CN115181752A - Method for improving modified protein efficiency and protein expression quantity by sugar chain plasmid optimization - Google Patents
Method for improving modified protein efficiency and protein expression quantity by sugar chain plasmid optimization Download PDFInfo
- Publication number
- CN115181752A CN115181752A CN202210814690.9A CN202210814690A CN115181752A CN 115181752 A CN115181752 A CN 115181752A CN 202210814690 A CN202210814690 A CN 202210814690A CN 115181752 A CN115181752 A CN 115181752A
- Authority
- CN
- China
- Prior art keywords
- pglb
- pglk
- plasmid
- weca
- glycosylation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1081—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1288—Transferases for other substituted phosphate groups (2.7.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/99—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
- C12Y204/99019—Undecaprenyl-diphosphooligosaccharide—protein glycotransferase (2.4.99.19)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/08—Transferases for other substituted phosphate groups (2.7.8)
- C12Y207/08035—UDP-N-acetylglucosamine—decaprenyl-phosphate N-acetylglucosaminephosphotransferase (2.7.8.35)
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of protein engineering, discloses a method for improving modified protein efficiency and protein expression quantity by optimizing a sugar chain plasmid, and particularly relates to a method for deleting a WecA sequence of a pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid, constructing a novel sugar chain synthetic plasmid pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF and producing N-glycosylation and sialylation N-glycosylation recombinant proteins in E.coli DH5 alpha and E.coli DH5 alpha delta nanKETA (DK 5 alpha), which proves that the action of the WecA gene on the plasmid is very slight and the over-expression of the WecA gene can reduce the yield of the N-glycosylation recombinant proteins. Wherein the sugar chain structure is Gal-beta-1, 4-GlcNAc-beta-1, 3-Gal-beta-1, 3-GlcNAc. The method reduces the burden of producing sugar chains by using plasmids, increases the yield of the sugar chain modified N-glycosylation and sialylation N-glycosylation recombinant proteins, and ensures that the technical platform for producing the sugar chain modified N-glycosylation and sialylation N-glycosylation recombinant proteins by using a dual-plasmid system is more stable.
Description
Technical Field
The invention belongs to the technical field of protein engineering, relates to a method for improving modified protein efficiency and protein expression quantity by sugar chain plasmid optimization, and particularly relates to a method for constructing a novel vector for expressing an N-glycosylation system by deleting a WecA sequence of a tetrasaccharide plasmid.
Background
Early experiments found that the protein expression in the N-glycosylation system was low and that the sugar modification efficiency and sialylation modification efficiency were not ideal.
The WecA gene sequence on the synthetic sugar chain plasmid in the N-glycosylation system is derived from Mycobacterium and can initiate arabinogalactan biosynthesis. Also, it is a base for sugar chain synthesis (Neu 5 Ac-. Alpha. -2, 6-Gal-. Beta. -1, 4-GlcNAc-. Beta. -1, 3-Gal-. Beta. -1, 3-GlcNAc) as N-acetylglucosamine-1-phosphotransferase. The WecA protein is a natural protein of E.coli and is involved in the initiation of lipopolysaccharide synthesis. Some strains: DH 5. Alpha., BL21 (DE 3) and engineered strains, such as E.coli DK 5. Alpha. Strain constructed in this laboratory on the basis of E.coli DH 5. Alpha. Naturally carry the WecA gene on its genome.
Disclosure of Invention
The WecA gene has little effect on glycosylation and sialylation efficiency, but may adversely affect strain growth, protein expression level and glycosylation efficiency. In order to increase the protein expression amount in an N-glycosylation system and improve the sugar modification efficiency and the sialylation modification efficiency, the invention optimizes a sugar chain plasmid in the N-glycosylation system, selects a WecA gene on the sugar chain plasmid for knockout, thereby lightening the production burden of glycoprotein in Escherichia coli, and improving the yield of sugar-modified and sialic acid-modified proteins, wherein the nucleotide sequence of the protein is Seq ID.NO.1.
The technical scheme of the invention is as follows: the N-glycosylation system contains glycosyltransferase lsgCDEF Gene cluster (GenBank: M94855, 1) derived from Haemophilus influenzae (Haemophilus inflenzae), oligosaccharide chain synthesis initiator WecA Gene (Gene ID: 948789) derived from Escherichia coli, oligosaccharide flippase pglK Gene (GenID: 905421) and oligosaccharide transferase pgB Gene (GenID: 905417) derived from Campylobacter jejuni, and deletion of oligosaccharide chain synthesis initiator WecA Gene (GenID: 948789) derived from Escherichia coli does not affect the synthesis efficiency and protein expression level, and is confirmed on the basis of Escherichia coli DH5 alpha and modified recombinant Escherichia coli DK5 alpha.
Wherein the oligosaccharide chain is Gal-beta-1, 4-GlcNAc-beta-1, 3-Gal-beta-1, 3-GlcNAc.
A method for improving the efficiency of modifying protein and the expression level of protein by sugar chain plasmid optimization comprises the following steps:
(1) Deleting a carbohydrate chain synthesis initiator WecA gene from escherichia coli by using an overlapPCR method, reducing the recombination probability of a tetrasaccharide plasmid, thereby enhancing the stability of the synthesized carbohydrate chain plasmid, and constructing a new carbohydrate chain plasmid pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF;
(2) Producing the N-glycosylation recombinant protein and the sialylation N-glycosylation recombinant protein in the escherichia coli in vivo; and (2) transforming the pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF plasmid constructed in the step (1) and the constructed known protein expression plasmid pIG6-Fn3.4.4-plst6-neuBCA into Escherichia coli DH5 alpha and the modified recombinant Escherichia coli DK5 alpha, and producing the N-glycosylated recombinant protein and the sialylated N-glycosylated recombinant protein in the strain in vivo by an IPTG induction or automatic induction culture method.
Wherein, the step (1) is specifically as follows: according to the base sequence of pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid, two pairs of primers are designed on two sides of pglB and pglK respectively, and are respectively as follows:
pglBF1:gaggaattacatatgatgttgaaaaaaga
pglBR1:aaagtttttttagcatcacatcctcatttaaattttaagtttaaaaaccttagcatc
pglKF2:gatgctaaggtttttaaacttaaaatttaaatgaggatgtgatgctaaaaaaacttt
pglKR2:gctttagaaaaagcttcactttgtgc
firstly, taking pglB as a template, and carrying out first PCR amplification by using primers pglB F1 and pglBR 1; and performing second PCR amplification by using primers pglKF2 and pglKR2 by using pglK as a template to obtain two sequences with the lengths of 2142bp and 754bp respectively, namely: pglB and pglK, and obtaining purified PCR fragments at two ends by agarose gel electrophoresis and gel cutting recovery respectively; and performing third PCR amplification by using pglK and pglB as templates through overlapPCR to obtain a pglK + pglB fragment with the length of 2896bp. Then cutting the pglK + pglB fragment and pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid by NdeI and DraIII enzyme, cutting gel, recovering, and connecting the fragment and the vector overnight; finally, the ligation mixture was transformed into E.coli Top 10 strain cells and the WecA fragment of pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid was deleted by integrating the PCR fragment into the pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid by overlap PCR.
The step (2) is specifically as follows: the constructed pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF and pIG6-Fn3.4.4-plst6-neuBCA are jointly transformed into an escherichia coli strain DH5 alpha and an induced recombinant escherichia coli strain DK5 alpha to obtain a recombinant escherichia coli strain with an N-glycosylation modification and sialic acid modification N-glycosylation recombinant protein expression vector, two groups of positive escherichia coli strains with successful protein expression are respectively selected as transformants, the transformants are inoculated onto LB solid medium plates containing 15ug/mL kanamycin, 100ug/mL ampicillin and 34ug/mL chloramphenicol and are cultured overnight at 37 ℃ for 12 hours at 37 ℃, and after single clone is selected, the transformants are inoculated into 3mLLB liquid medium containing 100ug/mL ampicillin and 34ug/mL chloramphenicol and are cultured overnight at 220rpm and 37 ℃; the next day, inoculating the bacterial liquid into a 10mL centrifuge tube containing 100 mu g/mL ampicillin and 34 mu g/mL chloramphenicol at a ratio of 1; in addition, the bacterial solution was inoculated into IPTG medium containing 100. Mu.g/mL ampicillin and 34. Mu.g/mL chloramphenicol at an IPTG induction ratio of 1, cultured at 220rpm at 37 ℃ until the OD value became 0.6 to 0.8, 200. Mu.g/mL-arabinose was added, 1MIPTG and 200. Mu.g/mL-arabinose were added at a ratio of 1.
Further, the method also comprises the step (3) of obtaining the N-glycosylation recombinant protein and the sialylation N-glycosylation recombinant protein which are induced to express at different time points.
Further, the method also comprises a step (4) of analyzing the N-glycosylation efficiency, the sialylation N-glycosylation efficiency and the protein expression quantity of the sugar modification and the sialic acid modification by using WesternBlotting and LectinBlotting.
Compared with the prior art, the invention has the beneficial effects that:
the invention deletes the WecA sequence of pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid, constructs new sugar chain synthetic plasmid pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF and produces N-glycosylation and sialylation N-glycosylation recombinant proteins in E.coli DH5 alpha and E.coli DH5 alpha delta nanKETA (DK 5 alpha), and proves that the WecA gene on the plasmid has little effect and the over-expression of the WecA gene can reduce the yield of the N-glycosylation recombinant proteins. Wherein the sugar chain structure is Gal-beta-1, 4-GlcNAc-beta-1, 3-Gal-beta-1, 2-GlcNAc. The method reduces the burden of producing sugar chains by using plasmids, increases the yield of the sugar chain modified N-glycosylation and sialylation N-glycosylation recombinant proteins, and ensures that the technical platform for producing the sugar chain modified N-glycosylation and sialylation N-glycosylation recombinant proteins by using a dual-plasmid system is more stable.
Drawings
FIG. 1 is a vector map of pC 15-Ara-pglB-. DELTA.WecA-pglK-lsgCDEF of the present invention;
FIG. 2 shows the results of WesternBlotting assay of the effect of the WecA sequence on sialylation N-glycosylation efficiency of the synthetic plasmid for sugar chains carried in the recombinant E.coli DH 5. Alpha. Of the present invention, in which sialylation N-glycosylation protein expressed by IPTG induction and receptor protein Fn33.4.4 are exemplified, wherein: 1.2, 3 and 4 represent deletion of the synthetic sugar chain plasmid WecA sequence, respectively, that is: negative unmodified protein of pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF, 4h induced expression, 16h induced expression and 24h induced expression. 5. 6, 7 and 8 represent that the synthetic sugar chain plasmids contain the WecA sequence, that is: negative unmodified protein of pC15-Ara-pglB-WecA-pglK-lsgCDEF, 4h induced expression, 16h induced expression and 24h induced expression;
FIG. 3 shows the results of WesternBlotting assay of the effect of the WecA sequence on the N-glycosylation efficiency of a sugar chain-synthesizing plasmid carried in vivo by recombinant Escherichia coli DK 5. Alpha. In the present invention, N-glycosylated protein expressed by IPTG induction and receptor protein Fn33.4.4 are exemplified, in which: 1.2, 3 and 4 represent deletion of the WecA sequence on the synthetic sugar chain plasmid, respectively, that is: negative unmodified protein of pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF, 4h induced expression, 16h induced expression and 24h induced expression. 5. 6, 7 and 8 represent negative unmodified proteins containing WecA sequence in the synthetic sugar chain plasmids, 4 h-induced expression, 16 h-induced expression and 24 h-induced expression, respectively.
FIG. 4A shows that recombinant E.coli DK 5. Alpha. Carries a synthetic sugar chain plasmid containing a WecA sequence, namely: pC15-Ara-pglB-WecA-pglK-lsgCDEF, through the result of the WesternBlotting detection of IPTG induction and automatic induction expression sialylation N-glycosylation protein, wherein 1,2, 3, 4, 5, 6, 7 and 8 are negative unmodified protein of IPTG induction expression, 2h induction expression, 4h induction expression, 16h induction expression, 24h induction expression, 36h induction expression and 48h induction expression respectively; 9. 10, 11 and 12 are negative unmodified proteins with automatic induced expression, 36h induced expression, 48h induced expression and 60h induced expression;
FIG. 4B shows that recombinant E.coli DK 5. Alpha. Carries a synthetic sugar chain plasmid not containing the WecA sequence, namely: pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF, through the result of WesternBlotting detection of IPTG induction and automatic induction expression sialylation N-glycosylation protein, wherein 1,2, 3, 4, 5, 6, 7 and 8 are negative unmodified protein of IPTG induction expression, 2h induction expression, 4h induction expression, 16h induction expression, 24h induction expression, 36h induction expression and 48h induction expression respectively; 9. 10, 11 and 12 are negative unmodified proteins which are automatically induced to express, 36h induced expression, 48h induced expression and 60h induced expression.
FIG. 5A shows the results of quantitative analysis of WecA gene sequence on plasmid for the detection of the expression of N-glycosylated recombinant proteins WesternBlotting in vivo of recombinant E.coli DH 5. Alpha. And DK 5. Alpha. Of a two-plasmid system. In the figure, the marks 1 and 2 are respectively the sialylated N-glycosylated proteins of WecA-free and WecA plasmids induced and expressed by IPTG in DH5 alpha strain; 3 represents a positive control; 4. 5 IPTG induced expression of WecA-free and WecA plasmid-containing N-glycosylated proteins in DK5 alpha strain respectively; 6. 7 is sialylated N-glycosylated protein without WecA plasmid in IPTG and auto-induction expression in DK5 alpha strain, respectively; 8. 9 is sialylated N-glycosylated protein expressed by WecA plasmid in IPTG and auto-induction in DK5 alpha strain respectively;
FIG. 5B shows the results of analysis of the expression levels of various sugar-modified proteins;
FIG. 6A is the result of detection of a lectin ECA (CatalogNumber: H-5901-1) blot specifically recognizing Gal- β -1,4-GlcNAc produced by EYlaboratories, inc.: in the figure, the label 1 is a negative unmodified protein; 2. 3 is the sialylated N-glycosylated protein of WecA-free and WecA plasmid induced expression by IPTG in DH5 alpha strain respectively; 4 represents a sialylated N-glycosylated protein; 5. 6 are IPTG induced expression of WecA-free and WecA plasmid-containing N-glycosylated proteins in DK5 alpha strain respectively; 7. 8 is sialylated N-glycosylated protein without WecA plasmid in IPTG and auto-induction expression in DK5 alpha strain respectively; 9. 10 is the sialylated N-glycosylated protein expressed by the WecA plasmid in IPTG and auto-induction in DK5 alpha strain respectively;
FIG. 6B is the result of quantitative analysis of the production of N-sugar chains in each histone expression system;
FIG. 7A shows the result of blotting detection of lectin SNA-I (CatalogNumber: H-6802-1) specifically recognizing Neu5 Ac-alpha-2, 6-Gal, produced by EYLaboratories, inc.: in the figure, the label 1 is a negative unmodified protein; 2. 3 is the sialylated N-glycosylated protein of WecA-free and WecA plasmid induced expression by IPTG in DH5 alpha strain respectively; 4 represents a positive control sialylated N-glycosylated protein; 5. 6 is sialylated N-glycosylated protein without WecA plasmid in IPTG and auto-induction expression in DK5 alpha strain, respectively; 7. 8 is the sialylated N-glycosylated protein expressed by the WecA plasmid in IPTG and auto-induction in DK5 alpha strain respectively;
FIG. 7B is the result of quantitative analysis of the production of sialylated N-sugar chains in each histone expression system.
Detailed Description
The invention will be further described with reference to the accompanying drawings and the detailed description, without affecting the scope of the invention. Unless otherwise indicated, the present invention is commercially available in the form of experimental devices, materials, reagents, etc.
Example 1 deletion of WecA sequence, construction of plasmid, and acquisition of recombinant protein
According to the base sequence of pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid, two pairs of primers are designed on two sides of pglB and pglK respectively, and are respectively as follows:
pglBF1:gaggaattacatatgatgttgaaaaaaga
pglBR1:aaagtttttttagcatcacatcctcatttaaattttaagtttaaaaaccttagcatc
pglKF2:gatgctaaggtttttaaacttaaaatttaaatgaggatgtgatgctaaaaaaacttt
pglKR2:gctttagaaaaagcttcactttgtgc
firstly, taking pglB as a template, and carrying out first PCR amplification by using primers pglB F1 and pglBR 1; and performing second PCR amplification by using primers pglKF2 and pglKR2 by using pglK as a template to obtain two sequences with the lengths of 2142bp and 754bp respectively, namely: pglB and pglK, and obtaining purified PCR fragments at two ends by agarose gel electrophoresis and gel cutting recovery respectively; and performing third PCR amplification by using pglK and pglB as templates through overlapPCR to obtain a pglK + pglB fragment with the length of 2896bp. Then cutting the pglK + pglB fragment and pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid by NdeI and DraIII enzyme, cutting gel, recovering, and connecting the fragment and the vector overnight; finally, the ligation solution was chemically transformed into E.coli Top 10 strain cells, and the PCR fragment was integrated into the pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid by overlap PCR, thereby deleting the WecA fragment of the pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid. The selected positive E.coli were plated on LB solid medium plate containing Chloromyces (34. Mu.g/mL) and cultured overnight at 37 ℃. And (4) carrying out colony PCR identification on the grown single clone by using an identification primer pair. And performing PCR identification and enzyme digestion identification again on the colony extraction plasmid with correct colony PCR identification, and performing gene sequencing identification to determine WecA gene sequence deletion.
The LB solid medium has the following formula: tryptone (tryptone): 4g of the total weight of the mixture; yeast extract (yeastextract): 1.5g; sodium chloride (NaCl): 3g of the total weight of the mixture; the RO water is added to a constant volume of 300mL.
The LB liquid medium formulation is as follows: agar powder: 4-5 g; tryptone (tryptone): 4g of the total weight of the mixture; yeast extract (yeastextract): 2g of the total weight of the mixture; sodium chloride: 4g of the total weight of the mixture; the RO water is added to 400mL.
The formula of the auto-induction culture medium is as follows: 20 XNPS: disodium hydrogen phosphate (Na) 2 HPO 4 ) 22.736g of dipotassium hydrogen phosphate (K) 2 HPO 4 ) 6.8045g; adjusting the pH value to about 7.0-7.2; ammonium sulfate ((NH) 4 ) 2 SO 4 ): volume × 0.5 × 132.14.1MMgSO 4 : magnesium sulfate (MgSO) 4 ) 4.81g; RO water is fixed to 40mL by 5X 5052:12.5g glycerol (glycerol); 1.25g glucose: 5g of the total weight of the feed; alpha-lactose (alpha-lactose); RO water is added to 50mL. ZY medium: tryptone: 4g of the total weight of the mixture; yeast powder: 2g of the total weight of the mixture; RO water is added to 400mL.
The constructed pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF and pIG6-Fn3.4.4-plst6-neuBCA are jointly transformed into an escherichia coli strain DH5 alpha and an induced recombinant escherichia coli strain DK5 alpha, so as to obtain a recombinant escherichia coli strain with an N-glycosylation modification and sialic acid modification N-glycosylation recombinant protein expression vector, and two groups of positive escherichia coli strains with successful protein expression are respectively screened out to serve as transformants.
The transformants were inoculated onto LB solid medium plates containing kanamycin (15 ug/mL), ampicillin (100 ug/mL), and chloramphenicol (34 ug/mL), and cultured overnight at 37 ℃ for 12 hours. After selection of a single clone, the selected single clone was inoculated into 3mL of LB liquid medium containing ampicillin (100 ug/mL) and chloramphenicol (34. Mu.g/mL), and cultured overnight at 37 ℃ at 220 rpm. The next day, the bacterial solution was inoculated into a 10mL centrifuge tube containing ampicillin (100. Mu.g/mL) and chloramphenicol (34. Mu.g/mL) at a ratio of 1; further, the IPTG induction was carried out at a ratio of 1: 100M IPTG and L-arabinose (200. Mu.g/mL) were added, followed by addition of L-arabinose (200. Mu.g/mL) every 12 hours, and samples were taken at 2h, 4h, 8h, 16h, 24 h.
Example 2 in vivo production of N-glycosylated modified and sialic acid modified N-glycosylated recombinant protein in E.coli
The glycosylation and sialic acid modification conditions of the recombinant protein are detected by western blotting detection and lectin blotting detection.
(1) WesternBlotting detection adopts an anti-FLAGM 1 monoclonal antibody produced by Sigma as a primary antibody, horseradish peroxidase-labeled goat anti-mouse IgG produced by Solarbio as a secondary antibody, and uses Fn33.4.4 recombinant protein which is not modified by sugar chains as a negative control to carry out detection analysis on the Fn33.4.4 recombinant protein which is modified by N-glycosylation and sialylation N-glycosylation. Glycosylation and sialic acid modification of the fn33.4.4 recombinant protein were determined by comparison of molecular mobility. The result is shown in fig. 2, fig. 3, fig. 4A, fig. 4B, fig. 5A, fig. 5B. The molecular weight of the Fn33.4.4 recombinant protein is increased after N-glycosylation modification, and the molecular weight is further increased after sialylation N-glycosylation modification.
Lectin blotting was carried out by using lectin ECA (CatalogNumber: H-5901-1) specifically recognizing Gal-. Beta. -1,4-GlcNAc and lectin SNA-I (CatalogNumber: H-6802-1) specifically recognizing Neu5 Ac-a-2, 6-Gal, which were produced by EY Laboratories, respectively, and by using Fn33.4.4 recombinant protein which had not been modified with sugar chains as a negative control, and by analyzing the N-glycosylated Fn33.4.4 recombinant protein and the N-glycosylated Fn33.4.4 recombinant protein which had been modified with sialic acid. As a result of the Western blot analysis of the lectin ECA (CatalogNumber: H-5901-1) lectin specifically recognizing Gal-. Beta.1, 4-GlcNAc produced by EY Laboratories, shown in FIG. 6A, unmodified Fn33.4.4 recombinant protein showed no specific band, and sialic acid-modified N-glycosylated Fn33.4.4 recombinant protein showed a band, which was probably due to whole protein sampling, and the sialylation modification efficiency of the protein hardly reached 100%, whereas the N-glycosylated Fn33.4.4 recombinant protein showed a band, demonstrating that Fn33.4.4 recombinant protein was N-glycosylated-modified, and FIG. 6B shows that the amount of N-sugar chain production was higher without WecA plasmid than with WecA plasmid, namely: group 2 was about 1.5 times higher than group 3, group 5 was about 1 times higher than group 6, group 7 was about 2.5 times higher than group 9, and group 8 was about 4 times higher than group 10; FIG. 7A shows the results of Western blotting test of the lectin SNA-I (CatalogNumber: H-6802-1) produced by EYLaborates, which specifically recognizes Neu5 Ac-a-2, 6-Gal, and shows that no specific band appeared in the unmodified Fn33.4.4 recombinant protein, whereas a specific band appeared in the positive control and a specific band was detected in the sialic acid-modified N-glycosylated Fn33.4.4 recombinant protein, demonstrating that the Fn33.4.4 recombinant protein was modified by sialyl N-glycosylation, and the quantitative analysis in FIG. 7B shows that the production amount of sialyl N-sugar chain without WecA plasmid was higher than that of sialyl N-sugar chain carrying WecA plasmid, namely: group 2 was about 2 times higher than group 3, group 5 was about 2.5 times higher than group 7, and group 6 was about 4 times higher than group 8.
The results were statistically analyzed using Prism (7.0), the data were expressed as mean ± standard deviation (mean ± SD), and the mean comparisons between the two groups were statistically analyzed using the t-test. Differences between the two groups were considered statistically significant when P < 0.05. Note: two groups compared p <0.01, p <0.05, ns were not statistically different.
The embodiments of the present invention are not limited thereto, and other embodiments may be made according to the above-mentioned contents of the present invention without departing from the basic technical idea of the present invention according to the general technical knowledge and common methods in the art. For example, other E.coli intracellular expression vectors and the like can be used to express the recombinant protein of this type. Therefore, the present invention can be modified, replaced or changed in other various forms without departing from the scope of the present invention.
Claims (5)
1. A method for improving efficiency of modifying a protein and an expression level of the protein by sugar chain plasmid optimization, which is characterized by comprising the following steps:
(1) Deleting a carbohydrate chain synthesis initiator WecA gene from escherichia coli by using an overlap PCR method, reducing the recombination probability of a tetrasaccharide plasmid, thereby enhancing the stability of the synthesized carbohydrate chain plasmid, wherein the constructed new carbohydrate chain plasmid is pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF;
(2) Producing the N-glycosylation recombinant protein and the sialylation N-glycosylation recombinant protein in the escherichia coli in vivo; and (2) transforming the pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF plasmid constructed in the step (1) and the constructed known protein expression plasmid pIG6-Fn3.4.4-plst6-neuBCA into Escherichia coli DH5 alpha and the modified recombinant Escherichia coli DK5 alpha, and producing the N-glycosylated recombinant protein and the sialylated N-glycosylated recombinant protein in the strain in vivo by an IPTG induction or automatic induction culture method.
2. The method for improving the efficiency of modifying proteins and the expression level of proteins by optimizing sugar chain plasmids according to claim 1, wherein the step (1) is specifically: according to the base sequence of pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid, two pairs of primers are designed on two sides of pglB and pglK respectively, and are respectively as follows:
pglB F1:gaggaattacatatgatgttgaaaaaaga
pglB R1:aaagtttttttagcatcacatcctcatttaaattttaagtttaaaaaccttagcatc
pglK F2:gatgctaaggtttttaaacttaaaatttaaatgaggatgtgatgctaaaaaaacttt
pglK R2:gctttagaaaaagcttcactttgtgc
firstly, taking pglB as a template, and carrying out first PCR amplification by using primers pglB F1 and pglB R1; and performing second PCR amplification by using primers pglK F2 and pglK R2 by using pglK as a template to obtain two sequences with the lengths of 2142bp and 754bp respectively, namely: pglB and pglK, and obtaining purified PCR fragments at two ends by agarose gel electrophoresis and gel cutting recovery respectively; performing third PCR amplification by using pglK and pglB as templates through overlap PCR to obtain a pglK + pglB fragment with the length of 2896bp; then the pglK + pglB fragment and the pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid are cut by NdeI and DraIII enzyme, and the fragment and the vector are connected overnight after gel cutting and recovery; finally, the ligation mixture was transformed into E.coli Top 10 strain cells and the WecA fragment of pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid was deleted by integrating the PCR fragment into the pC15-Ara-pglB-WecA-pglK-lsgCDEF plasmid by overlap PCR.
3. The method for optimizing and improving the efficiency of modifying proteins and the expression level of proteins by using sugar chain plasmids as claimed in claim 1, wherein the step (2) is specifically: the constructed pC 15-Ara-pglB-delta WecA-pglK-lsgCDEF and pIG6-Fn3.4.4-plst6-neuBCA are jointly transformed into an escherichia coli strain DH5 alpha and an induced recombinant escherichia coli strain DK5 alpha to obtain a recombinant escherichia coli strain with an N-glycosylation modification and sialic acid modification N-glycosylation recombinant protein expression vector, two groups of positive escherichia coli strains with successful protein expression are respectively selected as transformants, the transformants are inoculated onto LB solid medium plates containing 15ug/mL kanamycin, 100ug/mL ampicillin and 34ug/mL chloramphenicol and are cultured overnight at 37 ℃ for 12 hours, and after single clone is selected, the transformants are inoculated into 3mL LB liquid medium containing 100ug/mL ampicillin and 34ug/mL chloramphenicol and are cultured at 220rpm and 37 ℃; the next day, inoculating the bacterial liquid into a 10mL centrifuge tube containing 100 mu g/mL ampicillin and 34 mu g/mL chloramphenicol at a ratio of 1; in addition, the bacterial solution was inoculated into IPTG medium containing 100. Mu.g/mL ampicillin and 34. Mu.g/mL chloramphenicol at a ratio of 1 IPTG induction, cultured at 220rpm at 37 ℃ until OD was 0.6 to 0.8, and 200. Mu.g/mL L-arabinose was added, after 6 hours 1M IPTG and 200. Mu.g/mL L-arabinose were added at a ratio of 1.
4. The method for improving the efficiency of modifying proteins and the expression level of proteins by plasmid optimization of sugar chains according to claim 1, comprising the step (3) of obtaining the N-glycosylated recombinant proteins and the sialylated N-glycosylated recombinant proteins induced to be expressed at different time points.
5. The method for improving the efficiency of modifying proteins and the expression level of proteins by plasmid-based optimization of sugar chains according to claim 1, comprising the step (4) of analyzing the N-glycosylation efficiency, sialylation N-glycosylation efficiency and the expression level of proteins by sugar modification and sialic acid modification by Western Blotting and Lectin Blotting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210814690.9A CN115181752A (en) | 2022-07-12 | 2022-07-12 | Method for improving modified protein efficiency and protein expression quantity by sugar chain plasmid optimization |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210814690.9A CN115181752A (en) | 2022-07-12 | 2022-07-12 | Method for improving modified protein efficiency and protein expression quantity by sugar chain plasmid optimization |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115181752A true CN115181752A (en) | 2022-10-14 |
Family
ID=83518360
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210814690.9A Pending CN115181752A (en) | 2022-07-12 | 2022-07-12 | Method for improving modified protein efficiency and protein expression quantity by sugar chain plasmid optimization |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115181752A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104080921A (en) * | 2011-11-04 | 2014-10-01 | 康奈尔大学 | Prokaryote-based cell-free system for synthesis of glycoproteins |
| CN107904254A (en) * | 2017-11-28 | 2018-04-13 | 大连大学 | A kind of method using Escherichia coli extracellular production N glycosylation recombinant proteins |
| CN108774628A (en) * | 2018-07-02 | 2018-11-09 | 南开大学 | Synthesis causes the colibacillus engineering and purposes of neonatal meningitis Escherichia coli Glycoprotein binding vaccine |
| CN109852651A (en) * | 2018-12-27 | 2019-06-07 | 大连大学 | A kind of recombination bacillus coli matter week intracavitary production sialic acid modification N- glycosylation recombinant protein method |
| US20200325457A1 (en) * | 2017-12-21 | 2020-10-15 | The Regents Of The University Of California | Sialyl transferase variants having neosialidase activity |
| WO2022135700A1 (en) * | 2020-12-22 | 2022-06-30 | Chr. Hansen HMO GmbH | Sialyltransferases for the production of 6'-sialyllactose |
-
2022
- 2022-07-12 CN CN202210814690.9A patent/CN115181752A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104080921A (en) * | 2011-11-04 | 2014-10-01 | 康奈尔大学 | Prokaryote-based cell-free system for synthesis of glycoproteins |
| CN107904254A (en) * | 2017-11-28 | 2018-04-13 | 大连大学 | A kind of method using Escherichia coli extracellular production N glycosylation recombinant proteins |
| US20200325457A1 (en) * | 2017-12-21 | 2020-10-15 | The Regents Of The University Of California | Sialyl transferase variants having neosialidase activity |
| CN108774628A (en) * | 2018-07-02 | 2018-11-09 | 南开大学 | Synthesis causes the colibacillus engineering and purposes of neonatal meningitis Escherichia coli Glycoprotein binding vaccine |
| CN109852651A (en) * | 2018-12-27 | 2019-06-07 | 大连大学 | A kind of recombination bacillus coli matter week intracavitary production sialic acid modification N- glycosylation recombinant protein method |
| WO2022135700A1 (en) * | 2020-12-22 | 2022-06-30 | Chr. Hansen HMO GmbH | Sialyltransferases for the production of 6'-sialyllactose |
Non-Patent Citations (4)
| Title |
|---|
| ARSHPREET BHATWA, ET AL.: "Challenges Associated With the Formation of Recombinant Protein Inclusion Bodies in Escherichia coli and Strategies to Address Them for Industrial Applications", FRONTIERS IN BIOENGINEERING AND BIOTECHNOLOGY, vol. 9, pages 1 - 18 * |
| JING ZHU, ET AL.: "An Engineered Pathway for Production of Terminally Sialylated N-glycoproteins in the Periplasm of Escherichia coli", FRONTIERS IN BIOENGINEERING AND BIOTECHNOLOGY, vol. 8, pages 1 - 9 * |
| NING DING, ET AL.: "Improving production of N‑glycosylated recombinant proteins by leaky Escherichia coli", 3 BIOTECH, pages 1 - 10 * |
| 阮瑶等: "大肠埃希菌CLM37 菌株Lpp 基因敲除及胞外表达N - 糖基化 重组蛋白研究", 上海交通大学学报（医学版）, vol. 38, no. 11, pages 1306 - 1311 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110804577A (en) | Escherichia coli engineering strain for producing 2' -fucosyllactose | |
| CN109554385B (en) | Method for preparing 2-fucosyllactose by genetic engineering bacteria | |
| US11111485B2 (en) | Expression system for Psicose epimerase and production for Psicose using the same | |
| CN112430562A (en) | Genetically engineered bacterium for producing N-acetylglucosamine and application thereof | |
| US10508279B2 (en) | Recombinant Escherichia coli for high efficiency production of fructosylated chondroitin and method for making thereof | |
| WO2024045620A1 (en) | Recombinant strain for producing 2'-fucosyllactose, construction method, and use | |
| BRPI0721283B1 (en) | HOST CELL, METHODS FOR PRODUCING A POLYPEPTIDE AND FOR PRODUCING BIOETHANOL AND USE OF A POLYPEPTIDE, NUCLEIC ACID MOLECULE OR HOST CELL | |
| CN115181752A (en) | Method for improving modified protein efficiency and protein expression quantity by sugar chain plasmid optimization | |
| US9845475B2 (en) | Expression vector | |
| CN112375723B (en) | Engineering bacteria for producing maleic acid and construction method and application thereof | |
| CN113249353B (en) | N-glycosyltransferase mutant F13 and application thereof | |
| CN116676243A (en) | Construction method and application of recombinant escherichia coli producing 2' -fucosyllactose | |
| US20210292801A1 (en) | Method of producing a sialylated n-glycosylated recombinant protein in periplasm of a recombinant escherichia coli | |
| CN109852601B (en) | N-glycosylation alginate lyase mutant capable of being efficiently applied and construction method of genetic engineering bacteria | |
| CN110591997A (en) | Genetic engineering bacterium for improving activity of xylonic acid dehydratase and construction method and application thereof | |
| EP4344401A1 (en) | A genetically engineered bacterium and its application in the preparation of sialyllactose | |
| CN117736280A (en) | SecY protein mutant, genetically engineered bacterium and application | |
| CN116042666A (en) | Overexpression genes galK, galT and engineering bacteria thereof | |
| CN117925492A (en) | Construction and application of recombinant escherichia coli for efficiently synthesizing difucosyl lactose from head | |
| CN117004543A (en) | Genetically engineered bacterium for producing methyl selenocysteine and preparation and application thereof | |
| CN115786153A (en) | Pichia pastoris recombinant strain for high-yield farnesene as well as construction method and application thereof | |
| KR100379672B1 (en) | Process for expressing a isomaltulose synthetase using the gene originated from Erwinia rhapontici | |
| CN117535263A (en) | S-adenosylmethionine synthetase mutant based on 297 locus and application thereof | |
| CN117802185A (en) | Method for preparing NMNH by whole cell catalysis | |
| CN117736954A (en) | Escherichia coli capable of efficiently transporting lactose-N-neotetraose and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |