shown in FIG. 11, and it can be seen that the optimum seed culture inoculum size was 3% (ratio of seed liquid volume to total volume of fermentation system).

By examining the influence of each factor on the antioxidant activity of the vine tea fermentation filtrate, the optimal fermentation temperature is 35 ℃, the pH value of an optimal fermentation system is 7, the optimal feed-liquid ratio is 133.35g/L, the optimal carbon source addition amount is 2% (the weight of a carbon source to the weight of a material), the optimal nitrogen source addition amount is 0.3% (the weight of a nitrogen source to the weight of the material), and the optimal strain inoculation amount is 3% (the ratio of the volume of seed liquid to the total volume of the fermentation system).

Example 10

The present example is a yeast group. The content is as follows:

S1-S3 are as in example 3;

s4: the fermentation conditions are as follows: the fermentation temperature is 35 ℃, the pH of the fermentation system is 7, the feed-liquid ratio is 133.35g/L, the strain inoculation amount is 3% (the ratio of the volume of seed liquid to the total volume of the fermentation system), the fermentation time is 96 hours, the carbon source addition amount is 2.00% (the ratio of the weight of carbon source to the weight of material), and the nitrogen source addition amount is 0.30% (the ratio of the weight of nitrogen source to the weight of material).

Example 11

This example is the yeast +Cel906 group. The content is as follows:

S1-S4 are as in example 10;

s5: novel cellose Cel 906 with enzyme activity 2596.29U/L is added, and the ratio of the volume of the novel cellose Cel 906 to the weight of vine tea powder is 6mL:7.5g.

Determination of the extraction yield of flavone from the fermentation systems of examples 1, 10 and 11

The experimental method is the same as the "2) flavone content measurement in the" 3 "and the" experimental method ", the rutin standard curve is shown in FIG. 12, the flavone extraction rate of vine tea is calculated according to the ratio of the flavone content in the fermentation filtrate to the weight of vine tea added, the fermentation without adding saccharomycetes is set as a Control group, the fermentation of saccharomycetes is set as a saccharomycetes group, and the fermentation of saccharomycetes combined with cellulase is set as a saccharomycetes+Cel906 group. The results are shown in FIG. 13. The highest flavone extraction rate of example 11 is 42.79%, and the content of flavone in the fermentation filtrate is improved and the extraction rate of ampelopsis grossedentata flavone is improved after the saccharomycetes and the novel cellulase Cel 906 are added. The vine tea flavone has the functions of resisting oxidation, inflammation, bacteria and tumors, and the preparation method of the vine tea fermentation filtrate improves the extraction rate of the flavone, so that the vine tea flavone has a larger application value in the aspect of cosmetics. (P < 0.05) (P < 0.01) (P < 0.001)

Determination of polyphenol extraction Rate in fermentation systems of examples 1, 10 and 11

The experimental method is the same as the "3) polyphenol content measurement" in the "3 and the" experimental method ", the gallic acid standard curve is shown in fig. 14, the extraction rate of vine tea polyphenol is calculated according to the ratio of the polyphenol content in the fermentation filtrate to the weight of the vine tea added material, the fermentation without adding saccharomycetes is set as a Control group, the fermentation of saccharomycetes is set as a saccharomycetes group, and the fermentation of saccharomycetes combined with cellulase is set as a saccharomycete+Cel906 group. The results are shown in FIG. 15. The highest polyphenol extraction rate of example 11 is 11.89%, and the addition of saccharomycetes and novel cellulase Cel 906 improves the polyphenol content in the fermentation filtrate and improves the extraction rate of ampelopsis grossedentata polyphenol. The vine tea polyphenol has the functions of antioxidation and the like, and the preparation method of the vine tea fermentation filtrate improves the content of the polyphenol, so that the vine tea fermentation filtrate has a larger application value in cosmetics. (P < 0.05) (P < 0.01) (P < 0.001)

Determination of polysaccharide extraction yield in fermentation systems of examples 1, 10 and 11

The experimental method is the same as the polysaccharide content measurement in the step (3) and the step (4) in the experimental method, the glucose standard curve is shown in fig. 16, the extraction rate of vine tea polysaccharide is calculated according to the ratio of the polysaccharide content in the fermentation filtrate to the weight of the added vine tea material, the fermentation without adding saccharomycetes is set as a Control group, the fermentation of saccharomycetes is set as a saccharomycetes group, and the fermentation of saccharomycetes and cellulase is set as a saccharomycete+Cel906 group. As shown in FIG. 17, the polysaccharide extraction rate of example 11 is 7.16%, and the addition of yeast and novel cellulase Cel 906 increases the polysaccharide content in the fermentation filtrate and increases the extraction rate of Ampelopsis grossedentata polysaccharide. The vine tea polysaccharide has the functions of moisturizing, resisting oxidation, relieving and repairing, and the preparation method of the vine tea fermentation filtrate improves the content of the polysaccharide, so that the vine tea fermentation filtrate has a larger application value in cosmetics. (P < 0.05) (P < 0.01) (P < 0.001)

Experiments were subsequently performed using the ampelopsis grossedentata fermentation filtrate prepared in example 12.

4. The influence of ampelopsis grossedentata fermentation filtrate on alpha-MSH stimulated mouse melanoma B16-F10 cells is explored

The specific method comprises the following steps:

1) Reagent(s)

DMEM high sugar medium, fetal bovine serum, green-streptomycin mixed solution, 0.25% trypsin/EDTA solution, MTT cell proliferation assay kit, tyrosinase, L-levodopa, DMSO, α -melanocyte stimulating hormone (α -MSH).

2) Step (a)

(1) Cell culture

Cell incubator (37 ℃ C., 5% CO) based on high sugar culture of mouse B16 melanoma cells with DMEM containing 10% fetal bovine serum and 1% green-streptomycin mixture ₂ ) Medium routine culture, 2-3 days with 1 liquid change, taking logarithmic growth phase cells to digest with 0.25% trypsin/EDTA solution for experiment.

(2) MTT method for screening proper medicine concentration

Taking logarithmic growth phase cells, and adjusting cell density to about (4-5) x10 ⁵ Inoculating into 96-well plate at 37deg.C with 5% CO at a concentration of 100 μl/well ₂ Culturing overnight in an incubator. Setting a blank group, a control group stimulated by alpha-MSH, a positive group with a final concentration of 500 mug/mL kojic acid and an experimental group; according to the volume fraction, the fermentation filtrate with the final concentration of 20%, 10%, 5%, 2.5%, 1.25% and 0.625% is added into the experimental group, 6 compound holes are arranged in each group, and the culture is continued for 24 hours. The supernatant was aspirated, 50. Mu.L of 5g/L MTT solution was added in the dark, the culture was continued for 4h, the supernatant was discarded, 150. Mu.L DMSO was added to each well, shaking was performed for 20min on a shaker, and the OD of each well was measured at 490nm by an ELISA reader. Experiments were repeated 3 times. The OD value was calculated as in equation 1.

Equation 1: cell viability = (experimental group-blank)/(control group-blank) ×100%

The results are shown in fig. 18, and when the concentration of the fermentation filtrate is 5% -20%, the cell viability is significantly reduced; when the concentration of the fermentation filtrate is 0.625% -2.5%, the cell activity is above 90%, so the fermentation filtrate is used as the concentration for subsequent experiments. (P < 0.05) × (P < 0.001), compared to the control group.

(3) Detection of tyrosinase activity by dopa rate oxidation

Taking logarithmic growth phase cells, adjusting cell density to (4-5) x10 ⁵ Inoculating into 96-well plate at 37 deg.C 5% CO at 100 μl/well ₂ Culturing overnight in an incubator. Setting a control group stimulated by alpha-MSH, a positive group with a final concentration of 500 mug/mL kojic acid and an experimental group; and adding fermentation filtrate with final concentration of 0.625%, 1.25% and 2.5% into each hole of the experimental group according to volume fraction, arranging 6 compound holes in each group, continuously culturing for 24 hours, discarding old culture medium after culturing, washing 3 times by PBS, adding 100 mu L of 1% Triton X-100 solution into each hole, rapidly placing in a refrigerator at-80 ℃ for 1 hour, and thawing at room temperature to break cells. After pre-warming the cells and 1% L-DOPA in a 37℃constant temperature gas bath, 100. Mu.L of 1% L-DOPA was added to each well. The reaction was carried out at 37℃for 30min. The OD was measured at 490nm with the microplate reader and the experiment was repeated 3 times. The OD value was calculated as in equation 2.

Equation 2: tyrosinase inhibition rate = 1- (experimental/control group) 100%

(4) Determination of melanin content by sodium hydroxide cracking method

Taking cells in logarithmic growth phase, and adjusting cell density to about 2×10 ⁵ Each mL was inoculated in a 6-well plate at 2 mL/well. 37 ℃ 5% CO ₂ The culture was carried out overnight in an incubator, and the old medium was discarded. Setting a control group stimulated by alpha-MSH, a positive group with a final concentration of 500 mug/mL kojic acid and an experimental group; and adding fermentation filtrate with final concentration of 0.625%, 1.25% and 2.5% into each hole of the experimental group according to the volume fraction, and continuously culturing for 48 hours. After the incubation was completed, the old medium was discarded, washed 3 times with PBS, digested with 0.25% trypsin/EDTA solution, the complete medium 1640 was stopped and the cells were collected in a 1.5mL centrifuge tube, centrifuged at 1000 revolutions per minute for 10min, the supernatant was discarded, washed 2 times with PBS, and the melanin particles were completely solubilized by adding 300. Mu.L of 1mol/L NaOH solution containing 10% DMSO in a water bath at 80℃for 30min And (5) solving. The solution in which melanin was dissolved was added to a 96-well plate at 100. Mu.L per well, and 3 multiplex wells were provided. The OD was measured at 490nm with the microplate reader and the experiment was repeated 3 times. The OD value was calculated as in equation 3.

Equation 3: melanogenesis inhibitory rate=1- (experimental group/control group) ×100%

3) Results

As shown in fig. 19, tyrosinase activity inhibition rates were significantly different from positive groups when the fermentation filtrate concentrations were 0.625% and 1.25%; when the concentration of the fermentation filtrate is 2.5%, the inhibition rate is 32.171%, and the ampelopsis grossedentata fermentation filtrate can obviously inhibit the activity of tyrosinase in cells, similar to the inhibition rate of kojic acid on tyrosinase. (P < 0.05) × (P < 0.001), compared to the control group.

As shown in fig. 20, melanin synthesis inhibition rates were significantly different from those of the positive group when the fermentation filtrate concentrations were 0.625% and 1.25%; when the concentration of the fermentation filtrate was 2.5%, the inhibition rate of melanin synthesis by kojic acid was similar. (< 0.001) compared to the control group.

In conclusion, the ampelopsis grossedentata fermentation filtrate inhibits the activity of tyrosinase in the cells B16-F10 of the melanoma cells of the mice, and reduces the generation of melanin. The ampelopsis grossedentata fermentation filtrate is found to have the effects of whitening and removing freckles and has the potential of being applied to functional cosmetics.

5. The inhibition effect of vine tea fermentation filtrate on inflammation is explored by establishing an inflammation model induced by tail breakage of zebra fish

The specific method comprises the following steps:

1) Material

Transgenic zebra fish Tg (corola: EGFP), introduced by university of Guangdong medical science, was propagated in this laboratory.

2) Step (a)

(1) Experimental fish and collection of fertilized eggs thereof

The sexually mature zebra fish is bred in the zebra fish breeding unit in a male-female separate tank. Water temperature: 26+/-2 ℃; pH 7.2; conductivity: 520 μs/cm; light/dark cycle: 14h to 10h. The day before the exposure experiment starts, the male and female are paired at a ratio of 1:2, and natural mating and spawning are carried out.

(2) Macrophage and neutrophil clearance assay

Zebra fish developed to 3dpf (days post fertilization) and developed normally Tg (corola: EGFP) were selected, 50% of the zebra fish tail fins were excised under a stereoscopic microscope with a scalpel, then the zebra fish was placed in a 6-well cell culture plate, 14 strips/well, cultured in culture water, and incubated in an incubator for 6 hours. After 6h incubation, zebra fish is placed in a 6-hole cell culture plate, and vine tea fermentation filtrate with final concentration of 0.625%, 1.25% and 2.5% is added into each hole of an experimental group according to volume fraction, and the zebra fish system culture water is taken as a blank control group and placed in an incubator for continuous incubation for 6h. After a further 6h incubation, zebra fish were anesthetized with 0.02% tricaine, macrophages and neutrophils were observed under a fluorescence microscope for clearance of the tail fin wound and recorded with photographs, counting cell numbers. Statistical data were processed using GraphPad Prism 8.0 software, experimental data were all expressed as mean±sem data, and analytical comparisons were performed using variance test.

3) Results

As shown in fig. 21a, the ampelopsis grossedentata fermentation filtrate inhibited the aggregation of inflammatory cells, and as the concentration increased, the inhibition was stronger; fig. 21b shows the number of cells recruited in the tail fin of individual zebra fish at 6h, and the number of inflammatory cells recruited in the tail fin was found to decrease gradually with increasing concentration of ampelopsis grossedentata fermentation filtrate, with the best 2.5% group effect (P < 0.01), with a statistical ordinate value of 11.4. By establishing a zebra fish tail-breaking inflammation model, the ampelopsis grossedentata fermentation filtrate is found to have a certain anti-inflammatory capability. (P < 0.05) compared to control group (P < 0.01)

6. The inhibiting effect of ampelopsis grossedentata fermentation filtrate on inflammation is explored by establishing an LPS-induced mouse mononuclear macrophage line RAW264.7 cell inflammation model

The specific method comprises the following steps:

1) Materials and reagents

The mouse mononuclear macrophage cell line RAW264.7 is preserved by Guangdong university of medical science and used after passage in the laboratory. RPMI-1640 medium, fetal bovine serum, green-streptomycin mixed solution, MTT cell proliferation detection kit, tyrosinase, L-levodopa, dimethyl sulfoxide (DMSO), alpha-melanocyte stimulating hormone (alpha-MSH) and bacterial Lipopolysaccharide (LPS).

2) Step (a)

(1) Cell culture

Mouse mononuclear macrophage cell line RAW264.7 cell culture with RPMI-1640 containing 10% fetal bovine serum and 1% blue-streptomycin mixed solution based on cell incubator (37 ℃, 5% CO) ₂ ) The medium is subjected to conventional culture for 2-3 days, liquid is changed for 1 time, and 0.25% trypsin/EDTA solution of cells in logarithmic growth phase is taken for digestion and used for experiments.

(2) Effect of Ampelopsis grossedentata fermentation filtrate on TNF-alpha content in LPS-stimulated mouse mononuclear macrophage cell line RAW264.7 cells

Taking logarithmic growth phase cells, adjusting cell density to (4-5) x10 ⁵ Inoculating into 96-well plate at 37 deg.C 5% CO at 100 μl/well ₂ Culturing overnight in an incubator. Setting a blank control group stimulated by LPS, a positive group (100 mug/ml dexamethasone) and an experimental group; adding fermentation filtrate with final concentration of 20%, 10%, 5%, 2.5%, 1.25% and 0.625% into each well of experimental group according to volume fraction, arranging 6 compound wells, and placing 96-well plate into CO after administration ₂ Culturing in an incubator for 24 hours plus or minus 2 hours. The drug concentration was determined using the MTT method. As shown in FIG. 22a, the experimental concentration of the vine tea fermentation filtrate was screened by MTT method, and found that when the concentration was 0.625% -2.5%, the cell viability of RAW264.7 cells was 90% or more, and the TNF-alpha content was measured using this concentration range.

The cells were again cultured according to the above culture method and the optimal concentration, 3 wells were multiplexed in each group, and after the incubation, 200. Mu.L of the cell culture supernatant was collected in a 1.5mL sterile centrifuge tube and tested according to the instructions of the TNF-. Alpha.ELISA test kit. In addition, the concentration of TNF-alpha standard (20 pg/mL-200 pg/mL) is taken as the ordinate, OD ₄₅₀ The value is the abscissa, a standard curve is produced according to the OD of the sample ₄₅₀ The value, the corresponding concentration was found. Concentration and OD of the standard ₄₅₀ The values calculate the regression equation for the standard curve as shown in FIG. 22 b; OD in positive, control, experimental group ₄₅₀ Substituting the values into an equation to calculate the intracellular TNF-alpha content. The average of 3 wells of each group was finally taken as the final TNF-alpha content result. The inhibition ratio was calculated according to equation 4.

Equation 4:

inhibition (%) = (1-T/C) ×100%

T-average value of TNF-alpha content of the test substance;

average value of TNF-alpha content of C-negative control.

3) Results

As shown in 22c, the inhibition rate of TNF-alpha gradually increased with increasing concentration of the vine tea fermentation filtrate, with the highest 2.5% group. Proved by the results, the ampelopsis grossedentata fermentation filtrate can inhibit the production of TNF-alpha in RAW264.7 cells and has the anti-inflammatory and desensitizing effects. (P < 0.05) (P < 0.01) compared to the control group

7. By establishing H ₂ O ₂ Induced human fibroblast (HSF) oxidation model, and explore the oxidation injury resistance protection capability of ampelopsis grossedentata fermentation filtrate

The specific method comprises the following steps:

1) Materials and reagents

Human fibroblasts (HSF) were deposited by the university of guangdong medical science university laboratory and used after passage in this laboratory. DMEM high-sugar culture medium, fetal calf serum, green-streptomycin mixed solution, 0.25% trypsin/EDTA solution, MTT cell proliferation detection kit, dimethyl sulfoxide (DMSO) and H ₂ O ₂ 。

2) Step (a)

(1) Cell culture

Human fibroblasts (HSF) were routinely cultured in a DMEM high-sugar culture medium containing 10% fetal bovine serum and 1% green-streptomycin mixture based on a cell incubator (37 ℃ C., 5% CO 2) with 1-day change of the medium, and the cells in logarithmic growth phase were digested with 0.25% trypsin/EDTA solution for the experiment.

(2) Antioxidant injury protection capability of vine tea fermentation filtrate

Taking logarithmic growth phase cells, adjusting cell density to (4-5) x10 ⁵ Inoculating into 96-well plate at 37 deg.C 5% CO at 100 μl/well ₂ Culturing overnight in an incubator. The final concentration is added to each hole of the experimental group according to the volume fractionRespectively fermenting filtrate of 20%, 10%, 5%, 2.5%, 1.25% and 0.625%, and arranging 6 compound holes in each group; simultaneously, other experimental groups are additionally arranged, and H with different final concentrations is respectively added into each hole ₂ O ₂ 0.25mmol/L, 0.5mmol/L, 1mmol/L, 2mmol/L, respectively; after the administration, the 96-well plate is placed in CO ₂ Culturing in an incubator for 24 hours plus or minus 2 hours. The drug concentration was determined using the MTT method. As shown in FIG. 23, when the concentration of the fermentation broth is 0.625% -1.25%, the activity of HSF cells is above 90%, and the fermentation broth is used as a safe concentration for subsequent experiments; selecting the concentration of the oxidant for establishing an oxidative damage model, wherein the cell activity is about 50%; as shown in FIG. 24, 2mmol/L H ₂ O ₂ The cell viability of the treated HSF cells was 50.5524% as an induction concentration.

Culturing the cells again, after incubation culture, adding 0.625% -1.25% of fermentation filtrate culture medium to act on the cells for 24h, discarding fermentation filtrate-containing culture medium, and adding final concentration of 2mmol/LH ₂ O ₂ Cell viability was measured 1h after stimulation of HSF cells.

3) Results

As shown in fig. 25, it was found that the cell viability of the cell oxidation model subjected to the action of 0.625% -1.25% ampelopsis grossedentata fermentation filtrate was improved, and as the concentration was increased, the cell viability was improved, proving that the ampelopsis grossedentata fermentation broth has a protective effect on oxidative damage of cells. (P < 0.01) and (P < 0.01), compared to the control group.

8. Eye irritation/corrosiveness chicken embryo chorioallantoic membrane test (HET-CAM) of vine tea fermentation filtrate

1) Material

Bai Laihang chick (white laghorn chicken) fertilized chick embryo, fatty alcohol ether sodium sulfate salt mixture, 0.9% NaCl solution, 0.1mol/L NaOH.

2) Step (a)

(1) Chick embryo

SPF-grade chick embryo is purchased back into a rear Rcom MARU MAX incubator with the air chamber end up, incubated at 37.6 ℃ under the conditions of 0.1 ℃ and relative humidity of 46% under the condition of 1%, automatically turned over once every hour when the horizontal direction is inclined by 45 degrees, automatically ventilated, and incubated until the 9 th day for test.

(2) Eye irritation/corrosiveness chick embryo chorioallantoic membrane assay (HET-CAM)

Chick embryos cultivated to 9 days old were checked for candling and the air chambers were opened. The negative control group adopts NaCl solution with the mass concentration of 0.9 percent, the positive control group adopts NaOH solution with the mass concentration of 0.2 percent, 0.3 percent and 0.5 percent, the standard substance positive control group adopts fatty alcohol ether sodium sulfate salt mixture with the mass concentration of 0.5 percent, 1 percent and 5 percent, and the experimental group adopts vine tea fermentation filtrate with the final concentration of 0.625 percent, 1.25 percent and 2.5 percent according to the volume fraction, and the experiment is repeated for 6 times.

After 3min each group received chorioallantoic membrane using the endpoint scoring method, bleeding, coagulation and vascular lysis were observed, endpoint Scores (ES) were calculated, each chick embryo score = the sum of the bleeding, coagulation and vascular lysis levels observed for each chick embryo, ES = the average of the mathematical sums of the chick embryo scores, and the subject eye irritation was classified according to table 1 based on the ES values.

TABLE 1 evaluation of end point scoring results

3) Results

As shown in FIG. 26, a is a negative control, and (b-d) is the case after 3min of exposure of the test group of vine tea fermentation filtrate with a concentration of 0.625%,1.25% and 2.5% respectively to chick embryo allantoic membrane (CAM). Only 2.5% of the groups showed small vascular bleeding, with no dissolution and clotting.

As shown in fig. 27, the positive control and the reference control were used to evaluate the safety performance of the ampelopsis grossedentata fermentation filtrate after 3min of contact with chick embryo allantoic membrane (CAM).

Table 2 shows that the vine tea fermentation filtrate with the concentration of 0.625% -2.5% is non/light in irritation, and demonstrates the safety performance of the vine tea fermentation filtrate.

TABLE 2 end point scoring of Ampelopsis grossedentata fermentation filtrate

In summary, the invention screens a plurality of probiotics to ferment vine tea, obtains the strain most suitable for vine tea fermentation, optimizes the fermentation condition of the strain, and adds novel cellulase Cel 906 to perform combined fermentation, thus finally obtaining vine tea fermentation filtrate. The ampelopsis grossedentata fermentation filtrate contains more flavone, polyphenol and polysaccharide, wherein microbial fermentation and enzymolysis of cellulase are key points for enrichment and separation of effective substances. Then, a whitening experiment is carried out by using the melanoma cells of the mice B16-F10, and the ampelopsis grossedentata fermentation filtrate is found to have stronger inhibition effect on the activity of tyrosinase and melanin synthesis in cells; then, an anti-inflammatory experiment is carried out by using a zebra fish tail-breaking inflammation model and a mouse mononuclear macrophage line RAW264.7 cell, and the ampelopsis grossedentata fermentation filtrate is found to be capable of effectively inhibiting the recruitment of zebra fish inflammatory cells and effectively inhibiting the generation of inflammatory factors TNF-alpha in the RAW264.7 cell. Subsequently, H is established ₂ O ₂ An induced human fibroblast (HSF) oxidation model shows that the ampelopsis grossedentata fermentation filtrate has strong oxidation injury resistance and protection capability. Finally, the chick embryo chorioallantoic membrane test is utilized to verify that the vine tea fermentation filtrate is non-irritating or corrosive in the effective concentration range. Therefore, the vine tea fermentation filtrate has good effect on antioxidation, whitening and anti-inflammatory aspects, and is safe and effective. The invention provides a new thought for the production of natural plant functional raw materials and provides a new raw material for the production of cosmetics.

The foregoing has described in detail the technical solutions provided by the embodiments of the present invention, and specific examples have been applied to illustrate the principles and implementations of the embodiments of the present invention, where the above description of the embodiments is only suitable for helping to understand the principles of the embodiments of the present invention; meanwhile, as for those skilled in the art, according to the embodiments of the present invention, there are variations in the specific embodiments and the application scope, and the present description should not be construed as limiting the present invention.

Claims

1. A vine tea fermentation filtrate is characterized in that:

the preparation method comprises the steps of fermenting a fermentation system consisting of an aqueous solution containing vine tea, novel cellulase Cel906, saccharomycetes, a carbon source and a nitrogen source; the NCBI accession number of the novel cellulase Cel906 is MW076177.

2. A fermentation system for preparing a vine tea fermentation filtrate as claimed in claim 1, characterised in that:

the components comprise an aqueous solution containing vine tea, saccharomycetes, novel cellulase Cel906, a carbon source and a nitrogen source.

3. A fermentation system for preparing a vine tea fermentation filtrate according to claim 2, wherein:

the components are as follows: comprises an aqueous solution of vine tea, a saccharomycete liquid with the volume fraction of 1-9% relative to the total volume of a fermentation system, novel cellulase Cel906, a carbon source with the weight fraction of 1-5% relative to the weight fraction of the materials, and a nitrogen source with the weight fraction of 0.1-0.5% relative to the weight fraction of the materials;

the pH of the fermentation system is 3-12;

the feed liquid ratio is 40g/L-200g/L;

the enzyme activity of the novel cellulase Cel906 is 2596.29U/L, and the ratio of the volume to the weight of the added novel cellulase Cel906 is 4-6mL:7-9g.

4. A fermentation system for preparing a vine tea fermentation filtrate according to claim 3, wherein:

the components are as follows: the fermentation system comprises an aqueous solution of vine tea, yeast liquid with the volume fraction of 3% relative to the total volume of the fermentation system, novel cellulase Cel906, a carbon source with the weight fraction of 2% relative to the weight fraction of the material, and a nitrogen source with the weight fraction of 0.3% relative to the weight fraction of the material;

The pH of the fermentation system is 7;

the feed liquid ratio is 133.35g/L;

the enzyme activity of the novel cellulase Cel906 is 2596.29U/L, and the ratio of the volume to the weight of the added novel cellulase Cel906 is 6mL:7.5g.

5. A process for preparing a vine tea fermentation filtrate using the fermentation system of any one of claims 2-4, which is characterized in that:

the method comprises the following steps:

6. The method for preparing vine tea fermentation filtrate according to claim 5, which is characterized in that:

the fermentation time is 96 hours; the temperature of the fermentation was 35 ℃.

7. The method for preparing vine tea fermentation filtrate according to claim 5, which is characterized in that:

the culture medium for the activation and expansion culture is prepared by the following method: 20g peptone, 10g yeast extract, 70mL molasses, 1g MgSO4.7H ₂ O、0.5gKH ₂ PO ₄ 、2gFeSO ₄ ·7H ₂ O is dissolved in a proper amount of double distilled water, 15ml of 0.2% adenine solution is added, and then the volume is fixed to 1L, and the mixture is autoclaved at 120 ℃ for 15min.

8. The method for preparing vine tea fermentation filtrate according to claim 5 or 7, which is characterized in that:

the conditions of the activation and the expansion culture are 36 ℃, 220rpm and 48 hours, and the activation culture is carried out until the OD ₆₀₀ ＝0.6-0.8。

9. Use of the vine tea fermentation filtrate according to claim 1 in the preparation of cosmetics.

10. Use of the vine tea fermentation filtrate according to claim 9 in the preparation of cosmetics with antioxidant, whitening and anti-inflammatory effects.