CN115161299B - Aldehyde ketone reductase mutant with 158-bit mutation and application thereof - Google Patents
Aldehyde ketone reductase mutant with 158-bit mutation and application thereof Download PDFInfo
- Publication number
- CN115161299B CN115161299B CN202210522265.2A CN202210522265A CN115161299B CN 115161299 B CN115161299 B CN 115161299B CN 202210522265 A CN202210522265 A CN 202210522265A CN 115161299 B CN115161299 B CN 115161299B
- Authority
- CN
- China
- Prior art keywords
- scecpr
- plasmid
- leu
- lys
- glu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
- C12P41/002—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by oxidation/reduction reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
- C12R2001/19—Escherichia coli
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a semi-rational design and biocatalysis application of a Saccharomyces cerevisiae-derived aldehyde ketone reductase SceCPR, and belongs to the field of protein engineering. The invention provides an aldehyde ketone reductase mutant through homologous modeling, molecular alignment and molecular docking, which mutates serine at 158 th site shown in amino acid sequence 2 in a sequence table into alanine SceCPR S158A Obtaining the aldehyde ketone reductase mutant with improved enzyme activity. SceCPR, sceCPR S158A The specific enzyme activities of (C) are respectively 32.62U/mg and 119.4U/mg, sceCPR S158A The specific enzyme activity is improved by 3.66 times.
Description
Technical Field
The present invention relates to aldehyde ketone reductase mutants (SceCPR S158A ) The construction and expression of the enzyme, and the property and preparation research of the enzyme, belonging to the technical fields of genetic engineering and enzymology research.
Background
D-Pantothenic Acid (PA), also known as vitamin B5, is present in plants and parts of microorganisms and has a variety of physiological functions. First, pantothenic acid participates in metabolism as an energy substance, which is not only a substance necessary for brain nerves but also can maintain health of blood, skin and hair. Secondly, pantothenic acid is used as a precursor for synthesizing coenzyme a, and aids in the biosynthesis reaction of fatty acids and lipids, and D-pantothenic acid deficiency inhibits production of coenzyme a, resulting in a decrease in free radical scavenging efficiency and phospholipid synthesis efficiency, and ultimately affecting the operation of the nervous system and metabolic functions.
D-Pantolactone (D-PL) is an important precursor for the synthesis of D-pantothenic acid, and can be used for the synthesis of isoprene, a molluscide A macromolecular lactone compound, D- (-) -noviose, and the like. The synthetic methods of D-PL include chemical methods, enzymatic methods and chemoenzymatic methods. The chemical synthesis method of D-PL is that formaldehyde and isobutyraldehyde are used as starting materials, the D/L-PL is produced through the reactions of aldehyde condensation, nitrile formation, lactonization and the like, and then the D-PL is obtained through selective resolution, the whole process is mature, but the total reaction steps are more, the reaction conditions are severe, and the acid-base consumption is large and the energy consumption is higher. The development of biotechnology provides important feasibility for synthesizing D-PL by a biological enzyme method. At present, the industrialized synthesis of D-PL adopts a technical route combining a chemical method and a hydrolytic enzyme resolution method. Under the action of D-pantoic acid lactone hydrolase, D-pantoic acid is selectively hydrolyzed to generate D-pantoic acid, D-pantoic acid is lactonized to generate D-PL, and the remained L-PL is chemically racemized to D/L-PL for re-circulating resolution.
The oxidation-reduction method for catalyzing asymmetric reduction of Ketopantolactone (KPL) can also be used for preparing D-PL, and the specific process is that the D/L-PL oxidizes L-PL into KPL under the action of L-pantolactone dehydrogenase, and then the Ketopantolactone reductase is utilized for asymmetrically reducing the L-PL into D-PL. The whole process is simple and green, and racemization is not needed by a chemical method.
As early as 1974, king HL et al have found that an NADP (H) -dependent ketopantoate reductase derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) was able to reduce KPL to D-PL. In 1989, hata H et al found ketopantolactone reductase from S.cerevisiae NRRL Y-2034, studied its enzymatic properties, found that it had very high affinity for the aldehyde ketone compound isatin (Istain) and its derivatives, which also had good affinity for KPL, K m The value was 0.017mM. NADPH-dependent ketopantolactone reductases belong to the aldehyde-ketone reductase (AKR) superfamily. More CPR is currently studied mainly from CPR-C1 and CPR-2 of Candida parapsilosis IFO 0708, and SceCPR in S.cerevisiae. In 2014, qin HM et al analyzed the protein structure of CPR-C2, which consisted of 13 alpha helices and 8 beta sheets, and had a typical triose phosphate isomerase structural pocket, belonging to a typical AKR family of proteins. Qin HM et alThe molecular action mechanism of CPR-C2 is further provided, and four key catalytic sites Asp58, tyr63, lys88 and His125 are disclosed, wherein Tyr63 and His125 are taken as proton donors, and a charged hydrogen bond formed by Tyr63 and Lys88 promotes proton transfer of Tyr 63; the formation of a salt bridge between Lys88 and Asp58 allows the whole catalytic process and, in addition, reveals CPR-C2 coenzyme binding sites (Gly 26, thr27, ser161, ser215, leu217, arg222, thr260, thr 261).
In 2017, zhao M et al produced D-PL by constructing a "one-bacterium two-enzyme" coenzyme cycle regeneration system, in order to inhibit spontaneous hydrolysis of the substrate KPL, the substrate was added into the reaction in an acidic condition stream, the final product concentration reached 475mM, the yield was about 95%, the e.e. > 99.9%, the space-time yield of the product was 243.45 g.L -1 d -1 . In 2020, peiX et al, developed a biphasic reaction system for whole-cell bioconversion of D-PL using methylene chloride to inhibit spontaneous hydrolysis of KPL. In the fed-batch biphasic reaction, the product concentration of D-PL was 0.77mol/L, with an e.e. > 99%, and a space-time yield of 343.2 g.L -1 d -1 。
However, due to the importance of pantothenic acid and its related products, there is still a need in the industry to further increase the efficiency of D-PL production, reduce its cost of synthesis, and further increase the catalytic activity of SceCPR.
Disclosure of Invention
The invention aims to provide a directional remodelling enzyme of aldehyde ketone reductase with higher specific activity compared with a wild type through molecular docking and directed evolution technology.
The invention is realized by the following technical scheme:
in a first aspect, the invention provides an aldehyde-ketone reductase mutant comprising the sequence set forth in SEQ ID NO:2 or the 298 th site of the amino acid sequence shown in the formula 2 or the 158 th site and the 298 th site of the amino acid sequence are subjected to double mutation.
Specifically, the mutant is produced by combining SEQ ID NO:2, and performing mutation on the amino acid sequence shown in the formula 2 to obtain the amino acid sequence: (1) Tyrosine at 298 th site is mutated into histidine, and the amino acid sequence is shown as SEQ ID NO:6 is shown in the figure; (2) Serine at 158 th and tyrosine at 298 th are mutated into alanine and histidine respectively, and the amino acid sequences are shown in SEQ ID NO: shown at 8.
In a second aspect, the present invention provides a gene encoding the above-described aldehyde ketoreductase mutant. The nucleotide sequences of the coding genes are respectively shown in SEQ ID NO: 5. SEQ ID NO: shown at 7.
In a third aspect, the present invention provides a recombinant expression plasmid containing the above-described coding gene.
Preferably, the recombinant expression plasmid vector is pEASY-Blunt E1. The recombinant expression plasmid is obtained by inserting the coding gene into a multiple cloning site (multiple cloning sites, MCS) of a pEASY-Blunt E1 plasmid.
The recombinant expression plasmid is further constructed according to the following method:
(1) Taking E.coli DH5 alpha strain containing plasmid pACYCDuet1-SceCPR/EsGDH as a template, carrying out PCR amplification by using the following primers, and purifying and recovering PCR products to obtain the target gene:
SceCPR-F TCATCATCATATGGGCTCATTTCATCAGCAG
SceCPR-R GTTATGCTAGTCACACTTTCTGGGCCGC
the plasmid pACYCDuet1-SceCPR/EsGDH is obtained by respectively inserting a gene with the accession number of EGA59421.1 and a gene with the accession number of KM817194.1 into the cleavage sites Nco I and HindIII and Nde I and Xho I of the same plasmid pACYCDuet-1;
(2) PCR amplification is carried out by taking pEASY-Blunt E1 plasmid as a template and the following primers, and the PCR product is purified and recovered to obtain a linearization vector:
pEASY-Blunt E1-F GAAAGTGTGACTAGCATAACCCCTTGGGGC
pEASY-Blunt E1-R ATGAGCCCATATGATGATGATGATGATGAGAACCC
(3) Connecting the target gene in the step (1) and the linearization vector in the step (2) through a one-step cloning kit, transferring the obtained connection product into competent cells, screening on a culture medium containing (100 mug/mL) ampicillin, picking up monoclonal sequencing for verification, and extracting plasmids to obtain the wild type expression plasmids;
(4) Taking the wild expression plasmid in the step (3) as a template, carrying out full plasmid site-directed mutagenesis PCR with the following primers, transferring the obtained PCR product into E.coli DH5 alpha competent cells after purification, screening on a culture medium containing (100 mug/mL) ampicillin, picking up monoclonal sequencing for verification, extracting the plasmid, and obtaining recombinant expression plasmid A:
Y298H-F
CGCCTGCATTGGAACAAACTGTATGGCAAATATAATTATGCG
Y298H-R GTTCCAATGCAGGCGCAGTGGTTCATGTTCTAAGCCCA
(5) Taking the wild expression plasmid in the step (3) as a template, sequentially carrying out two rounds of full plasmid site-directed mutagenesis PCR by using the following two pairs of primers, transferring the obtained PCR product into E.coli DH5 alpha competent cells after purification, screening on a culture medium containing ampicillin, picking up monoclonal sequencing for verification, extracting the plasmid, and obtaining recombinant expression plasmid B:
S158A-F GGCGTGGCAAATTTTGCGGTGGAAGATTTGCAG
S158A-R AAAATTTGCCACGCCAATATTTTTGGCTTTACCTGACTT
Y298H-F
CGCCTGCATTGGAACAAACTGTATGGCAAATATAATTATGCG
Y298H-R GTTCCAATGCAGGCGCAGTGGTTCATGTTCTAAGCCCA。
the recombinant plasmid A and the recombinant plasmid B are different in the mutation sites on the target gene. Recombinant plasmid a: tyrosine at 298 th site is mutated into histidine, and the amino acid sequence is shown as SEQ ID NO:6 is shown in the figure; recombinant plasmid B: serine at 158 th and tyrosine at 298 th are mutated into alanine and histidine respectively, and the amino acid sequences are shown in SEQ ID NO: shown at 8.
The recombinant expression plasmid can be directly sent to a company for synthesis, or can be obtained by inserting a target gene into an expression vector by any conventional means known to a person skilled in the art, and the recombinant expression plasmid capable of expressing three aldehyde ketone reductase mutants of the invention is within the protection scope of the invention, and the invention only provides a method for actual operation of the inventor.
In a fourth aspect, the invention provides a recombinant genetically engineered bacterium constructed by the recombinant expression plasmid.
In one embodiment of the invention, the host cell of the recombinant genetically engineered bacterium is E.coli BL21 (DE 3).
Specifically, the recombinant genetically engineered bacterium is constructed according to the following method: transferring the recombinant expression plasmid into E.coli BL21 (DE 3) competent cells by using a heat shock method, uniformly coating a conversion product on an LB solid medium containing 100 mug/mL ampicillin, culturing overnight at 37 ℃, and picking up monoclonal sequencing for verification to obtain the recombinant genetically engineered bacterium.
In a fifth aspect, the invention provides an application of the aldehyde ketone reductase mutant in catalyzing asymmetric reduction of ketopantolactone to prepare D-pantolactone.
Specifically, the application is: the recombinant genetically engineered bacteria expressing the aldehyde ketone reductase mutant are subjected to induction expression and protein purification to obtain pure enzyme serving as a catalyst, ketopantolactone serving as a substrate and NADPH serving as a coenzyme to construct a reaction system, and asymmetric reduction is carried out at the pH value of 6.0 and the temperature of 35 ℃; in the reaction system, the final concentration of the pure enzyme is 0.5. Mu.g/mL, the final concentration of the ketopantolactone is 50mM, and the final concentration of the NADPH is 60. Mu.M.
In a sixth aspect, the invention provides an aldehyde ketoreductase mutant comprising the amino acid sequence set forth in SEQ ID NO:2, and performing single mutation at position 158 of the amino acid sequence shown in figure 2.
Specifically, the mutant is produced by combining SEQ ID NO:2 by mutating the amino acid sequence shown in the formula 2 as follows: serine at 158 is mutated into alanine, the amino acid sequence of which is shown in SEQ ID NO: 4.
In a seventh aspect, the present invention provides a coding gene of the aldehyde ketone reductase mutant, wherein the nucleotide sequence of the coding gene is shown in SEQ ID NO: 3.
In an eighth aspect, the present invention provides a recombinant expression plasmid containing the above-described coding gene.
Preferably, the recombinant expression plasmid vector is pEASY-Blunt E1. The recombinant expression plasmid is obtained by inserting the coding gene into a multiple cloning site (multiple cloning sites, MCS) of a pEASY-Blunt E1 plasmid.
The recombinant expression plasmid is further constructed according to the following method:
(1) Taking E.coli DH5 alpha strain containing plasmid pACYCDuet1-SceCPR/EsGDH as a template, carrying out PCR amplification by using the following primers, and purifying and recovering PCR products to obtain the target gene:
SceCPR-F TCATCATCATATGGGCTCATTTCATCAGCAG
SceCPR-R GTTATGCTAGTCACACTTTCTGGGCCGC
the plasmid pACYCDuet1-SceCPR/EsGDH is obtained by respectively inserting a gene with the accession number of EGA59421.1 and a gene with the accession number of KM817194.1 into the cleavage sites Nco I and HindIII and Nde I and Xho I of the same plasmid pACYCDuet-1;
(2) PCR amplification is carried out by taking pEASY-Blunt E1 plasmid as a template and the following primers, and the PCR product is purified and recovered to obtain a linearization vector:
pEASY-Blunt E1-F GAAAGTGTGACTAGCATAACCCCTTGGGGC
pEASY-Blunt E1-R ATGAGCCCATATGATGATGATGATGATGAGAACCC
(3) Connecting the target gene in the step (1) and the linearization vector in the step (2) through a one-step cloning kit, transferring the obtained connection product into competent cells, screening on a culture medium containing ampicillin, picking up monoclonal sequencing for verification, and extracting plasmids to obtain the wild expression plasmids;
(4) Taking the wild expression plasmid in the step (3) as a template, carrying out full plasmid site-directed mutagenesis PCR with the following primers, transferring the obtained PCR product into E.coli DH5 alpha competent cells after purification, screening on an ampicillin-containing culture medium, picking up monoclonal for sequencing verification, extracting plasmids, and obtaining the recombinant expression plasmid:
S158-F GGCGTGGCAAATTTTGCGGTGGAAGATTTGCAG
S158-R AAAATTTGCCACGCCAATATTTTTGGCTTTACCTGACTT。
recombinant plasmids A, B and C differ in the mutation site on the gene of interest. Recombinant plasmid a: tyrosine at 298 th site is mutated into histidine, and the amino acid sequence is shown as SEQ ID NO:6 is shown in the figure; recombinant plasmid B: serine at 158 th and tyrosine at 298 th are mutated into alanine and histidine respectively, and the amino acid sequences are shown in SEQ ID NO: shown as 8; recombinant plasmid C: serine at 158 is mutated into alanine, the amino acid sequence of which is shown in SEQ ID NO: 4.
The recombinant expression plasmid can be directly sent to a company for synthesis, or can be obtained by inserting a target gene into an expression vector by any conventional means known to a person skilled in the art, and the recombinant expression plasmid capable of expressing three aldehyde ketone reductase mutants of the invention is within the protection scope of the invention, and the invention only provides a method for actual operation of the inventor.
In a ninth aspect, the present invention provides a recombinant genetically engineered bacterium constructed from the recombinant expression plasmid.
In one embodiment of the invention, the host cell of the recombinant genetically engineered bacterium is E.coli BL21 (DE 3).
Specifically, the recombinant genetically engineered bacterium is constructed according to the following method: transferring the recombinant expression plasmid into E.coli BL21 (DE 3) competent cells by using a heat shock method, uniformly coating a conversion product on LB solid medium containing (100 mug/mL) ampicillin, culturing overnight at 37 ℃, and picking up monoclonal sequencing for verification to obtain the recombinant genetically engineered bacterium.
In a tenth aspect, the invention provides an application of the aldehyde ketone reductase mutant in catalyzing asymmetric reduction of ketopantolactone to prepare D-pantolactone.
Specifically, the application is: the recombinant genetically engineered bacteria expressing the aldehyde ketone reductase mutant are subjected to induction expression and protein purification to obtain pure enzyme serving as a catalyst, ketopantolactone serving as a substrate and NADPH serving as a coenzyme to construct a reaction system, and asymmetric reduction is carried out at the pH value of 6.0 and the temperature of 35 ℃; in the reaction system, the final concentration of the pure enzyme is 0.5. Mu.g/mL, the final concentration of the ketopantolactone is 50mM, and the final concentration of the NADPH is 60. Mu.M.
In summary, the present invention provides directed mutants of aldehyde-ketone reductase SceCPR, which are obtained by combining the amino acid sequences of SEQ ID NO:2, and the position 158 and the position 298 of the amino acid sequence shown in the formula 2 are subjected to single-site mutation and double-site mutation respectively.
Further, the aldehyde ketone reductase SceCPR mutant was mutated at one or both of the following positions: (1) inserting SEQ ID NO:2 into alanine at position 158 of the amino acid sequence shown in FIG. 2, i.e., sceCPR S158A The method comprises the steps of carrying out a first treatment on the surface of the (2) inserting SEQ ID NO:2, the 298 th tyrosine of the amino acid sequence shown in FIG. 2 is mutated to histidine, sceCPR Y298H The method comprises the steps of carrying out a first treatment on the surface of the (3) inserting SEQ ID NO:2, respectively and simultaneously changes serine 158 th and tyrosine 298 th of the amino acid sequence into alanine and histidine, namely SceCPR S158A /Y298H 。
The high specific enzyme activity directed modification enzyme SceCPR of the aldehyde-ketone reductase provided by the invention S158A The nucleotide sequence coded by the nucleotide sequence is shown as SEQ ID NO:3 is shown in the figure; the coded amino acid sequence is shown as SEQ ID NO: 4.
The high specific enzyme activity directed modification enzyme SceCPR of the aldehyde-ketone reductase provided by the invention Y298H The nucleotide sequence coded by the nucleotide sequence is shown as SEQ ID NO:5 is shown in the figure; the coded amino acid sequence is shown as SEQ ID NO: shown at 6.
The high specific enzyme activity directed modification enzyme SceCPR of the aldehyde-ketone reductase provided by the invention S158A/Y298H The nucleotide sequence coded by the nucleotide sequence is shown as SEQ ID NO: shown in figure 7; the coded amino acid sequence is shown as SEQ ID NO: shown at 8.
In a second aspect, the invention also provides a coding gene, a recombinant expression plasmid and mutant protease activity and enzymatic characterization of the aldehyde ketone reductase mutant.
Further, the nucleotide sequence of the coding gene of the aldehyde ketone reductase mutant is shown as SEQ ID NO: 3. SEQ ID NO:5 or SEQ ID NO: shown at 7.
Preferably, the recombinant expression plasmid vector is pEASY-Blunt E1. Such host cells include, but are not limited to, various conventional host cells in the art, with E.coli BL21 (DE 3) being preferred in the present invention.
Further, the recombinant expression plasmid of the aldehyde ketone reductase mutant is prepared by mixing the nucleotide sequence of SEQ ID NO:1 into the multicloning site (multiple cloning sites, MCS) of pEASY-Blunt E1 plasmid.
Particularly preferably, the recombinant expression plasmid of the aldehyde ketoreductase mutant is obtained by the following method:
(1) The SceCPR gene and the linearized pEASY-Blunt E1 plasmid are connected by using a one-step cloning kit (ClonExpress II One Step Cloning Kit) to obtain a recombinant plasmid inserted with the SceCPR gene, and the plasmid map is shown in figure 1;
(2) Taking the recombinant plasmid inserted with the SceCPR gene in the step (1) as a template, carrying out full plasmid site-directed mutagenesis, and carrying out post-treatment on an obtained PCR product to obtain a recombinant expression plasmid of the aldehyde ketone reductase mutant;
further, the post-treatment is as follows: and (3) digesting the PCR product with endoprotease Dpn I at 37 ℃ for 1h, removing template DNA, and purifying with a purification kit to obtain the recombinant expression plasmid fragment of the aldehyde ketone reductase mutant.
Compared with the prior art, the invention has the beneficial effects that: the invention uses homologous modeling and sequence homology analysis to carry out rational transformation on aldehyde-ketone reductase, and constructs engineering bacteria capable of expressing aldehyde-ketone reductase mutants with high activity. Compared with the wild type, the specific enzyme activity of the mutant is obviously improved, and the improvement is 1226.55 percent. The invention also discloses a construction, expression and purification method of the mutant engineering bacteria, and the prepared mutant has higher specific enzyme activity and larger industrial application potential.
Drawings
FIG. 1 schematic representation of recombinant plasmid pEASY-Blunt E1-SceCPR;
FIG. 2 schematically illustrates the docking structure of SceCPR molecules;
FIG. 3 SDS-PAGE of ketopantolactone reductase and its mutants: m is: protein markers; lane 1 is: sceCPR crude enzyme solution; lane 2 is: sceCPR S158A Pure enzyme solution; lane 3 is: sceCPR Y298H Pure enzyme solution; lane 4 is: sceCPR S158A/Y298H Pure enzyme solution;
FIG. 4 effect of different temperatures (. Degree. C.) on SceCPR and mutants;
FIG. 5 effect of different pH on SceCPR and mutants;
FIG. 6SceCPR and results of specific enzyme activity of mutants.
Detailed Description
Materials and reagents used in the examples, unless otherwise specified, were all available from conventional marketing sources;
the experimental methods used in the examples are all conventional methods unless otherwise specified;
the invention is illustrated below by means of specific embodiments. The embodiments are illustrative, and not limiting, of the scope of the invention, which is defined solely by the claims.
The LB medium consists of: 10g/L of tryptone, 5g/L of yeast extract, 10g/L of sodium chloride, deionized water as a solvent and natural pH value;
LB solid medium composition: 10g/L of tryptone, 5g/L of yeast extract, 10g/L of sodium chloride, 2% of agar powder, deionized water as a solvent and natural pH value.
50mM Tris-HCl (pH 8.0) buffer: tris 6.05g was dissolved in ultrapure water, and after adjusting the pH to 8.0 with HCl, the volume was fixed to 1L by a volumetric flask.
Buffer a:50mM Tris-HCl,300mM NaCl,pH 8.0.
Buffer B:50mM Tris-HCl,300mM NaCl,500mM imidazole, pH 8.0.
20mM PBS buffer: 20mM Na 2 HPO 4 ，20mM NaH 2 PO 4 0.9% NaCl, pH 6.0 was added.
Species origin of amino acid sequences: saccharomyces cerevisiae, sceCPR; exiguobacterium sibiricum, esGDH.
Example 1: construction method of aldehyde ketone reductase mutant
(1) SceCPR gene molecular evolution relation analysis and model establishment
The amino acid sequence of SceCPR (NCBI ID: NP-010159.1) was used as a template, and the amino acid sequence having a high sequence similarity was searched in the NCBI database, and a conjugated aldehyde-ketone reductase (CPR-C2) derived from Candida parapsilosis IFO 0708 having a high sequence similarity to SceCPR was selected for modeling. Homology modeling was performed using SWISS-MODEL on-line servers using the three-dimensional structure of CPR-C2 (PDB ID:3 VXG) as a template. And evaluating and optimizing the structural model of the homology modeling by using an online analysis website (https:// services. Mbi. Ucal. Edu/SAVES), so as to obtain a model with higher accuracy, as shown in figure 2.
(2) Molecular docking predicts binding patterns between SceCPR and substrate
And carrying out molecular docking treatment on the SceCPR and the substrate KPL by using Autodock molecular docking software to obtain key sites for the interaction of the enzyme and the substrate and amino acid sites which can influence the catalytic efficiency of the enzyme. Using SceCPR and KPL complex as model, KPL-centered was determinedThe amino acids within are shown in FIG. 2. Using Funclibhttp:// FuncLib.weizmann.ac.il) The on-line analysis tool determines the selectivity of homologous site mutations in the SceCPR structure.
The key effects of serine at position 158 and tyrosine at position 298 were determined in combination with the results presented by the above analysis software. Serine 158 was mutated to alanine and tyrosine 298 to histidine.
Example 2: construction of aldehyde ketoreductase mutant strains.
(1) Construction of aldehyde-ketone reductase recombinant engineering strain
The recombinant expression plasmid of the aldehyde ketone reductase mutant is prepared by the steps of: 1 into the MCS of pEASY-Blunt E1 plasmid.
Connecting the SceCPR gene with the linearized pEASY-Blunt E1 plasmid by using a one-step cloning kit to obtain a recombinant plasmid inserted with the SceCPR gene;
e.coli DH 5. Alpha. (pACYCDuet 1-SceCPR/EsGDH) strain (Zhao M, gao L, zhang L, et al, asymmetric reduction of ketopantolactone using a strictly (R) -stereoselective carbonyl reductase through efficient NADPH regeneration and the substrate constant-feeding strategy. Biotechnology Letters) was maintained in the laboratory.
2017,39 (11) the target gene SceCPR fragment (which has been codon optimized and has the nucleotide sequence shown in SEQ ID NO) was amplified by PCR using 1741-1746.DOI:10.1007/s10529-017-2415-1 as template: 1) and the amino acid sequence of the target protein coded by the gene is shown as SEQ ID NO: 2.
Two pairs of amplification primers are designed according to the nucleotide sequence of the Saccharomyces cerevisiae aldehyde ketone reductase gene searched in NCBI database:
TABLE 1 construction of recombinant plasmid related primers
PCR amplification System of the target Gene (SceCPR): mu.L of pACYCDuet1-SceCPR/EsGDH plasmid at a concentration of 100ng/uL was used as a template, and primer F and primer R at a concentration of 10. Mu.M were each 1. Mu.L, 2X PrimeSTAR HSDNA Polymerase high-fidelity DNA polymerase 25. Mu.L, and ultrapure water 22. Mu.L.
The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃ for 1min; for a total of 30 cycles, the termination temperature was 4 ℃.
pEASY-Blunt E1 plasmid fragment linearization PCR amplification System: 1. Mu.L of pEASY-Blunt E1 plasmid at a concentration of 120 ng/. Mu.L was used as a template, and primer F and primer R at a concentration of 10. Mu.M were each 1. Mu.L, and 2X PrimeSTAR HSDNA Polymerase were used as 25. Mu.L of high-fidelity DNA polymerase and 22. Mu.L of ultrapure water.
The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;58 ℃,15sec;72 ℃ for 1min; for a total of 30 cycles, the termination temperature was 4 ℃.
The PCR product was purified and recovered, and the fragment obtained by the purification and recovery was ligated with the linearized pEASY-Blunt E1 plasmid fragment using a one-step cloning kit (Vazyme, clonExperss II One Step Cloning Kit C) to obtain a recombinant plasmid pEASY-Blunt E1-SceCPR, as shown in FIG. 1. The ligation product was transformed into E.coli DH 5. Alpha. Competence. In the 100 u g/mL Amp LB medium, 37 degrees C overnight culture 12h, choose bacteria and identify positive transformants. According to the sequencing result, selecting the strain with correct nucleotide sequence for glycerol sterilization, and preserving in a-80 ℃ ultralow temperature refrigerator. Extraction of pEASY-Blunt E1-SceCPR plasmid was transferred into the competent expression strain E.coli BL21 (DE 3), cultured in LB medium containing 100. Mu.g/mL Amp at 37℃for 12h, picked up and identified as positive transformants. The positive transformants were cultured and tested.
(2) Construction of aldehyde ketone reductase mutant recombinant engineering strain
Site-directed mutagenesis primers (Table 2) were designed and whole plasmid PCR was performed using pEASY-Blunt E1-SceCPR plasmid as template. PCR amplification system: 1. Mu.L of pEASY-Blunt E1-SceCPR plasmid at a concentration of 1 ng/. Mu.L was used as a template, and primer F and primer R at a concentration of 10. Mu.M were each 1. Mu.L, and 2X PrimeSTAR HSDNA Polymerase were used as 25. Mu.L of high-fidelity DNA polymerase and 22. Mu.L of ultrapure water.
TABLE 2 site-directed mutagenesis related primer
Note that: the bold font indicates the mutant base, which is the optimized base for E.coli.
The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃ for 1min; for a total of 30 cycles, the termination temperature was 4 ℃.
After the whole plasmid site-directed mutagenesis PCR product is digested for 2 hours at 37 ℃ by endonuclease Dpn I, the purified product obtained by the purification kit is transferred into E.coli DH5 alpha competence, bacterial liquid is evenly coated on LB solid medium containing 100 mug/mL Amp, and the bacterial liquid is cultured at 37 ℃ overnight to obtain a site-directed mutagenesis library. Single transformants were picked and positive transformants were identified by colony PCR. Wherein SceCPR S158A/Y298H Mutants are obtained after two rounds of site-directed mutagenesis of the whole plasmid.
According to the sequencing result, selecting the strain with correct nucleotide sequence for glycerol sterilization, and preserving in a-80 ℃ ultralow temperature refrigerator. The recombinant mutant plasmid is extracted and transferred into the competence of an expression strain E.coli BL21 (DE 3) by a heat shock method, and the recombinant mutant plasmid is cultured for 12 hours at 37 ℃ in LB culture medium containing 100 mug/mL Amp, and positive transformants are picked up and identified.
Example 3: expression and purification of aldehyde ketone reductase mutant proteins
(1) Induction expression of aldehyde ketone reductase mutant gene
Contains the aldehyde ketone reductase mutant gene (SceCPR) S158A 、SceCPR Y298H 、SceCPR S158A/Y298H ) The engineering strain of (2) is inoculated in LB culture medium containing 100 mug/mL Amp, and shaking is carried out for 12 hours at 37 ℃ with 180rpm, thus obtaining seed liquid.
The seed solution was transferred to LB medium containing 100. Mu.g/mL Amp at an inoculum size of 2% (v/v), shake was performed on a shaker at 37℃and 180rpm for about 2 hours until OD600 was 0.6-0.8, and isopropyl thiogalactoside (IPTG) was added at a final concentration of 0.2mM, followed by induction culture at 24℃and 180rpm for 12 hours.
(2) Purification of aldehyde ketone reductase mutants
The cells were collected by centrifugation at 4℃for 10min at a high-speed refrigerated centrifuge at 8000rpm, the supernatant was discarded, and the washed cells were resuspended in ultrapure water, centrifuged at 5000 rpm at 4℃for 10min, and the supernatant was collected and weighed. 0.5g of wet cells was weighed and 50mM Tris-HCl (pH 8.0) buffer was added at a ratio of 1:20 (m/v, g/ml) to resuspend the cells. The resuspended thalli are crushed by an ultrasonic crusher to release the target protein, and the whole process needs ice bath. Ultrasonic disruption procedure: the operation was continued for 2s, for 4s, for 10min, with the power maintained at 35%. The crushed solution was centrifuged at 12000rpm at 4℃for 15 minutes using a high-speed refrigerated centrifuge, and cell debris was removed to obtain a crude enzyme solution. The crude enzyme solution was subjected to SDS-PAGE. The crude enzyme solution can be used for protein purification after membrane treatment.
Purifying by Ni column affinity chromatography, loading the sample after Ni column is equilibrated by using buffer A, removing nonspecific binding protein by using buffer A and buffer B in a volume ratio of 9:1, eluting target protein by using buffer B, and collecting the eluent to obtain purified target protein.
The purified target protein is desalted by means of dialysis. Before the dialysis treatment, the leak detection operation is required to be carried out on the dialysis bag (3.5 kDa), so that the good tightness of the dialysis bag is ensured. The purified target protein was placed in a dialysis bag, the dialysis bag was placed in 20mM PBS buffer, the solution was changed every 6 hours, and the dialysis was performed for 12 hours, and a low temperature (ice bath 0 ℃) treatment was ensured throughout.
(3) Purification verification of aldehyde ketone reductase mutant
SDS-PAGE analysis is carried out on the enzyme solution obtained after dialysis, and the purification effect of the enzyme solution is verified. The results are shown in FIG. 3: the strip is single, the size accords with the theoretical value, and the strip can be used for subsequent experimental research. M is Marker, and the standard proteins are (235 kDa, 170kDa, 130kDa, 93kDa, 70kDa, 53kDa, 41kDa, 30kDa, 22kDa, 18kDa, 14kDa, 9 kDa) in sequence; lane 1: pEASY-Blunt E1-SceCPR preinduced bacterial solution; lane 2: the pEASY-Blunt E1-SceCPR induces the expressed pure enzyme; lane 3: pEASY-Blunt E1-SceCPR S158A Inducing the expressed pure enzyme; lane 4: pEASY-Blunt E1-SceCPR Y298H Pure enzyme after induction of expression.
Example 4: measurement of enzyme activity and enzymatic characterization of aldehyde ketone reductase mutant
(1) Specific enzyme activity measuring method for aldehyde ketone reductase mutant
Enzyme activity measurement the enzyme activity was calculated by measuring the change in absorbance of NADPH at 340nm using a spectrophotometer, with a total reaction system of 1mL. Definition of enzyme Activity Unit (U): the amount of enzyme required to oxidize 1. Mu. Mol NADPH per minute at 35 min.
The enzyme activity was calculated by incubating a centrifuge tube containing 1mL of phosphate buffer (pH 6.0) in a metal bath at 35℃for 10min, then adding SceCPR enzyme solution (0.5. Mu.g) and KPL (final concentration 50 mM), incubating for 30s, immediately transferring to a cuvette of 1mL capacity, adding coenzyme NADPH (final concentration 60. Mu.M), and monitoring the change in absorbance of NADPH at 340nm over 1 min. The volumetric enzyme activity and specific enzyme activity of the ketopantolactone reductase are calculated as follows:
Δa is the change in absorbance; v1 is the total volume of the reaction liquid; v2 is the volume of enzyme solution added in the reaction solution,mL;6220 is the molar extinction coefficient, L.times.mol, of NADPH at 340nm -1 *cm -1 The method comprises the steps of carrying out a first treatment on the surface of the L is the optical path distance, cm; t is the reaction time, min.
(2) Measurement of optimal temperature of aldehyde-ketone reductase mutant
Centrifuge tubes containing 1mL of phosphate buffer (pH 6.0) were incubated in a metal bath at 25, 30, 35, 40, 45, 50, 55℃for 10min, then SceCPR pure enzyme solution (0.5. Mu.l, 1 mg/mL) and KPL at a final concentration of 50mM were added, incubated together for 30s, immediately transferred to a cuvette of 1mL capacity, and coenzyme NADPH (60. Mu.M) was added, and the change in absorbance of NADPH at 340nm over 1min was monitored to calculate enzyme activity, defining the maximum enzyme activity as 100%. The results are shown in FIG. 4, and the optimum reaction temperature is 35 ℃.
(3) Aldolone reductase mutant optimal pH measurement
Centrifuge tubes containing 1mL of 0.2M phosphate buffer (pH 5.5, 6.0, 6.5, 7.0, 8.0), 0.1M citric acid-sodium citrate buffer (pH 4.0, 5.0, 5.5, 6.0) were incubated in a metal bath at 35℃for 10min, then SceCPR pure enzyme solution (0.5. Mu.l, 1 mg/mL) and 50mM KPL were added, and after incubation for 30s, immediately transferred to a cuvette of 1mL capacity, while coenzyme NADPH (60. Mu.M) was added, and the change in absorbance at 340nm over 1min was monitored to calculate enzyme activity, defining the maximum enzyme activity as 100%. The results are shown in FIG. 5, and the optimum reaction pH is 6.0.
Measurement under optimum conditions SceCPR, sceCPR S158A 、SceCPR Y298H 、SceCPRS 158A/Y298H The specific enzyme activity of (C) is shown in FIG. 6, sceCPR, sceCPR S158A 、SceCPR Y298H 、SceCPRS 158A/Y298H The specific enzyme activities of (C) are respectively 32.62U/mg, 119.4U/mg, 216.6U/mg and 400.1U/mg, sceCPR S158A 、SceCPR Y298H 、SceCPR S158A/Y298H The specific enzyme activities of (C) are respectively improved by 3.66 times, 6.64 times and 12.26 times compared with SceCPR. The above is a detailed implementation method and a specific operation flow of the present invention, which are implemented on the premise of the technical scheme of the present invention, but the protection scope of the present invention is not limited to the above embodiments.
Sequence listing
<110> Zhejiang university of industry
<120> an aldehyde ketoreductase mutant with 158 th mutation and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 942
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgggctcat ttcatcagca gttcttcacc ctgaataacg gcaacaagat cccggctatt 60
gccattatcg gtacgggtac acgttggtac aaaaatgagg aaaccgatgc tacctttagc 120
aattcactgg ttgaacagat tgtgtatgct ctgaaactgc cgggcatcat ccatatcgat 180
gccgccgaaa tctatcgtac ctatccggaa gtgggcaaag ccttatcatt aaccgaaaaa 240
cctcgtaatg cgatctttct gacggataaa tatagtcctc agatcaaaat gagtgattct 300
ccggcggatg gcctagacct ggcgctgaaa aagatgggta cggattatgt tgatctgtac 360
ttactgcata gtccgtttgt gagcaaagaa gttaatggtc tgtctctgga agaagcatgg 420
aaagatatgg aacagctgta caagtcaggt aaagccaaaa atattggcgt gtctaatttt 480
gcggtggaag atttgcagcg catcctgaaa gttgccgaag ttaaacctca ggttaatcag 540
atcgagttta gtccgtttct tcaaaatcag acaccaggca tctataagtt ttgtcaggaa 600
catgatatac tggttgaagc ctattctcca ttaggcccgt tacaaaagaa aacggcccag 660
gatgattcac agccgttctt tgaatatgtt aaagaactga gcgaaaaata tatcaaaagc 720
gaagcacaga ttatcttacg ctgggtgacc aaacgcggtg tgctgccagt gacgacgagt 780
agtaaaccgc agcgcattag cgatgcacag aatctgttta gctttgatct gaccgccgaa 840
gaagtggata aaatcacgga actgggctta gaacatgaac cactgcgcct gtattggaac 900
aaactgtatg gcaaatataa ttatgcggcc cagaaagtgt ga 942
<210> 2
<211> 313
<212> PRT
<213> Saccharomyces cerevisiae (Saccharomyces cerevisiae)
<400> 2
Met Gly Ser Phe His Gln Gln Phe Phe Thr Leu Asn Asn Gly Asn Lys
1 5 10 15
Ile Pro Ala Ile Ala Ile Ile Gly Thr Gly Thr Arg Trp Tyr Lys Asn
20 25 30
Glu Glu Thr Asp Ala Thr Phe Ser Asn Ser Leu Val Glu Gln Ile Val
35 40 45
Tyr Ala Leu Lys Leu Pro Gly Ile Ile His Ile Asp Ala Ala Glu Ile
50 55 60
Tyr Arg Thr Tyr Pro Glu Val Gly Lys Ala Leu Ser Leu Thr Glu Lys
65 70 75 80
Pro Arg Asn Ala Ile Phe Leu Thr Asp Lys Tyr Ser Pro Gln Ile Lys
85 90 95
Met Ser Asp Ser Pro Ala Asp Gly Leu Asp Leu Ala Leu Lys Lys Met
100 105 110
Gly Thr Asp Tyr Val Asp Leu Tyr Leu Leu His Ser Pro Phe Val Ser
115 120 125
Lys Glu Val Asn Gly Leu Ser Leu Glu Glu Ala Trp Lys Asp Met Glu
130 135 140
Gln Leu Tyr Lys Ser Gly Lys Ala Lys Asn Ile Gly Val Ser Asn Phe
145 150 155 160
Ala Val Glu Asp Leu Gln Arg Ile Leu Lys Val Ala Glu Val Lys Pro
165 170 175
Gln Val Asn Gln Ile Glu Phe Ser Pro Phe Leu Gln Asn Gln Thr Pro
180 185 190
Gly Ile Tyr Lys Phe Cys Gln Glu His Asp Ile Leu Val Glu Ala Tyr
195 200 205
Ser Pro Leu Gly Pro Leu Gln Lys Lys Thr Ala Gln Asp Asp Ser Gln
210 215 220
Pro Phe Phe Glu Tyr Val Lys Glu Leu Ser Glu Lys Tyr Ile Lys Ser
225 230 235 240
Glu Ala Gln Ile Ile Leu Arg Trp Val Thr Lys Arg Gly Val Leu Pro
245 250 255
Val Thr Thr Ser Ser Lys Pro Gln Arg Ile Ser Asp Ala Gln Asn Leu
260 265 270
Phe Ser Phe Asp Leu Thr Ala Glu Glu Val Asp Lys Ile Thr Glu Leu
275 280 285
Gly Leu Glu His Glu Pro Leu Arg Leu Tyr Trp Asn Lys Leu Tyr Gly
290 295 300
Lys Tyr Asn Tyr Ala Ala Gln Lys Val
305 310
<210> 3
<211> 942
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atgggctcat ttcatcagca gttcttcacc ctgaataacg gcaacaagat cccggctatt 60
gccattatcg gtacgggtac acgttggtac aaaaatgagg aaaccgatgc tacctttagc 120
aattcactgg ttgaacagat tgtgtatgct ctgaaactgc cgggcatcat ccatatcgat 180
gccgccgaaa tctatcgtac ctatccggaa gtgggcaaag ccttatcatt aaccgaaaaa 240
cctcgtaatg cgatctttct gacggataaa tatagtcctc agatcaaaat gagtgattct 300
ccggcggatg gcctagacct ggcgctgaaa aagatgggta cggattatgt tgatctgtac 360
ttactgcata gtccgtttgt gagcaaagaa gttaatggtc tgtctctgga agaagcatgg 420
aaagatatgg aacagctgta caagtcaggt aaagccaaaa atattggcgt ggcaaatttt 480
gcggtggaag atttgcagcg catcctgaaa gttgccgaag ttaaacctca ggttaatcag 540
atcgagttta gtccgtttct tcaaaatcag acaccaggca tctataagtt ttgtcaggaa 600
catgatatac tggttgaagc ctattctcca ttaggcccgt tacaaaagaa aacggcccag 660
gatgattcac agccgttctt tgaatatgtt aaagaactga gcgaaaaata tatcaaaagc 720
gaagcacaga ttatcttacg ctgggtgacc aaacgcggtg tgctgccagt gacgacgagt 780
agtaaaccgc agcgcattag cgatgcacag aatctgttta gctttgatct gaccgccgaa 840
gaagtggata aaatcacgga actgggctta gaacatgaac cactgcgcct gtattggaac 900
aaactgtatg gcaaatataa ttatgcggcc cagaaagtgt ga 942
<210> 4
<211> 313
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
Met Gly Ser Phe His Gln Gln Phe Phe Thr Leu Asn Asn Gly Asn Lys
1 5 10 15
Ile Pro Ala Ile Ala Ile Ile Gly Thr Gly Thr Arg Trp Tyr Lys Asn
20 25 30
Glu Glu Thr Asp Ala Thr Phe Ser Asn Ser Leu Val Glu Gln Ile Val
35 40 45
Tyr Ala Leu Lys Leu Pro Gly Ile Ile His Ile Asp Ala Ala Glu Ile
50 55 60
Tyr Arg Thr Tyr Pro Glu Val Gly Lys Ala Leu Ser Leu Thr Glu Lys
65 70 75 80
Pro Arg Asn Ala Ile Phe Leu Thr Asp Lys Tyr Ser Pro Gln Ile Lys
85 90 95
Met Ser Asp Ser Pro Ala Asp Gly Leu Asp Leu Ala Leu Lys Lys Met
100 105 110
Gly Thr Asp Tyr Val Asp Leu Tyr Leu Leu His Ser Pro Phe Val Ser
115 120 125
Lys Glu Val Asn Gly Leu Ser Leu Glu Glu Ala Trp Lys Asp Met Glu
130 135 140
Gln Leu Tyr Lys Ser Gly Lys Ala Lys Asn Ile Gly Val Ala Asn Phe
145 150 155 160
Ala Val Glu Asp Leu Gln Arg Ile Leu Lys Val Ala Glu Val Lys Pro
165 170 175
Gln Val Asn Gln Ile Glu Phe Ser Pro Phe Leu Gln Asn Gln Thr Pro
180 185 190
Gly Ile Tyr Lys Phe Cys Gln Glu His Asp Ile Leu Val Glu Ala Tyr
195 200 205
Ser Pro Leu Gly Pro Leu Gln Lys Lys Thr Ala Gln Asp Asp Ser Gln
210 215 220
Pro Phe Phe Glu Tyr Val Lys Glu Leu Ser Glu Lys Tyr Ile Lys Ser
225 230 235 240
Glu Ala Gln Ile Ile Leu Arg Trp Val Thr Lys Arg Gly Val Leu Pro
245 250 255
Val Thr Thr Ser Ser Lys Pro Gln Arg Ile Ser Asp Ala Gln Asn Leu
260 265 270
Phe Ser Phe Asp Leu Thr Ala Glu Glu Val Asp Lys Ile Thr Glu Leu
275 280 285
Gly Leu Glu His Glu Pro Leu Arg Leu Tyr Trp Asn Lys Leu Tyr Gly
290 295 300
Lys Tyr Asn Tyr Ala Ala Gln Lys Val
305 310
<210> 5
<211> 942
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
atgggctcat ttcatcagca gttcttcacc ctgaataacg gcaacaagat cccggctatt 60
gccattatcg gtacgggtac acgttggtac aaaaatgagg aaaccgatgc tacctttagc 120
aattcactgg ttgaacagat tgtgtatgct ctgaaactgc cgggcatcat ccatatcgat 180
gccgccgaaa tctatcgtac ctatccggaa gtgggcaaag ccttatcatt aaccgaaaaa 240
cctcgtaatg cgatctttct gacggataaa tatagtcctc agatcaaaat gagtgattct 300
ccggcggatg gcctagacct ggcgctgaaa aagatgggta cggattatgt tgatctgtac 360
ttactgcata gtccgtttgt gagcaaagaa gttaatggtc tgtctctgga agaagcatgg 420
aaagatatgg aacagctgta caagtcaggt aaagccaaaa atattggcgt gtctaatttt 480
gcggtggaag atttgcagcg catcctgaaa gttgccgaag ttaaacctca ggttaatcag 540
atcgagttta gtccgtttct tcaaaatcag acaccaggca tctataagtt ttgtcaggaa 600
catgatatac tggttgaagc ctattctcca ttaggcccgt tacaaaagaa aacggcccag 660
gatgattcac agccgttctt tgaatatgtt aaagaactga gcgaaaaata tatcaaaagc 720
gaagcacaga ttatcttacg ctgggtgacc aaacgcggtg tgctgccagt gacgacgagt 780
agtaaaccgc agcgcattag cgatgcacag aatctgttta gctttgatct gaccgccgaa 840
gaagtggata aaatcacgga actgggctta gaacatgaac cactgcgcct gcattggaac 900
aaactgtatg gcaaatataa ttatgcggcc cagaaagtgt ga 942
<210> 6
<211> 313
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 6
Met Gly Ser Phe His Gln Gln Phe Phe Thr Leu Asn Asn Gly Asn Lys
1 5 10 15
Ile Pro Ala Ile Ala Ile Ile Gly Thr Gly Thr Arg Trp Tyr Lys Asn
20 25 30
Glu Glu Thr Asp Ala Thr Phe Ser Asn Ser Leu Val Glu Gln Ile Val
35 40 45
Tyr Ala Leu Lys Leu Pro Gly Ile Ile His Ile Asp Ala Ala Glu Ile
50 55 60
Tyr Arg Thr Tyr Pro Glu Val Gly Lys Ala Leu Ser Leu Thr Glu Lys
65 70 75 80
Pro Arg Asn Ala Ile Phe Leu Thr Asp Lys Tyr Ser Pro Gln Ile Lys
85 90 95
Met Ser Asp Ser Pro Ala Asp Gly Leu Asp Leu Ala Leu Lys Lys Met
100 105 110
Gly Thr Asp Tyr Val Asp Leu Tyr Leu Leu His Ser Pro Phe Val Ser
115 120 125
Lys Glu Val Asn Gly Leu Ser Leu Glu Glu Ala Trp Lys Asp Met Glu
130 135 140
Gln Leu Tyr Lys Ser Gly Lys Ala Lys Asn Ile Gly Val Ser Asn Phe
145 150 155 160
Ala Val Glu Asp Leu Gln Arg Ile Leu Lys Val Ala Glu Val Lys Pro
165 170 175
Gln Val Asn Gln Ile Glu Phe Ser Pro Phe Leu Gln Asn Gln Thr Pro
180 185 190
Gly Ile Tyr Lys Phe Cys Gln Glu His Asp Ile Leu Val Glu Ala Tyr
195 200 205
Ser Pro Leu Gly Pro Leu Gln Lys Lys Thr Ala Gln Asp Asp Ser Gln
210 215 220
Pro Phe Phe Glu Tyr Val Lys Glu Leu Ser Glu Lys Tyr Ile Lys Ser
225 230 235 240
Glu Ala Gln Ile Ile Leu Arg Trp Val Thr Lys Arg Gly Val Leu Pro
245 250 255
Val Thr Thr Ser Ser Lys Pro Gln Arg Ile Ser Asp Ala Gln Asn Leu
260 265 270
Phe Ser Phe Asp Leu Thr Ala Glu Glu Val Asp Lys Ile Thr Glu Leu
275 280 285
Gly Leu Glu His Glu Pro Leu Arg Leu His Trp Asn Lys Leu Tyr Gly
290 295 300
Lys Tyr Asn Tyr Ala Ala Gln Lys Val
305 310
<210> 7
<211> 942
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atgggctcat ttcatcagca gttcttcacc ctgaataacg gcaacaagat cccggctatt 60
gccattatcg gtacgggtac acgttggtac aaaaatgagg aaaccgatgc tacctttagc 120
aattcactgg ttgaacagat tgtgtatgct ctgaaactgc cgggcatcat ccatatcgat 180
gccgccgaaa tctatcgtac ctatccggaa gtgggcaaag ccttatcatt aaccgaaaaa 240
cctcgtaatg cgatctttct gacggataaa tatagtcctc agatcaaaat gagtgattct 300
ccggcggatg gcctagacct ggcgctgaaa aagatgggta cggattatgt tgatctgtac 360
ttactgcata gtccgtttgt gagcaaagaa gttaatggtc tgtctctgga agaagcatgg 420
aaagatatgg aacagctgta caagtcaggt aaagccaaaa atattggcgt ggcaaatttt 480
gcggtggaag atttgcagcg catcctgaaa gttgccgaag ttaaacctca ggttaatcag 540
atcgagttta gtccgtttct tcaaaatcag acaccaggca tctataagtt ttgtcaggaa 600
catgatatac tggttgaagc ctattctcca ttaggcccgt tacaaaagaa aacggcccag 660
gatgattcac agccgttctt tgaatatgtt aaagaactga gcgaaaaata tatcaaaagc 720
gaagcacaga ttatcttacg ctgggtgacc aaacgcggtg tgctgccagt gacgacgagt 780
agtaaaccgc agcgcattag cgatgcacag aatctgttta gctttgatct gaccgccgaa 840
gaagtggata aaatcacgga actgggctta gaacatgaac cactgcgcct gcattggaac 900
aaactgtatg gcaaatataa ttatgcggcc cagaaagtgt ga 942
<210> 8
<211> 313
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 8
Met Gly Ser Phe His Gln Gln Phe Phe Thr Leu Asn Asn Gly Asn Lys
1 5 10 15
Ile Pro Ala Ile Ala Ile Ile Gly Thr Gly Thr Arg Trp Tyr Lys Asn
20 25 30
Glu Glu Thr Asp Ala Thr Phe Ser Asn Ser Leu Val Glu Gln Ile Val
35 40 45
Tyr Ala Leu Lys Leu Pro Gly Ile Ile His Ile Asp Ala Ala Glu Ile
50 55 60
Tyr Arg Thr Tyr Pro Glu Val Gly Lys Ala Leu Ser Leu Thr Glu Lys
65 70 75 80
Pro Arg Asn Ala Ile Phe Leu Thr Asp Lys Tyr Ser Pro Gln Ile Lys
85 90 95
Met Ser Asp Ser Pro Ala Asp Gly Leu Asp Leu Ala Leu Lys Lys Met
100 105 110
Gly Thr Asp Tyr Val Asp Leu Tyr Leu Leu His Ser Pro Phe Val Ser
115 120 125
Lys Glu Val Asn Gly Leu Ser Leu Glu Glu Ala Trp Lys Asp Met Glu
130 135 140
Gln Leu Tyr Lys Ser Gly Lys Ala Lys Asn Ile Gly Val Ala Asn Phe
145 150 155 160
Ala Val Glu Asp Leu Gln Arg Ile Leu Lys Val Ala Glu Val Lys Pro
165 170 175
Gln Val Asn Gln Ile Glu Phe Ser Pro Phe Leu Gln Asn Gln Thr Pro
180 185 190
Gly Ile Tyr Lys Phe Cys Gln Glu His Asp Ile Leu Val Glu Ala Tyr
195 200 205
Ser Pro Leu Gly Pro Leu Gln Lys Lys Thr Ala Gln Asp Asp Ser Gln
210 215 220
Pro Phe Phe Glu Tyr Val Lys Glu Leu Ser Glu Lys Tyr Ile Lys Ser
225 230 235 240
Glu Ala Gln Ile Ile Leu Arg Trp Val Thr Lys Arg Gly Val Leu Pro
245 250 255
Val Thr Thr Ser Ser Lys Pro Gln Arg Ile Ser Asp Ala Gln Asn Leu
260 265 270
Phe Ser Phe Asp Leu Thr Ala Glu Glu Val Asp Lys Ile Thr Glu Leu
275 280 285
Gly Leu Glu His Glu Pro Leu Arg Leu His Trp Asn Lys Leu Tyr Gly
290 295 300
Lys Tyr Asn Tyr Ala Ala Gln Lys Val
305 310
Claims (9)
1. An aldehyde ketone reductase mutant, characterized in that: the mutant is obtained by combining SEQ ID NO:2 by mutating the amino acid sequence shown in the formula 2 as follows: serine at position 158 is mutated to alanine.
2. The aldehyde ketoreductase mutant encoding gene as claimed in claim 1.
3. A recombinant expression plasmid comprising the coding gene of claim 2.
4. The recombinant expression plasmid of claim 3, wherein: the recombinant expression plasmid is pEASY-Blunt E1, and is obtained by inserting the coding gene into a polyclonal site of the pEASY-Blunt E1 plasmid.
5. The recombinant expression plasmid of claim 4, wherein said recombinant expression plasmid is constructed as follows:
(1) Taking E.coli DH5 alpha strain containing plasmid pACYCDuet1-SceCPR/EsGDH as a template, carrying out PCR amplification by using the following primers, and purifying and recovering PCR products to obtain the target gene:
SceCPR-F TCATCATCATATGGGCTCATTTCATCAGCAG
SceCPR-R GTTATGCTAGTCACACTTTCTGGGCCGC
the plasmid pACYCDuet1-SceCPR/EsGDH is obtained by respectively inserting a gene with the accession number of EGA59421.1 and a gene with the accession number of KM817194.1 into the cleavage sites Nco I and HindIII and Nde I and Xho I of the same plasmid pACYCDuet-1;
(2) PCR amplification is carried out by taking pEASY-Blunt E1 plasmid as a template and the following primers, and the PCR product is purified and recovered to obtain a linearization vector:
pEASY-Blunt E1-F GAAAGTGTGACTAGCATAACCCCTTGGGGC
pEASY-Blunt E1-R ATGAGCCCATATGATGATGATGATGATGAGAACCC
(3) Connecting the target gene in the step (1) and the linearization vector in the step (2) through a one-step cloning kit, transferring the obtained connection product into competent cells, screening on a culture medium containing ampicillin, picking up monoclonal sequencing for verification, and extracting plasmids to obtain the wild expression plasmids;
(4) Taking the wild expression plasmid in the step (3) as a template, carrying out full plasmid site-directed mutagenesis PCR with the following primers, transferring the obtained PCR product into E.coli DH5 alpha competent cells after purification, screening on an ampicillin-containing culture medium, picking up monoclonal for sequencing verification, extracting plasmids, and obtaining the recombinant expression plasmid:
S158A-F GGCGTGGCAAATTTTGCGGTGGAAGATTTGCAG
S158A-R AAAATTTGCCACGCCAATATTTTTGGCTTTACCTGACTT。
6. the recombinant genetically engineered bacterium constructed from the recombinant expression plasmid of claim 3.
7. The recombinant genetically engineered bacterium of claim 6, wherein the recombinant genetically engineered bacterium is constructed as follows: transferring the recombinant expression plasmid into E.coli BL21 (DE 3) competent cells by using a heat shock method, uniformly coating a conversion product on an LB solid medium containing ampicillin, culturing overnight at 37 ℃, and picking up monoclonal sequencing for verification to obtain the recombinant genetically engineered bacterium.
8. The use of the aldehyde ketoreductase mutant of claim 1 in catalyzing asymmetric reduction of ketopantolactone to produce D-pantolactone.
9. The application according to claim 8, characterized in that the application is: the recombinant genetically engineered bacteria expressing the aldehyde ketone reductase mutant are subjected to induction expression and protein purification to obtain pure enzyme serving as a catalyst, ketopantolactone serving as a substrate and NADPH serving as a coenzyme to construct a reaction system, and asymmetric reduction is carried out at the pH value of 6.0 and the temperature of 35 ℃; in the reaction system, the final concentration of the pure enzyme is 0.5. Mu.g/mL, the final concentration of the ketopantolactone is 50mM, and the final concentration of the NADPH is 60. Mu.M.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210522265.2A CN115161299B (en) | 2022-05-13 | 2022-05-13 | Aldehyde ketone reductase mutant with 158-bit mutation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210522265.2A CN115161299B (en) | 2022-05-13 | 2022-05-13 | Aldehyde ketone reductase mutant with 158-bit mutation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115161299A CN115161299A (en) | 2022-10-11 |
| CN115161299B true CN115161299B (en) | 2023-09-05 |
Family
ID=83483486
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210522265.2A Active CN115161299B (en) | 2022-05-13 | 2022-05-13 | Aldehyde ketone reductase mutant with 158-bit mutation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115161299B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058248A (en) * | 2017-04-26 | 2017-08-18 | 浙江工业大学 | One kind restructuring aldehyde Ketoreductase mutant, gene, carrier, engineering bacteria and its application |
-
2022
- 2022-05-13 CN CN202210522265.2A patent/CN115161299B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058248A (en) * | 2017-04-26 | 2017-08-18 | 浙江工业大学 | One kind restructuring aldehyde Ketoreductase mutant, gene, carrier, engineering bacteria and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115161299A (en) | 2022-10-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112391372B (en) | Glutamic acid decarboxylase mutant, genetically engineered bacterium and application thereof | |
| CN113528476B (en) | Glucose oxidase mutant and coding gene and efficient recombinant expression thereof | |
| CN110066777B (en) | Endo-inulase and application thereof in production of fructo-oligosaccharide | |
| CN117625581B (en) | N-acetylglucosaminidase mutant Ea2F and application thereof | |
| CN113151201B (en) | High-thermal-stability and high-activity isoeugenol monooxygenase mutant and application thereof | |
| CN113913400A (en) | L-sorbosone dehydrogenase mutant with improved catalytic activity | |
| CN110129305B (en) | Cephalosporin C acylase mutant for preparing 7-ACA | |
| CN115161299B (en) | Aldehyde ketone reductase mutant with 158-bit mutation and application thereof | |
| KR102473375B1 (en) | Recombinant microorganisms, their preparation methods and their use in the production of coenzyme Q10 | |
| CN115232800B (en) | 298-site mutant aldehyde ketone reductase mutant and application thereof | |
| CN110592119A (en) | Novel pullulanase derived from paenibacillus and gene and application thereof | |
| CN114591938B (en) | Carboxylase mutant and preparation method and application thereof | |
| CN110438097B (en) | L-isoleucine hydroxylase mutant with improved heat stability and enzyme activity | |
| CN111154746A (en) | Amidase mutant and application thereof in catalytic synthesis of 2-chloronicotinic acid | |
| CN116064494B (en) | Glutamate decarboxylase mutant, gene and application thereof | |
| WO2005123921A1 (en) | Novel glycerol dehydrogenase, gene therefor, and method of utilizing the same | |
| CN112941059B (en) | L-asparaginase mutant and expression thereof in bacillus subtilis | |
| CN114395543B (en) | Trehalose synthase mutant and application thereof | |
| CN108866017B (en) | Method for preparing β -hydroxy- β -methylbutyric acid by enzyme method | |
| AU2021100409A4 (en) | Recombinant low-temperature catalase, recombinant vector and engineered strain thereof | |
| CN115896050A (en) | End transformation combined point mutation of 7 alpha-hydroxysteroid dehydrogenase and efficient synthesis of ursodeoxycholic acid intermediate | |
| US10900028B2 (en) | Heparinase-producing Pseudomonas stutzeri strain and heparinase derived therefrom | |
| KR0184755B1 (en) | Thermostable tyrosine phenol-lyase and the preparation process of l-dopa using it | |
| CN107338263B (en) | Construction method for producing itaconic acid by fermenting xylose based on pichia stipitis synthetic strain | |
| CN117070542A (en) | Hemicellulose degrading enzyme co-expression strain, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |