CN115181799A

CN115181799A - Markers, methods and systems for predicting, preventing or treating heart failure

Info

Publication number: CN115181799A
Application number: CN202211106641.6A
Authority: CN
Inventors: 郭娜; 杨洪军; 张品; 仪勃交
Original assignee: EXPERIMENTAL RESEARCH CENTER CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
Current assignee: EXPERIMENTAL RESEARCH CENTER CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
Priority date: 2022-09-13
Filing date: 2022-09-13
Publication date: 2022-10-14
Anticipated expiration: 2042-09-13
Also published as: CN115976241A; CN115181799B

Abstract

The invention discloses a marker, a method and a system for predicting, preventing or treating heart failure. Wherein the prediction method comprises measuring phenylacetic acid and its metabolites and/or enterobacter in a sample collected from the subject using the reagentTuricibacterOr the content of a bacterial species from the genus, to obtain a measured value; a step of comparing the measured value with a standard value; when the measured value is higher than the standard value, then predicting the subject as having heart failure, or predicting the subject as having a high risk of having heart failure; when the measured value is lower than the standard value, the subject is predicted not to suffer from heart failure, or the risk of the subject being predicted to suffer from heart failure is low. The invention provides a new target for preventing and treating heart failure, and further verifies the important role of the intestinal Zurich-phenylacetic acid and a metabolite axis thereof in the heart failure.

Description

Markers, methods and systems for predicting, preventing or treating heart failure

Technical Field

The present invention relates to the field of biomedicine, and in particular to markers, methods and systems for predicting, preventing or treating heart failure.

Background

Heart Failure (HF), abbreviated as heart failure, refers to a heart circulatory disturbance syndrome caused by venous return blood volume failing to be fully discharged from the heart due to the failure of the systolic and/or diastolic functions of the heart, resulting in blood stasis in the venous system and insufficient blood perfusion in the arterial system, which is manifested as pulmonary congestion and vena cava congestion. Heart failure is a common clinical syndrome, is the terminal state of many cardiovascular diseases, and is a serious social public health problem facing all countries around the world. With the progression of aging of the population increasing, the prevalence of HF continues to rise year after year, placing a heavy burden on public health care systems and individual homes. Biomarkers play a crucial role in HF clinical practice and in various aspects of patient management, and the use of biomarkers provides a rapid, objective, low-cost quantitative tool that can be used in HF diagnosis, assessing the severity of disease, identifying individuals with significant risk significance and predicting HF patient prognosis.

According to the urgency of occurrence of heart failure, the clinical classification can be acute heart failure and chronic heart failure. There are left heart, right heart and whole heart failure according to the occurrence of heart failure. There are also systolic or diastolic heart failure fractions. Diagnosis of heart failure can be based on the patient's history and objective evidence of abnormalities in cardiac structure or function, such as the presence or absence of enlarged cardiac chambers, third heart sounds, heart murmurs, echocardiographic abnormalities, elevated levels of natriuretic peptide (BNP/NT-proBNP), etc.

The occurrence and discovery of heart failure have quite complex mechanisms, and studies show that IL-6-gp130-JAK-STAT3 plays an important role in hypertrophy and apoptosis disorder. It has also been shown that disorders of energy metabolism can also lead to heart failure. For example, WO2020168247A1 discloses a method of treating heart failure comprising administering to a subject a therapeutically effective amount of a composition comprising isolated mitochondria or a combined mitochondrial reagent. In addition, researchers find that the decrease of calcium ions in cardiac muscle cells and the coupling of excitation and contraction loss play an important role in heart failure.

Changes of a plurality of micromolecular metabolites are involved in different periods of development of the heart failure, changes of specific molecular markers of the heart failure are detected from peripheral blood or excrement, and the method has the advantages of simplicity, convenience, rapidness, small pain, easiness in rechecking and the like, has important significance for clinical diagnosis and treatment of the heart failure, and has wide application prospect. However, to date, reliable biomarkers and effective drugs for heart failure are still lacking, and further intensive studies on molecular mechanisms for preventing and treating heart failure are also needed.

Disclosure of Invention

In order to solve the technical problems in the prior art, the inventor constructs a heart failure rat model and determines key factors related to heart failure mechanisms. According to the invention, the content of the biomarker is obviously increased in heart failure through targeted quantitative analysis, and the intestinal flora markers related to heart failure are determined through 16S rRNA gene sequencing analysis and metagenome sequencing analysis to analyze the diversity and species composition of the intestinal flora related to heart failure. Meanwhile, the invention also carries out correlation analysis and clinical verification on the intestinal flora, phenylacetic acid and metabolite biomarkers thereof. Specifically, the present invention includes the following.

In a first aspect of the invention, there is provided a method for the display of phenylacetic acid and its metabolites and/or intestinal ZurichTuricibacterUse of an amount of an agent in the preparation of a medicament for predicting, detecting or diagnosing heart failure.

In a second aspect of the invention, there is provided the use of an inhibitor in the manufacture of a medicament for the prophylaxis and/or treatment of heart failure, wherein the inhibitor comprises an agent capable of inhibiting phenylacetic acid and its metabolites or inhibiting its production, or an agent which inhibits the activity of the intestinal genus zurich or a species derived therefrom.

In certain embodiments, the use according to the present invention, wherein the prevention and/or treatment refers to curing, alleviating, preventing the occurrence and development of heart failure.

In certain embodiments, the use according to the invention, wherein the production of phenylacetic acid and its metabolites is mediated by the gut microflora, wherein the gut microflora comprises the gut genus zurichTuricibacter。

In certain embodiments, the use according to the invention, wherein the species of the genus zurich include, but are not limited to:Turicibacter sanguinis、Turicibacter sp.TS3、Turicibacter sp.H121。

in certain embodiments, the use according to the invention, wherein the agent that inhibits the production of phenylacetic acid and its metabolites comprises an aspartate aminotransferase inhibitor, an aromatic amino acid aminotransferase inhibitor and/or an aldehyde dehydrogenase inhibitor.

In a third aspect of the invention there is provided the use of a biomarker for the manufacture of a diagnostic product for the diagnosis or prognosis of heart failure or for the assessment of heart failure characterised in that the product is selected from the group consisting of phenylacetic acid and metabolites thereof and/or enterobacter sppTuricibacterAs a comment on the amount ofA value indicator, wherein the diagnostic product is selected from a kit, a diagnostic device and/or a computer system.

In certain embodiments, the use according to the invention, wherein the diagnosis or prognosis comprises the steps of:

(1) Measurement of phenylacetic acid and its metabolites and/or intestinal zurich in a sample collected from a subject using a reagentTuricibacterA step of obtaining a measured value;

(2) A step of comparing the measured value with a standard value; and

(3) When the measured value is higher than the standard value, predicting the subject as having heart failure, or predicting the subject as being at risk of having heart failure; when the measured value is below the standard value, then the subject is predicted as not having heart failure, or the subject is predicted as not at risk of having heart failure.

In certain embodiments, the use according to the invention, wherein the standard value is a value obtained from a biological sample of a normal subject comparable to the age of the subject.

In a fourth aspect of the present invention, there is provided a method of screening for a compound useful for treating heart failure, comprising:

a. measurement of phenylacetic acid and its metabolites and/or enterobacter by means of an agent in a sample collected from a subject suffering from heart failureTuricibacterA step of obtaining a first measurement value;

b. a step of administering the compound to a subject suffering from heart failure;

c. measuring phenylacetic acid and its metabolites and/or enteroclysis Zuricella in a sample collected from a subject with heart failure after administration of the compoundTuricibacterA step of obtaining a second measurement value;

d. a step of comparing the first measurement value and the second measurement value; and

e. screening the compound for a compound useful for treating or slowing heart failure when the second measurement is less than or equal to the first measurement, and screening the compound for a compound not useful for treating or slowing heart failure when the second measurement is greater than the first measurement.

In a fifth aspect of the present invention, there is provided a system for predicting heart failure occurrence risk, comprising:

a data acquisition unit for acquiring at least phenylacetic acid and its metabolites and/or enterobacter from a subjectTuricibacterThe amount data of (a); and

a determination unit for determining the presence of said phenylacetic acid, a metabolite thereof and/or a species of the genus zurichTuricibacterIs compared to a preset threshold, classifying the subject as belonging to a patient at high or low risk of developing heart failure.

According to a sixth aspect of the present invention there is provided a method of preventing and/or treating heart failure comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor or antimicrobial agent, wherein the inhibitor comprises an agent which inhibits phenylacetic acid and its metabolites or its production, and the antimicrobial agent comprises an agent which kills at least part of the intestinal genus zurichTuricibacterOr inhibiting intestinal ZuricemiaTuricibacterGrowth or inhibition of intestinal genus ZuricemiaTuricibacterAny antimicrobial agent in an amount or activity.

The invention discovers that the heart failure disease is up-regulated through researchTuricibacterRelative abundance of the genus increases the amount of phenylacetic acid and its metabolites in serum, based on which molecular mechanisms of a new target of the enterobacter zurich-phenylacetic acid and its metabolites axis for the prevention and treatment of heart failure are proposed. In addition, the influence of phenylacetic acid and its metabolites on heart failure diseases is further verified. The invention provides new insights for the diagnosis, molecular typing, prognosis evaluation and new metabolic pathways of heart failure, not only provides new understanding of the pathological mechanism of heart failure, but also provides new targets and ideas for the research and development of new drugs.

Drawings

FIG. 1 is a comparison of heart function index of ischemic heart failure rats in each group 28 days after molding. (A) Left ventricular Ejection Fraction (EF) (B) left ventricular shortening Fraction (FS) (each group n = 8-13). P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

FIG. 2 shows the hemodynamic index of each group of ischemic heart failure rats molded for one month. (A) left ventricular diastolic pressure (LVEDP) (B) Left Ventricular Systolic Pressure (LVSP) (C) ± dp/dtmin (D) ± dp/dtmax. (each group n = 8-13) P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

Fig. 3 shows the results of serum B-type natriuretic peptide (BNP) and neuronal terminal precursor brain natriuretic peptide (NT-proBNP) detection in ischemic heart failure rats one month after modeling (n =8-13 for each group). P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

Fig. 4 shows phenylacetic acid and its metabolite trend in serum of rats with heart failure after one month of modeling (a) phenylacetic acid and its metabolite trend in serum of rats with ischemic heart failure (B) phenylacetic acid and its metabolite trend in rat heart failure at different time periods (each group n = 8-13). P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

FIG. 5 shows a curve for the quantification of phenylacetic acid and its metabolites.

Fig. 6 shows the result of quantitative determination of phenylacetic acid and its metabolites in serum of heart failure rats one month after molding (n =8-13 for each group).

Fig. 7 is an assay for PAGln in serum from patient groups, data expressed as mean ± SEM, and data analyzed using student's t-test (n =37 per group). P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

FIG. 8 is a phenylacetic acid standard curve (left graph) and the quantitative determination results of the content of phenylacetic acid in the feces of the heart failure rat blank group, the sham operation group and the model group (right graph).

FIG. 9 is a Multiple Reaction Monitoring (MRM) chromatogram of a liquid chromatography-mass spectrometry combined method for measuring phenylacetic acid and its metabolites in the serum of heart failure rat one month after molding; (A) a blank control group; (B) a sham group; (C) a model set; and (D) standard substance.

Fig. 10 is a Venn diagram of the classification of rat intestinal flora OUT in the blank, sham and model groups (numbers in the overlapping portions represent the number of species common in the groups, and numbers in the non-overlapping portions represent the number of species unique to the corresponding group). Control: blank group; and Sham: a sham operation group; model: and (4) model groups.

Fig. 11 shows the ace index of the level of the rat gut flora between the blank, sham and model groups. Control: blank group; and Sham: a sham operation group; model: and (4) model groups. P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

Fig. 12 shows a graph of principal coordinate analysis (PCoA) of rat intestinal flora at genus level among the blank group, the sham group and the model group. Control: blank group; and Sham: a sham operation group; model: and (4) model groups.

Fig. 13 is a graph of the relative abundance distribution of the rat gut flora at genus level for the blank, sham and model groups. Control: blank group; and Sham: a sham operation group; model: and (4) model groups.

Figure 14 shows LEfSe analysis of species with enriched genus level differences in the intestinal microbiota of rats in sham and model groups (significant if LDA > 2). The left column is Model: model set, right hand column Sham: sham operation group.

FIG. 15 is a Spanisman correlation heatmap of phenylacetic acid and differential flora in serum phenylacetylglutamine and feces from rats with heart failure.

FIG. 16 is a Venn chart of the NR species classification of the rat intestinal flora in the blank, sham and model groups. Control: blank group; and Sham: a sham operation group; model: and (4) model groups.

FIG. 17 is a graph of principal coordinate analysis (PCoA) of rat intestinal flora at the NR species level among the blank group, the sham group, and the model group. Control: blank group; and Sham: a sham operation group; model: and (4) model groups.

FIG. 18 the content of phenylacetylglutamine in serumTuricibactersp.TS3 species relativeCorrelation of abundance.

FIG. 19 intestinal flora in heart failure ratsTuricibacterTrend of relative abundance of sp.ts3.

FIG. 20 is a graph of primary coordinate analysis (PCoA) of intestinal flora at a functional level in rats among the blank group, the sham group and the model group. Control: blank group; and Sham: a sham operation group; model: and (4) model groups.

FIG. 21 is a plot of LEfSe differentially enriched in intestinal flora in rats in sham and model groups. (Linear discriminant analysis (LDA) scores were calculated; higher scores indicate greater magnitude of effect, log10 LDA score > 2.0). The left column is Model: model set, right hand column Sham: and (4) a sham operation group.

FIG. 22 shows the in vivo synthetic pathway of phenylacetic acid and its metabolites.

FIG. 23 shows the relative changes of aspartate Aminotransferase (AST), aromatic Amino Acid Transaminase (AAAT) and aldehyde dehydrogenase (ALDH) in the synthetic pathway of phenylacetic acid and its metabolites from rat intestinal flora in metagenomic assay blanks, sham and model groups. P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

FIG. 24 shows the comparison of cardiac function index of ischemic heart failure rats in each group 28 days after molding. (A) Left ventricular Ejection Fraction (EF) (B) left ventricular shortening Fraction (FS) (each group n = 6-9). P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

FIG. 25 is the hemodynamic index of each group of ischemic heart failure rats molded in one month. (A) left ventricular diastolic pressure (LVEDP) (B) Left Ventricular Systolic Pressure (LVSP) (C) ± dp/dtmin (D) ± dp/dtmax. (each group n = 6-9).

FIG. 26 is a graph showing the comparison of cardiac function indexes of various groups of rats with ischemic heart failure after 28 days of molding. (A) Left ventricular Ejection Fraction (EF) (B) left ventricular shortening Fraction (FS). (each group n = 8-13) P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 in comparison to model group

FIG. 27 is the hemodynamic index of each group of ischemic heart failure rats modeled after one month. (a) Left Ventricular End Diastolic Pressure (LVEDP) (B) Left Ventricular Systolic Pressure (LVSP) (C) ± dp/dtmin (D) ± dp/dtmax (each group n = 8-13). P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

Fig. 28 shows the results of detection of serum B-type natriuretic peptide (BNP) and neuronal terminal precursor brain natriuretic peptide (NT-proBNP) in ischemic heart failure rats one month after modeling (n =8-13 for each group). P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

Fig. 29 shows the trend of phenylacetic acid and its metabolites in serum of each group of heart failure rats one month after molding (n =8-13 in each group). P <0.05 compared to model group; p <0.01 compared to model group; p <0.001 compared to model group.

FIG. 30 shows the results of quantitative determination of phenylacetic acid content in feces of rats in the blank group, the sham group, the model group, the administration group and the positive group.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that the upper and lower limits of the range, and each intervening value therebetween, is specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control. Unless otherwise indicated, "%" is percent by weight.

The present invention is described in detail below.

In the present invention, the term "amount" is meant to include content, level, absolute amount, relative amount, and the like.

As used herein, the terms "heart failure," "HF," and "heart failure" are used interchangeably and refer to the failure of venous return to the heart due to a failure of the systolic and/or diastolic function of the heart, resulting in pooling of venous system blood and insufficient perfusion of arterial system blood, thereby causing a cardiac circulatory disorder syndrome.

The present invention provides the use of an inhibitor in the manufacture of a medicament for the prediction, prevention and/or treatment of heart failure, wherein the inhibitor comprises an agent capable of inhibiting or inhibiting the production of phenylacetic acid and its metabolites. Agents that inhibit phenylacetic acid and its metabolites include small or large molecules that are capable of binding phenylacetic acid and its metabolites. Inhibitors for the production of phenylacetic acid and its metabolites include, but are not limited to, compounds, agents or formulations capable of inhibiting, reducing the production of phenylacetic acid and its metabolites. Preferably, the production of phenylacetic acid and its metabolites is mediated by the gut microflora. Further preferably, the phenylacetic acid and its metabolites are of the genus zurichTuricibacterOr a related metabolite derived from a species of the genus.

In the present invention, the agent for inhibiting the production of phenylacetic acid and its metabolites includes an aspartate aminotransferase inhibitor, an aromatic amino acid aminotransferase inhibitor and/or an aldehyde dehydrogenase inhibitor.

The production of phenylacetic acid and its metabolites may be manifested in altered levels thereof, such as an increase or decrease in the amount of phenylacetic acid and its metabolites. It is understood that the functions of phenylacetic acid and its metabolites are related to the physical amounts thereof. Benzene (III)The levels of acetic acid and its metabolites may be detected and quantified by any means known in the art. For example, mass spectrometry such as UPLC-ES1-MS/MS or NMR spectroscopy such as ¹ H-NMR spectrum is used for detection.

It is understood in the art that inhibitors further include antimicrobial agents in addition to the agents described above, and "antimicrobial agent" as used herein refers to a chemical substance that is capable of killing, inhibiting the growth of, or inhibiting the activity of microorganisms. In certain embodiments, antimicrobial agent refers to a compound capable of killing the intestinal genus zurichTuricibacterInhibiting intestinal genus ZuricemiaTuricibacterGrowth or inhibition of intestinal genus ZuricemiaTuricibacterAny chemical species that is active. In certain embodiments, the genus zurich includes, but is not limited to, the following species of this genus:Turicibacter sanguinis、Turicibacter sp.TS3、Turicibactersp.H121. Preferably, the antimicrobial agents of the present invention include broad spectrum antibiotics.

In certain embodiments, the metabolite of phenylacetic acid comprises phenylacetylglutamine, also sometimes referred to herein simply as "PAGln".

The invention further provides phenylacetic acid and its metabolites and/or enterobacter speciesTuricibacterUse in the manufacture of a diagnostic product for diagnosing or predicting the risk of developing heart failure, wherein the diagnostic product is selected from a kit, a diagnostic device and/or a computer system. The diagnosis or prognosis comprises at least:

(2) A step of comparing the measured value with a standard value; and

(3) When the measured value is higher than the standard value, predicting the subject as having heart failure, or predicting the subject as being at risk of having heart failure; when the measured value is below the standard value, then the subject is predicted as not suffering from heart failure, or the subject is predicted as not being at risk of suffering from heart failure.

Step (1)

Step (1) of the present invention is a method for obtaining phenylacetic acid and its metabolites and/or enterobacter in a sample of a subjectTuricibacterA step of obtaining a measured value. Wherein the type of sample is not limited, examples of which include, but are not limited to, tissue samples or fluid samples. Tissue samples include somatic cell samples, and fluid samples include blood or components thereof such as plasma, serum, and the like. The biological sample may be any sample of mammalian origin, preferably of human origin. Examples of types of biological samples that may be used in the present invention include, but are not limited to, one or more of the following: urine, feces, tears, whole blood, serum, plasma, blood components, bone marrow, cells, tissues, organs, body fluids, saliva, cheek swabs, lymph fluid, cerebrospinal fluid, lesion exudate, and other fluids produced by the body. The biological sample may also be frozen, fixed, paraffin embedded or a fresh biopsy.

In the invention, the reagent can be used for displaying phenylacetic acid and metabolites thereof to be detected and/or intestinal ZurichTuricibacterAmount or level of any agent. The agents of the invention may also include other ingredients. Examples of other components include, but are not limited to, LC-MS/MS, amplicon sequencing, and flow cytometry-related assay reagents. In certain embodiments, any one of the above substances may be separately stored in different containers (e.g., vials) in a state separated from the other substance, as long as they can be in contact with each other at the time of use. In addition, preferably, any two or more of the above-mentioned substances may be mixed to exist as a mixture.

In certain embodiments, the other ingredients may be provided separately in the form of a dry powder, or in the form of a solution, e.g., an aqueous solution. The concentrations or amounts of these substances, in the case of their presence in aqueous solution, are readily determinable by those skilled in the art as a function of the individual requirements. For example, for storage purposes, the concentration of the substance may be present in a higher form, and when in service or in use, the concentration may be reduced to a working concentration by, for example, diluting the higher concentration solution.

The reagent of the present invention may be further prepared as a diagnostic agent for detecting heart failure in a subject. The diagnostic agent can be in the form of a diagnostic composition, a diagnostic kit, or any other form in which a plurality of separately present reagents are used in combination.

Step (2)

Step (2) of the present invention is a step of comparing the measured value with a standard value. The standard value may be a specific value or a range of values.

In certain embodiments, a standard value can be a sample test value from a normal subject. Preferably, the values of the sample from a normal subject of an age comparable to that of the subject to be tested, and also preferably, the standard values and the measured values are obtained by the same method.

In certain embodiments, the standard values may also be from different time periods of the same subject. For example, the amount in the sample T1 taken from the subject at a first time point is measured as the standard value, and the amount in the sample T2 taken from the same subject at a second time point is measured as the measured value. Wherein the first point in time T1 is preferably a point in time before no signs of heart failure are shown or present and the point in time at which the second point in time T2 is detected is preferably a point in time after any signs of heart failure are present.

In certain embodiments, standard values for the invention are ranges, e.g., standard values for phenylacetic acid and its metabolites are 0.01-100ng/mL, preferably 10-60 ng/mL, more preferably 10-50 ng/mL.

Step (3)

Step (3) of the present invention is a result determination step. In particular, when the measured value is higher than the standard value, then predicting the subject as having heart failure, or predicting the subject as being at risk of having heart failure; when the measured value is below the standard value, then the subject is predicted as not suffering from heart failure, or the subject is predicted as not being at risk of suffering from heart failure.

The present invention also provides a method for screening compounds useful for treating or ameliorating heart failure, sometimes referred to herein simply as a "screening method". Preferably, the method comprises:

d. a step of comparing the first measurement value and the second measurement value;

In the screening method of the present invention, the subject is preferably an animal model having heart failure, for example, rat, mouse, dog, pig, monkey, orangutan, etc. Such animals may be artificially induced to suffer from heart failure.

The present invention further provides a system for predicting the risk of developing heart failure, comprising:

a determination unit for determining the presence of said phenylacetic acid or its metabolites and/or intestinal ZurichTuricibacterIs compared to a preset threshold, classifying the subject as belonging to a patient at high or low risk of developing heart failure.

The data of the data acquisition unit of the invention can be data obtained by hospital laboratory examination, and can also be acquired by various possible acquisition ways, such as blood detection instruments, detection equipment based on mass spectrometry, liquid chromatography-mass spectrometry, amplicon sequencers and the like and having certain data processing and storage capacities. Such detection devices include, but are not limited to, liquid chromatography mass spectrometry, sequencing systems or platforms, and the like.

It will be appreciated by those skilled in the art that other steps or operations, before, after, or between the steps of the methods involved, may be included as long as the objects of the invention are achieved, for example to further optimize and/or improve the methods described herein.

Examples

1. Construction of Heart failure rat model

1.1 rat left anterior descending coronary artery Ligation (LAD) model preparation

35 male SPF SD rats (purchased from Beijing Huafukang Biotechnology GmbH) with a body weight of 240 + -10 g were fasted 12h before molding after acclimatizing for 3 days. The groups were randomized into the blank group (control), the Sham group (Sham), and the Model group (Model). The model group was anesthetized with 3% pentobarbital sodium solution using sterile saline at a dose of 0.2mL/100 g. The method comprises the steps of removing hair and preparing skin of the chest of a rat, disinfecting, longitudinally cutting the skin by about 2cm along the left edge 1cm of the left sternum under aseptic conditions, carrying out blunt muscle tissue separation between the fourth or fifth auxiliary bones, opening the chest and cutting off the pericardium, hooking the heart by using a blunt retractor, threading between the left auricle and the pulmonary artery cone, ligating the anterior descending branch of the left coronary artery, then quickly placing the heart back into the chest, and suturing the chest and the skin. After ligation of anterior descending branch of left coronary artery, the electrocardiogram of each rat is observed, and the ST segment of arch back is kept to be raised by more than or equal to 0.1mV, namely the rat with myocardial ischemia symptom. The sham group was performed in the same manner as the model animals except that the coronary artery was not ligated.

And (3) standing the blood sample after half month and 1 month of molding in an ice bath for 30min, centrifuging at 4 ℃ and 3000rpm for 10min, subpackaging the supernatant, and freezing and storing in a refrigerator at minus 80 ℃ for later use. Collecting fresh feces of rats by abdominal massage method for intestinal flora analysis, and storing in a refrigerator at-80 deg.C and ultralow temperature for use.

1.2 Rat heart failure model confirmation

And performing cardiac function detection, hemodynamic detection and biochemical index detection 28 days after molding.

When the test result is measured by using a small animal ultrasonic system, the cardiac function test result is shown in figure 1, and the left ventricular Ejection Fraction (EF) and the left ventricular shortening Fraction (FS) of the rat are obviously reduced 28 days after the coronary artery ligation induced acute myocardial infarction compared with the sham operation group and the blank group, which indicates that the rat may have heart failure.

The hemodynamic index of the heart of each group of rats is evaluated by a carotid artery ventricular intubation method. The hemodynamic test results are shown in fig. 2, and hemodynamic evaluation shows that the Left Ventricular End Diastolic Pressure (LVEDP) of the model group is higher than that of the sham operation group and the blank group; in contrast, the left ventricular systolic blood pressure (LVSP), + -dp/dtmin and + -dp/dtmax of the rats receiving coronary ligation were significantly reduced compared to the sham and blank groups.

After one month of rat modeling, serum is taken to carry out detection on rat B-type natriuretic peptide (BNP) and nerve terminal precursor brain natriuretic peptide (NT-proBNP) (by adopting a THERMO full-automatic enzyme marker MK3 according to an ELISA kit). The biochemical indicator detection shows that the BNP and NT-proBNP concentration of the model rat is obviously higher than that of the blank group and the sham operation rat (as shown in figure 3).

1.3 And (4) conclusion: the above results suggest that the rat heart failure model was successfully made.

1.4 patients with Heart failure

In the present invention, 37 heart failure patients (age 35-90 years) were selected from the family hospital in a chat city, and the control group was a healthy group. Study participants provided detailed information about their age, sex, cardiac risk factors and existing heart disease, and received hematological and biochemical examinations.

Heart failure rat serum quasi-targeted metabonomics research based on liquid chromatography-mass spectrometry combined technology

2.1 preparation of Standard solutions

Precisely weighing 1mg of the reference substance, placing the reference substance in a centrifuge tube, dissolving to obtain 1mg/mL of standard solution mother liquor, shaking up, and placing in a refrigerator at 4 ℃ for later use.

2.2 sample preparation

Preparing a methanol extracting solution containing internal standards, wherein the internal standards have the following concentrations: phenylalanine-D5 (26.67 ng/mL), TMAO-D9 (16.67 ng/mL), norepinephrine-D6 (166.67 ng/mL), nicotinic acid-D4 (10 ng/mL), D-Glusone- ¹³ C6 (16.67 ug/mL), L-carnitine-d 3 (0.67 ng/mL), inositol- ¹³ C5 (20 ng/mL) and hypoxanthine-d 3 (6.67 ng/mL), and pre-freezing the extractive solution in a refrigerator at-20 deg.C.

Taking 20uL serum sample, pre-cooling methanol precipitation in an amount which is 10 times that of the serum sample, whirling for 1 min, centrifuging at 4 ℃, rotating at 12000 rpm, centrifuging for 10min, and taking supernatant to be tested.

2.3 chromatographic conditions

The instrument is an ACQUITY UPLC system, waters company; the mobile phase is A:0.1% formic acid-acetonitrile, B:0.1% formic acid-water containing 1nM ammonium formate; the chromatographic column is ACQUITY BEH Amide,100 mm × 2.1 mm,1.7 μm, waters company; the flow rate is 0.3mL/min; the column temperature is 40 ℃; the injection volume was 1. Mu.L.

The mobile phase gradient was:

2.4 Mass Spectrometry conditions

The instrument is a triple quadrupole mass spectrometer, waters corporation; the detection time is 0-20 min; capillary voltage 2 kV; the taper hole voltage is 20V; the elution temperature is 400 ℃; the flow rate of the elution gas is 800L/h; the cone hole gas flow is 150L/h; the ion source temperature is 100 ℃; the collection mode is a positive and negative ion mode; the information of ion pairs for detecting all small molecule metabolites is shown in the following table.

TABLE 1 correspondence of endogenous small molecule species to Cone-hole Voltage, collision energy, parent ions, daughter ions

Relation table

2.5 As a result:

t-tests were performed on targeted compounds to target endogenous small molecules of interest based on the evaluation of metabolite profiles in the blank (control), sham (Sham) and Model (Model) samples of UPLC-MS. Among them, phenylacetic acid, which is one of the differential metabolites having significant changes in the sham-operated group and the model group, and the metabolite trends thereof were changed as shown in fig. 4. The results show that the levels of PAGLn in the serum of rats after one month of modeling are obviously increased relative to the blank group and the sham operation group, and phenylacetic acid and metabolites thereof have time-dependent effects and show an increasing trend in the heart failure process of the rats.

Targeted quantitative analysis of phenylacetic acid and metabolite detection results in rats and patients with heart failure

3.1 preparation of Standard solution

Precisely weighing phenylacetic acid, metabolites thereof and a corresponding standard substance 1mg into a centrifuge tube, and ultrasonically and whirling a proper amount of ultrapure water until the phenylacetic acid, the metabolites thereof and the corresponding standard substance are completely dissolved to obtain a stock solution of 1 mg/mL. All working solutions were obtained by diluting the stock solutions with acetonitrile/water (85, v/v) and stored in a refrigerator at 4 ℃ until use.

3.2 sample preparation

Preparing a methanol extracting solution containing a standard substance (1 ng/mL), and pre-freezing the extracting solution in a refrigerator at the temperature of-20 ℃. Taking 20uL serum sample, pre-cooling methanol precipitation in an amount which is 10 times that of the serum sample, whirling for 1 min, centrifuging at 4 ℃, rotating at 12000 rpm, centrifuging for 10min, and taking supernatant to be tested.

3.3 chromatographic conditions

The instrument is an ACQUITY UPLC system, waters company; the mobile phase is A:0.2% formic acid-acetonitrile, B:0.1% formic acid-water; the chromatographic column is ACQUITY BEH Amide,100 mm × 2.1 mm,1.7 μm, waters corporation; the flow rate is 0.3mL/min; the column temperature was 40 ℃; the injection volume was 1. Mu.L.

The mobile phase gradient was:

3.4 Mass Spectrometry conditions

The instrument is a triple quadrupole mass spectrometer, waters corporation; the detection time is 0-8min; capillary voltage 2.5 kV; the taper hole voltage is 20V; the elution temperature is 400 ℃; the flow rate of the elution gas is 800L/h; the cone hole gas flow is 150L/h; the ion source temperature is 100 ℃; the collection mode is a positive ion mode; the information of ion pairs for detecting phenylacetic acid and its metabolites is shown in Table 2

TABLE 2 corresponding relationship table of phenylacetic acid and its metabolites with respect to taper hole voltage, collision energy, parent ion and daughter ion

3.5 determination of fecal Phenylacetic acid

3.5.1 Preparation of Standard solution

Precisely weighing 1mg of phenylacetic acid and a Phe-d5 standard substance into a centrifuge tube, performing ultrasonic treatment on a proper amount of ultrapure water, and performing vortex till the phenylacetic acid and the Phe-d5 standard substance are completely dissolved to obtain a stock solution of 1 mg/mL. All working solutions used acetonitrile with 1% formic acid: the stock solution was diluted with water (85.

3.5.2 Sample preparation

Preparing a methanol extracting solution containing Phe-d5 (10 ng/mL), and pre-freezing the extracting solution in a refrigerator at the temperature of 20 ℃ below zero. Taking 20 mg of excrement sample, extracting with 400 uL of extracting solution, whirling for 1 min, performing ultrasonic treatment for 3min, centrifuging at 4 ℃ at 12000 rpm for 10min, blowing supernatant nitrogen, redissolving at 100 uL, centrifuging at 4 ℃ at 12000 rpm for 10min, and taking supernatant for sample injection.

3.5.3 Chromatographic conditions

The instrument is an ACQUITY UPLC system, waters company; the mobile phase is A:0.2% formic acid-acetonitrile, B:0.1% formic acid-water; the chromatographic column is ACQUITY BEH Amide,100 mm × 2.1 mm,1.7 μm, waters corporation; the flow rate is 0.3mL/min; the column temperature is 40 ℃; the injection volume was 1. Mu.L.

The mobile phase gradient was:

3.5.4 Conditions of Mass Spectrometry

The instrument is a triple quadrupole mass spectrometer, waters corporation; the detection time is 0-5.5min; the capillary voltage is 1.8 kV; the taper hole voltage is 20V; the elution temperature is 400 ℃; the flow rate of the elution gas is 800L/h; the flow rate of the taper hole gas is 150L/h; the ion source temperature is 100 ℃; the collection mode is a negative ion mode; the information of detecting phenylacetic acid ion pair is as follows:

table of correspondence between phenylacetic acid and taper hole voltage, collision energy, parent ion and daughter ion

3.6 results

The concentrations of phenylacetic acid and metabolites thereof are calculated by a standard curve method by taking a standard product as an internal standard. Wherein, the ordinate is the peak area of phenylacetic acid and its metabolite, and the abscissa is the concentration of phenylacetic acid and its metabolite, as shown in fig. 5, the standard curve is y =64783x +244.05, the linear range is 0.0125-3.2ng/mL, the correlation coefficient is r =0.9999, and the linearity is good. The chromatogram, retention time and peak response of each group of phenylacetic acid and its metabolites and internal standard are shown in FIG. 9. The quantitative result shows that the contents of phenylacetic acid and metabolites thereof are obviously increased in the model group, and the sham operation group has no obvious difference from the blank group. It is shown that heart failure can significantly increase the amount of phenylacetic acid and its metabolites in rats (as shown in FIG. 6).

The results of phenylacetic acid and its metabolites in the serum of heart failure patients are shown in FIG. 7. The standard curve is y =0.673782x +1.34276, the linear range is 1.5625-800 ng/mL, the correlation coefficient is r =0.998, and the linearity is good. The quantitative results showed that the content of PAGln was significantly increased in the heart failure patients compared to the healthy group. Indicating that the heart failure can remarkably increase the content of PAGLn in human bodies.

The phenylacetic acid concentration is calculated by a standard curve method by taking phenylalanine-d 5 as an internal standard. Wherein, the ordinate is phenylacetic acid peak area, the abscissa is phenylacetic acid concentration, the standard curve is y =14.001x +40.549, the linear range is 3.90625-1000 ug/mL, the correlation coefficient is r =0.9998, and the linearity is good (as shown in the left picture of fig. 8). The quantitative results showed that the phenylacetic acid content was significantly increased in the model group compared to the blank control group and the sham operation group (as shown in the right panel of fig. 8). The in vivo phenylacetic acid of the rats with heart failure is obviously increased, and the result is found to be consistent with the result of the enrichment of the function of the macro gene after the subsequent enrichment of the function of the macro gene.

Gene sequencing analysis

4.1 Extraction and PCR amplification of fecal sample DNA

Total DNA from 31 stool samples selected by sequencing (n =9-12 per group) was isolated using E.Z.N.A. soil DNA kit (Omega Bio-tek, norcross, GA, U.S.) extraction kit. Then, the V3-V4 region of the 16S rRNA gene of mouse bacteria was amplified using the primers shown in Table 3, and specific primers were synthesized and amplified by PCR.

TABLE 3 bacterial 16S rRNA Gene sequencing PCR amplification primer information

Name of primer	Sequence of the Pre-primer	Rear primer sequence
			Standard bacteria V3-V4	ACTCCTACGGGAGGCAGCAG	GGACTACHVGGGTWTCTAAT

Amplification system (20 μ L): 4. Mu.L of 5 XStart Fastpfu buffer, 2. Mu.L of 2.5mM dNTPs, 0.8. Mu.L of upstream primer (5 uM), 0.8. Mu.L of downstream primer (5 uM), 0.4. Mu.L of Transstart Fastpfu DNA polymerase, 10 ng of template DNA, ddH ₂ O make up to 20. Mu.L. 3 replicates per sample.

Amplification parameters: pre-denaturation at 95 ℃ for 3min,27 cycles (denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 30 s), then steady extension at 72 ℃ for 10min, and finally storage at 4 ℃ (PCR instrument: ABI GeneAmp type 9700).

4.2 Illumina Miseq sequencing

PCR products from the same sample were mixed and recovered using 2% agarose Gel, purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, union City, calif., USA), detected by 2% agarose Gel electrophoresis, and quantified using Quantus Fluorometer (Promega, USA). The library was constructed using the NEXTflex (TM) Rapid DNA-Seq Kit (Bio Scientific, USA). Sequencing was performed using the Miseq PE300 platform from Illumina (Megaku, shanghai, biotechnology, inc.).

4.3 Data processing

(1) The original sequencing sequence was quality controlled using fastp (https:// github. Com/OpenGene/fastp, version 0.20.0) software, spliced using FLASH (http:// www. Cbcb. Umd. Edu/software/FLASH, version 1.2.7) software: (1) Filtering bases with tail mass value of less than 20 of reads, setting a window of 50bp, if the average mass value in the window is less than 20, cutting back-end bases from the window, filtering reads with quality control of less than 50bp, and removing reads containing N bases;

(2) According to the overlap relation between PE reads, splicing (merge) pairs of reads into a sequence, wherein the minimum overlap length is 10bp;

(3) The maximum mismatch ratio allowed by the overlap region of the splicing sequence is 0.2, and non-conforming sequences are screened;

(4) Samples are distinguished according to the barcode and the primer at the head end and the tail end of the sequence, the sequence direction is adjusted, the number of mismatch allowed by the barcode is 0, and the maximum primer mismatch number is 2.

Using UPARSE software (http:// drive5.Com/UPARSE/, version 7.1), OTU clustering was performed on the sequences based on 97% similarity and chimeras were eliminated. Species classification annotation was performed on each sequence using RDP classifier (http:// RDP. Cme. Msu. Edu/, version 2.2) against the silvera 16S rRNA database (version 138) setting the alignment threshold at 70%.

4.4 bioinformatics analysis

4.4.1 partitioning of Heart failure rat intestinal flora OTU

The spliced optimized Tags were clustered into OTUs for species classification at 97% similarity. The total number of OTUs for the blank group (control), sham group (Sham) and Model group (Model) were: 1255. 1227 and 1288. The Venn plot results show 1044 OTUs overlapping for the Sham (Sham), and Model (control) cohorts, with the number of OTUs unique to each of Sham (Sham), and Model (Model) cohorts being: 55. 60 and 81. As shown in fig. 10, the number of OTUs specific to the model group significantly increased.

4.4.2 Heart failure rat intestinal flora Alpha diversity analysis

The Alpha diversity index was tested for differential analysis using the rank sum test. As shown in fig. 11, compared with the blank group and the sham operation group, the ACE abundance of the model group was significantly increased, which shows that the species number of intestinal flora of rats after model creation is significantly increased, indicating that the heart failure disease significantly increases the diversity of intestinal flora of rats.

4.4.3 Heart failure rat intestinal flora Beta diversity analysis

Beta diversity is calculated by a weighted UniFrac method, and Beta diversity is visually displayed by principal co-ordinates analysis (PCoA). As can be seen from fig. 12, there was a significant difference in distribution between the groups, and the model group was completely separated from the blank group and the sham group, indicating that the intestinal flora structure of the heart failure rats alone was significantly changed. The above results suggest that the model group has a unique diversity compared to the blank and sham groups.

4.4.4 Heart failure rat gut flora species composition analysis

Comparative analysis was performed on the bacteria of the top 20 genus levels, and as shown in FIG. 13, it was found that the most abundant of the three groups were norak _ f _ Muribacterae, lactobacillus, etc. in the model group increased in abundance, and unclosed _ f _ Lachnospiraceae, lachnospiraceae _ NK4A136_ group, etc. decreased in abundance.

4.4.5 species analysis of significant differences between groups of intestinal flora in rats with Heart failure

To identify the differentially abundant taxa in the sham and model groups, linear and multi-stage species differential discriminant analysis (LEfSe) was performed on the fecal microbiota composition between the model and sham groups based on 16S rRNA gene sequencing. The LDA-value distribution histogram showed that the model group rats had higher relative abundance of Turicibacter than the sham group (fig. 14). LEfSe analysis indicated that HF significantly altered the composition and distribution of the gut microbiota, while the bacteria gricibacter may be a biomarker for heart failure disease.

4.4.6 correlation analysis between relative abundance of rat intestinal flora in heart failure and phenylacetic acid and metabolite content in serum

The correlation between the relative abundance of the different genera in the model group and the content of phenylacetic acid and metabolites thereof in serum was analyzed based on the LefSe analysis results using Spearman correlation analysis. <xnotran> , g __ Lactobacillus, g __ norank _ f __ norank _ o __ Clostridia _ UCG-014, g __ UCG-005, g __ unclassified _ f __ Oscillospiraceae, g __ Lachnospiraceae _ UCG-006, g __ unclassified _ p __ Firmicutes, g __ Erysipelatoclostridium, g __ Akkermansia, g __ Eubacterium _ brachy _ group, g __ norank _ f __ Desulfovibrionaceae, g __ Flavonifractor, g __ Parabacteroides, g __ Dielma, g __ Turicibacter, g __ Clostridium _ sensu _ stricto _1, g __ Holdemania, g __ Oscillospira, g __ norank _ f __ norank _ o __ norank _ c __ norank _ p __ Firmicutes. </xnotran> As shown in fig. 15, the Spearman correlation analysis results showed that the genus turkibacter is strongly and positively correlated with the phenylacetic acid and phenylacetylglutamine (PAGln) content in the serum.

4.5 And (4) conclusion: heart failure disease increases the content of phenylacetic acid and its metabolites by up-regulating the relative abundance of the genus tulicibacter.

Metagenomic sequencing analysis

5.1 DNA extraction, library construction and metagenomic sequencing

Total genomic DNA was extracted from rat fecal samples using the e.z.n.a. soil DNA kit (Omega Bio-tek, norcross, GA, u.s.) according to the manufacturer's instructions. The concentration and purity of the extracted DNA were determined using TBS-380 and NanoDrop2000, respectively. The DNA extract quality was checked on a 1% agarose gel. DNA extracts were fragmented using Covaris M220 (chinese gene ltd) to an average size of about 400 bp for paired-end library construction. Paired-end libraries were constructed using nextflex (tm) rapid DNA sequences (austin bio Scientific, texas, usa). An adaptor containing the full set of sequencing primer hybridization sites is ligated to the blunt end of the fragment. Illumina Novasek/Hiseq Xten (Illumina Inc., san Diego, calif.) was paired-end sequenced using NovaSeq kit/Hiseq X kit in Majorbio Bio Pharm Technology Co., ltd., china, according to the manufacturer's instructions (www.Illumina.com.).

5.2 Sequence quality control and genome assembly

Performing quality shearing on the adapter sequences at the 3 'end and the 5' end of the reads by using fastp (https:// github. Com/OpenGene/fastp, version 0.20.0); removing reads with the length of less than 50bp, the average base quality value of less than 20 and containing N bases after shearing by using fastp (https:// github. Com/open Gene/fastp, version 0.20.0), and keeping high-quality pair-end reads and single-end reads; the optimized sequences were assembled by splicing using splicing software MEGAHIT (https:// githu. Com/voutcn/MEGAHIT, version 1.1.2) based on the succint de Bruijn graphs principle. And screening contigs with the sequence not less than the optimal sequence bp in the splicing result as a final assembly result.

5.3 Gene prediction, classification and functional annotation

Open Reading Frames (ORFs) within the contig were identified using MetaGene (http:// gene. Cb. K. U-tokyo. Ac. Jp /), predicted ORFs of length at or above 100bp were retrieved and translated into amino acid sequences using the NCBI translation table.

A non-redundant gene catalogue (http:// www. Bioinformatics. Org/CD-HIT/4.6.1) was constructed using CD-HIT with 90% sequence identity and 90% coverage. The quality controlled reads were mapped to a non-redundant gene catalogue with 95% identity (http:// www. Bioinformatics. Org/cd-hit/, version 4.6.1) and gene abundance in each sample was evaluated using a SOAPaligner.

5.4 Species and functional notes

5.4.1 species taxonomy Annotation

Amino acid sequences of non-redundant gene sets were aligned to the NR database using Diamond (http:// www. Diamondsearch. Org/index. Php, version 0.8.35) (BLASTP alignment parameter set expectation value e-value to 1 e-5) and species annotations were obtained from the taxonomic information database corresponding to the NR library, and then abundance of the species was calculated using the sum of abundance of genes corresponding to the species.

5.4.2 KEGG functional notes

The amino acid sequences of the non-redundant gene sets were aligned to the KEGG database (version 94.2) using Diamond (http:// www. Diamondsearch. Org/index. Php, version 0.8.35) (BLASTP alignment parameter set to expect value e-value of 1 e-5). Obtaining the corresponding KEGG function of the gene. The abundance of the corresponding functional class is calculated by using the sum of the abundance of the genes corresponding to KO, pathway, EC and Module.

5.5 Bioinformatics analysis

5.5.1 Heart failure rat gut flora species classification

The total number of species for the blank (control), sham (Sham) and Model (Model) groups were: 19444. 19419 and 18949. The Venn plot results show 16066 overlapping species for the bland (control), sham (Sham) and Model (Model), with the number of OTUs unique to each of the bland (control), sham (Sham) and Model (Model) being: 1010. 956 and 804. As shown in fig. 16, there was a difference in intestinal flora between the groups at the species level.

5.5.2 Diversity analysis of species of rat intestinal flora

Beta diversity was calculated using the weighted UniFrac method and principal coordinate analysis (PCoA) was performed. PCoA indicates differences in microbiota composition between the three groups. Using a permutation multivariate analysis of variance (PERMANOVA) analysis, the results showed significant differences in the distribution of the model group from the sham and blank groups (as shown in fig. 17).

5.5.3 Correlation analysis

In order to determine the relationship between the strain of Turcibacter and phenylacetic acid and its metabolites, the present inventors performed correlation analysis, and the results are shown in FIG. 18. Phenylacetic acid and its metabolites withTuricibacterThere is a significant positive correlation between sp.ts3. Subsequently, the present invention compared the groupsTuricibacterTrend towards ts3 species. As shown in fig. 19, compared to falseSurgical and blank groups, model group speciesTuricibacterTs3 increased significantly.

5.5.4 Functional classification of intestinal flora in heart failure rats

The functional changes in intestinal microbiota of HF rats were predicted using the KEGG database. HF may result in functional changes in metabolic pathways, biosynthesis of secondary metabolites, microbial metabolism in different environments, amino acid biosynthesis, and the like.

5.5.5 Functional diversity analysis of rat intestinal flora

Functional differences between the three groups were analyzed using principal coordinate analysis (PCoA), and both the blank and sham groups were easily separated from the model group as shown in fig. 20.

5.5.6 Analysis of functional significant difference among intestinal flora groups of heart failure rats

The histogram of distribution of LDA values according to LEfSe analysis showed (as shown in fig. 21) that the sham group was rich in phenylalanine, lysine and tryptophan biosynthetic pathways and the model group was rich in methane metabolic pathways. By consulting the kegg database, the present invention speculates on the in vivo production pathway of phenylacetic acid and its metabolites, as shown in fig. 22.

5.5.7 Analysis of differences among intestinal flora metabolic pathways of heart failure rats

Based on the kegg annotation result, a metagenome sequencing technology is used for carrying out differential enzyme test on the phenylalanine metabolic pathway. Paired samples of multiple sets of enzymes involved in this metabolic pathway were subjected to a t-test to test the significance of the differences between the sets. The results showed that aspartate Aminotransferase (AST), aromatic Amino Acid Aminotransferase (AAAT), and aldehyde dehydrogenase (ALDH) were elevated in the model group, as shown in fig. 23.

5.6 And (4) conclusion: heart failure disease in rats by affectingTuricibacterTS3 bacterial regulates the content of relative enzyme in the synthetic path of phenylacetic acid and metabolic products to regulate the amount of phenylacetic acid and metabolic products to play the role of causing heart failure.

Verification research of influence of phenylacetic acid and metabolites thereof on heart failure diseases

6.1 rat left anterior descending coronary artery Ligation (LAD) model preparation

45 male SPF SD rats (purchased from Beijing Huafukang Biotechnology GmbH) with a weight of 240 + -10 g are fasted 12h before molding after acclimatizing for 3 days. Randomly divided into blank group, sham group, model group, low dose group, and high dose group. The heart failure model is constructed by performing left anterior descending coronary artery Ligation (LAD) on experimental animals, the electrocardiogram of each rat is observed after the left anterior descending coronary artery ligation, and ST segment arch back elevation is kept to be more than or equal to 0.1mV, namely the rat with myocardial ischemia symptoms. The sham group was performed in the same manner as the model animals except that the coronary artery was not ligated.

After modeling, rats were injected with PAGLN (25 mg/mL) by single subcutaneous injection in the low dose group, PAGLN (50 mg/mL) by single subcutaneous injection in the high dose group, and corresponding physiological saline solution was administered in the blank group, the sham group and the model group, and orbital bleeding was performed 28 days after administration for one month.

6.2 echocardiography

The procedure is as in 1.2. As shown in fig. 24, the left ventricular Ejection Fraction (EF) and left ventricular shortening Fraction (FS) of the rats were significantly reduced at day 28 after the induction of acute myocardial infarction by coronary artery ligation compared to the sham and blank groups; compared with the model group, the left ventricular ejection fraction and the left ventricular shortening fraction of the rats in the low-dose group showed a down-regulation trend, while the rats in the high-dose group showed a significant reduction and showed a dose dependence. Indicating that rats may develop heart failure and phenylacetic acid and its metabolites may exacerbate the severity of heart failure.

6.3 hemodynamic testing

The procedure is as in 1.2. The results are shown in fig. 25, and the hemodynamic evaluation shows that the LVEDP (left ventricular end diastolic blood pressure) of the model group is higher than that of the sham operation group and the blank control group (both P < 0.01), and compared with the model group, the left ventricular end diastolic blood pressure level of the rats of the low dose group and the high dose group is obviously increased; in contrast, LVSP (left ventricular systolic blood pressure), ± dp/dtmin and ± dp/dtmax were significantly reduced in rats receiving coronary ligation (P <0.01 and P <0.001, respectively) compared to sham and blank groups; the low dose and high dose groups were significantly lower than the model group.

6.4 conclusion: the phenylacetic acid and the metabolite thereof have the function of aggravating heart failure and can be used as a novel biomarker of heart failure.

7. Phenylacetic acid and metabolite thereof as heart failure marker for exploring drug effect of erigeron breviscapus pulse-activating treatment on heart failure

7.1 Rat left anterior descending coronary artery Ligation (LAD) model preparation

The procedure is as in 1.1. Rats were randomized to blank and sham prior to LAD. After LAD operation, the electrocardiogram of each rat is observed, the ST segment arch back elevation is kept to be more than or equal to 0.1mV, namely the rat with MI symptom is randomly divided into a model group, a breviscapine pulse administration group and a trimetazidine administration group. Wherein 9 rats in the blank group, 13 rats in each of the sham operation group, the model group, the breviscapine pulse administration group and the trimetazidine administration group. After the model building is finished, the rats are subjected to intragastric administration, wherein corresponding CMCNa solutions are administered to the blank group, the sham operation group and the model group, and the drug and the positive drug solution are administered to the breviscapine pulse administration group and the trimetazidine administration group respectively, and the administration process lasts for one month.

7.2 Echocardiography detection

The procedure is as in 1.2. As shown in fig. 26, the left ventricular Ejection Fraction (EF) and left ventricular shortening Fraction (FS) of the rats were significantly reduced at day 28 after the induction of acute myocardial infarction by coronary artery ligation compared to the sham-operated group and the blank group; compared with the model group, the left ventricular ejection fraction and the left ventricular shortening fraction of the rats in the erigeron pulse-activating group and the trimetazidine administration group show a remarkable callback trend. The results indicate that the rat heart failure model is successfully made, and both trimetazidine and erigeron pulse-activating administration have relieving effect on the rat heart failure model.

7.3 Haemodynamic testing

The procedure is as in 1.2. The results are shown in fig. 27, and the hemodynamic evaluation shows that the LVEDP (left ventricular end diastolic pressure) of the model group is higher than that of the sham operation group and the blank group, and compared with the model group, the left ventricular end diastolic pressure of the rats in the breviscapine pulse administration group and the trimetazidine administration group is significantly reduced; in contrast, LVSP (left ventricular systolic pressure), ± dp/dtmin and ± dp/dtmin were significantly reduced in rats receiving coronary artery ligation compared to sham and blank groups; the erigeron pulse-activating administration group and the trimetazidine administration group are obviously higher than the model group.

7.4 Biochemical index detection

The procedure is as in 1.2. As a result, as shown in FIG. 28, the BNP (shown by A in FIG. 28) and NT-proBNP (shown by B in FIG. 28) concentrations of the model rats were significantly increased compared to the sham-operated group and the blank group. Compared with the model group, the levels of the BNP and NT-proBNP in the rats of the erigeron pulse-activating group and the trimetazidine administration group are reduced. The erigeron breviscapus pulse group and the trimetazidine group have no significant change.

7.5 Based on the liquid chromatography-mass spectrometry combined technology, the steps of simulating targeted quantitative analysis of phenylacetic acid and a metabolite thereof in the serum of a heart failure rat, preparing a standard solution, preparing a sample, and carrying out chromatographic conditions and mass spectrometry are the same as 2.1-2.4.

As shown in fig. 29 and 30, the levels of phenylacetic acid and its metabolites were significantly increased in the model group, decreased in the case of the drug administration group and trimetazidine in the case of the drug administration group, and most significantly decreased in the case of the drug administration group, as compared to the blank group and the sham group. The results indicate that the model building of the heart failure rat model is successful, the level of phenylacetic acid and metabolites thereof of the rat can be effectively reduced by both the administration of the breviscapine and the trimetazidine, and the effect of the breviscapine on promoting blood circulation is most obvious.

The content reduction of phenylacetic acid and metabolites thereof in the serum and the feces of rats with the breviscapine pulse-activating group is detected, so that the effect of treating heart failure of the breviscapine pulse-activating group is prompted.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

Claims

1. For revealing phenylacetic acid and its metabolites and/or enterobacter speciesTuricibacterUse of an amount of the agent in the preparation of a test agent for predicting, detecting or diagnosing heart failure.

2. Use of an inhibitor in the manufacture of a medicament for the prevention and/or treatment of heart failure, wherein the inhibitor comprises an agent capable of inhibiting or inhibiting the production of phenylacetic acid and its metabolites or an agent which inhibits the activity of the intestinal genus zurich or a species derived therefrom.

3. Use according to claim 2, wherein the prevention and/or treatment is cure, alleviation, palliation, prevention of the occurrence and progression of heart failure.

4. Use according to claim 1 or 2, characterized in that the production of phenylacetic acid and its metabolites is mediated by the intestinal microflora.

5. Use according to claim 4, wherein the species of the genus Zuricella comprises at least one of the following species or a combination thereof:Turicibacter sanguinis、Turicibacter sp.TS3、Turicibactersp.H121。

6. use according to claim 5, characterized in that the agents inhibiting the production of phenylacetic acid and its metabolites comprise aspartate aminotransferase inhibitors, aromatic amino acid transaminase inhibitors and/or aldehyde dehydrogenase inhibitors.

7. Use according to claim 1, characterized in that said prediction, detection or diagnosis comprises the following steps:

(1) Measurement of phenylacetic acid and its metabolites and/or enterobacter by means of a reagent in a sample collected from a subjectTuricibacterA step of obtaining a measured value;

(2) A step of comparing the measured value with a standard value; and

8. The use according to claim 7, wherein the standard value is a value obtained from a biological sample of a normal subject comparable to the age of the subject.

9. A method of screening for a compound useful for treating heart failure, comprising:

a. measurement of phenylacetic acid and its metabolites and/or enterobacter by means of an agent in a sample collected from a subject suffering from heart failureTuricibacter(ii) the species of the genus zurich comprises at least one of the following species or combinations thereof:Turicibacter sanguinis、Turicibacter sp.TS3、Turicibacter sp.H121；

10. A system for predicting risk of developing heart failure, comprising:

a data acquisition unit for acquiring at least phenylacetic acid from a subject andmetabolites thereof and/or enterobacter speciesTuricibacterThe species of the genus zurich comprises at least one of the following species or combinations thereof:Turicibacter sanguinis、Turicibacter sp.TS3、Turicibactersp.H121; and

a determination unit for determining the presence of said phenylacetic acid, a metabolite thereof and/or said enterobacteria ZurichTuricibacterIs compared to a preset threshold and the subject is classified as belonging to a patient at high or low risk of developing heart failure.