CN115160425A - Rice mutant protein with high dinitroaniline herbicide resistance and corresponding gene - Google Patents

Abstract

The invention discloses a rice OsTubA2 mutant protein and a corresponding gene. The amino acid sequence of the OsTubA2 mutant gene coding protein has the following mutations: the arginine mutation corresponds to the 243 rd site of the amino acid sequence of the wild rice OsTubA 2. The OsTubA2 mutant gene is introduced into rice genome and expressed, and the receptor plant has very high resistance (tolerance) to dinitroaniline herbicides such as pendimethalin.

Description

Rice mutant protein with high dinitroaniline herbicide resistance and corresponding gene

Technical Field

The invention relates to the field of genes, and in particular relates to an OsTubA2 mutant protein of a rice dinitroaniline herbicide-resistant herbicide.

Background

The increasing world population has led to a continuous increase in the demand for agricultural crops. An important factor influencing the yield of the farmland is weeds, and various methods for removing the weeds, such as artificial weeding, chemical weeding and the like, wherein the chemical weeding is most applied. Manual weeding is time-consuming, labor-consuming and low in efficiency, and does not meet the requirements of modern agricultural production. Compared with artificial weeding, chemical weeding has the advantages of high efficiency, convenient use, low cost and the like, so that the chemical weeding is widely applied to modern agriculture. However, over the past decades the use of a large number of chemical herbicides (e.g. ALS inhibitors, EPSPS inhibitors, ACCase inhibitors) has led to the emergence of weed species which are resistant to these herbicides. Unlike other herbicides, dinitroaniline herbicides have a mechanism of killing weeds by inhibiting mitosis and differentiation of cells and destroying normal cell division. The herbicide is widely applied to the fields of various crops such as cotton, peanut, soybean and the like to prevent and kill off annual gramineous weeds and part of annual broadleaf weeds, so the dinitroaniline herbicide has a good effect of removing weeds, and rice is sensitive to the dinitroaniline herbicide and difficult to apply or seriously phytotoxic in the rice field, so that the development of herbicide-resistant rice germplasm is urgently needed to facilitate the application of the dinitroaniline herbicide.

It has been found that a mutant of OsTubA2 gene can cause herbicide resistance in wheat, but one has encountered difficulty in transplanting the gene into rice. Researchers cannot find similar herbicide-resistant genes which can be effectively applied to rice through a large number of research experiments. Furthermore, in order to increase the diversity of the species of the biological products and the diversity of the gene resources, it is desirable to be able to find more different herbicide-resistant genes.

Disclosure of Invention

In order to solve the problems, the invention provides a dinitroaniline herbicide-resistant gene which can be applied to rice.

In order to solve the problems, the inventor conducts a large number of experimental cultivations in batches in Anhui and Hainan, and finally finds a dinitroaniline herbicide-resistant mutant protein and a corresponding mutant gene which can be effectively applied to rice.

The invention utilizes a second generation of guided editing tool PE2 to mediate that G at the 1906 th position of an OsTubA2 gene is changed into a T yielding rice endogenous herbicide resistance site, and the amino acid sequence of the protein coded by the gene is mutated at the 243 th position corresponding to the amino acid sequence of wild rice OsTubA 2. The inventors have found that the resistance to dinitroaniline herbicides can be imparted to rice by mutation at position 243 of the gene sequence.

Therefore, the invention provides a nucleic acid or a gene for coding OsTubA2 mutant protein of rice.

In one embodiment, the present invention provides a rice OsTubA2 mutant protein, wherein the amino acid sequence of the OsTubA2 mutant protein is subjected to site-directed substitution: it is mutated at position 243 of the amino acid sequence of rice OsTubA 2.

Preferably, the 243 rd amino acid of the rice OsTubA2 amino acid sequence is mutated from arginine to methionine.

Preferably, the 243 rd amino acid of the rice OsTubA2 amino acid sequence is mutated with other amino acids except methionine.

Preferably, the situation that the mutated amino acid site of the OsTubA2 mutant protein of the invention is mutated into other amino acids is also within the protection scope of the invention, for example: the 243 rd amino acid is mutated from arginine into valine, glycine, leucine, serine, tyrosine, proline, isoleucine, aspartic acid, glutamine, tryptophan, lysine, histidine, methionine, threonine, alanine, glutamic acid and phenylalanine;

the invention also provides rice OsTubA2 mutant protein, which comprises the following components: (a) 1, and the protein which is derived from the (a) and has the amino acid sequence in the (a) subjected to site-specific substitution.

The invention also provides a nucleic acid or gene encoding the protein.

The nucleic acid or gene of the present invention comprises:

(i) Nucleic acids or genes encoding said proteins; or

(ii) A nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence defined in (a); or

(iii) The nucleotide sequence is selected from the sequence shown in SEQ ID NO.2 in the sequence table.

Further, the rice OsTubA2 mutant gene has the following mutations: the mutation is only generated at 1905-1907 nucleotide of rice OsTubA2 gene.

Preferably, the rice OsTubA2 mutant gene of the invention has one of the following mutations: only the 1906 nucleotide of the rice OsTubA2 gene is mutated from G to T.

The nucleotide mutated in the OsTubA2 mutant gene of the invention is also within the scope of the present invention when the nucleotide is mutated to another nucleotide at positions 1905 to 1907 of the OsTubA2 gene, for example: the G mutation is T, A, C.

The invention also provides an expression cassette and a recombinant vector, which contain the nucleic acid or the gene.

The invention also provides application of the rice OsTubA2 mutant protein, nucleic acid or gene, an expression cassette and a recombinant vector in herbicide resistance of plants.

The present invention also provides a method for obtaining a plant having herbicide resistance, comprising the steps of:

1) Allowing the plant to comprise the nucleic acid or gene; or

2) And (3) allowing the plant to express the rice OsTubA2 mutant protein.

Further, the method for obtaining the plant with herbicide resistance is to utilize a guided editing pathway to edit the rice OsTubA2 mutant protein into the seeds of a target plant.

The invention also provides methods of obtaining plants that are herbicide resistant. Further, the present invention provides methods for enhancing the tolerance of a plant, plant tissue, plant cell to at least one herbicide. Accordingly, herbicide resistance in the present invention refers to resistance to (tolerant) dinitroaniline herbicides.

The method of enhancing the resistance of a plant, plant tissue or plant cell to a herbicide of the present invention can be carried out by physical and chemical mutagenesis, transformation or hybridization, selfing and asexual propagation, or by site-directed mutagenesis of a gene, such that the altered plant comprises the nucleotide sequence of SEQ ID No.1 of the present invention.

The method for enhancing the resistance of plants, plant tissues or plant cells to herbicides can be implemented by physical and chemical mutagenesis, transformation or hybridization, selfing and asexual propagation methods, and can also be obtained by means of gene site-directed mutagenesis, so that the changed plants express the amino acid sequence SEQ ID No.1 of the invention.

The invention also provides a method for obtaining a herbicide-tolerant rice plant, which comprises the steps of transferring the PE2 vector aiming at the 1906-position guanine (G) of the OsTubA2 gene into rice, and converting the 1906-position G of the OsTubA2 gene in a transferred rice genome into T. It was found that the gene-edited rice carrying the mutation was highly resistant to the dinitroaniline herbicides, whereas wild-type rice was sensitive to the dinitroaniline herbicides. The invention also provides the application of the nucleic acid or the gene and the protein in plant breeding for cultivating plants with herbicide resistance, especially crops, and also provides the application of the protein and the coding gene thereof in transgenic or non-transgenic plants such as rice and the like.

Drawings

FIG. 1 shows a sequence diagram of mutation sites of rice plants having homozygous mutant OsTubA2 gene;

FIG. 2 shows growth of wild-type (left) and mutant OsTubA2 gene rice 7 days after germination on pendimethalin herbicide-containing medium at 30 mg/L;

FIG. 3 shows a comparison of the growth of homozygous mutant plants in the herbicide environment and non-mutant plants in the herbicide-free environment in comparative experiments.

Detailed Description

The present invention will be described below with reference to examples. It will be understood by those skilled in the art that the following examples are illustrative only and are not intended to limit the scope of the present invention in any way.

The experimental procedures in the following examples are all conventional ones unless otherwise specified. The raw materials and reagents used in the following examples are all commercially available products unless otherwise specified.

(1) Rice OsTubA2 mutation site acquisition and plant expression vector construction

Selecting the nucleotide sequence CCTCACTGACTGCCTCCCTG in the OsTubA2 gene of riceAGG(the underlined part is the PAM sequence of the 5'NGG-3' structure) as a targeting site. Synthesizing (general gene company) forward oligonucleotide chains (R243M-FP 1, R243M-FP2, R243M-FP 3) and complementary reverse oligonucleotide chains (R243M-RP 1, R243M-RP2, R243M-RP 3) according to the selected target sites,

the specific sequence is as follows:

R243M-FP1:GGCACCTCACTGACTGCCTCCCTGGTTTC

R243M-RP1:CTCTGAAACCAGGGAGGCAGTCAGTGAGG

R243M-FP2:AGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCG

R243M-RP2:GCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTCAACTTGC TATGCTGTTTCCAGCATAG

R243M-FP3:GTGCCTGAtGTTCGACTGACTGCCTCC

R243M-RP3:AAAAGGAGGCAGTCAGTCGAACaTCAG

after an annealing program, R243M-FP1, R243M-RP1, R243M-FP2, R243M-RP2, R243M-FP3 and R243M-RP3 are annealed to form double-stranded DNA with sticky ends, and the double-stranded DNA is used as an insert for constructing a recombinant vector.

In this example, gene editing was performed using a PE2 editing system using a guided editing system, which can change G.C at a target site to T.A, and the process will be described below.

The PE2 vector was digested with BsaI endonuclease (NEB) at 37 ℃ for 2 hours, and the digestion system was inactivated at 65 ℃ for 10 minutes, as a backbone fragment for constructing a recombinant vector. The backbone fragment and the insert fragment of the recombinant vector were ligated with T4 ligase (NEB) and transferred into E.coli. Positive transformants were obtained by selecting plaques with kanamycin resistance and no spectinomycin resistance. After sequencing verification, positive plasmids are extracted to form recombinant vector plasmids for editing 243 th amino acid mutant bases of the rice OsTubA2 gene, the recombinant vector plasmids are named as PE2-TubA2-R243, plant expression vectors are transferred into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (stored in college of agriculture, anhui university) by a freeze-thaw method, and positive clones are obtained through colony PCR screening, so that the Agrobacterium containing the PE2-TubA2-R243 is obtained.

(2) Obtaining transgenic plants

Removing glumes of mature rice seeds, soaking the seeds in 70% alcohol for 1min, and pouring off the alcohol. Seeds were soaked for 40min (150 r/min) with 1 drop of Tween 20 in 50% sodium hypochlorite (stock solution available chlorine concentration greater than 4%). And pouring off sodium hypochlorite, and washing for 5 times by using sterile water until the solution is clear and has no sodium hypochlorite taste. The seeds were soaked in sterile water overnight. The embryos were detached along the aleurone layer with a scalpel seed and inoculated onto callus induction medium. After dark culture for 11 days at 30 ℃, separating the callus from endosperm and embryo, and pre-culturing the primary callus with good bud removal state and vigorous division for 3-5 days for agrobacterium transformation.

Agrobacterium tumefaciens transformed with the recombinant expression vector in the above-described procedure is used for Agrobacterium-mediated genetic transformation, and the procedures of genetic transformation, transformant selection, transgenic Plant regeneration, etc. are described in reference to Yongbo Duan (Yongbo Duan, chenguang Zhai, et al. An infection and high-throughput protocol for Agrobacterium mediated transformation on phosphorus immunoassay porous selection in Japonica device (OrySativa L.) [ J. Plant Cell Report,2012.DOI 10.1007/s 00299-012-1275-3), etc

(3) R243 mutation site analysis of rice OsTubA2 mutant

Selecting leaves from the obtained transgenic rice mutant plants (48 plants), extracting genome DNA, and amplifying upstream and downstream sequences of a target sequence by using a pair of primers, wherein R243-seq FP: TCTTGAGCCTACCGTGATTGAT, R243-seq RP: GTTGAGGTTGGTGTAGGTTGGG. The amplified products were sent to Shanghai Producer for genome sequencing. The sequencing result is compared with the wild type Nipponbare OsTubA2 gene, and the 1906 th G of the OsTubA2 gene in 45 rice plants is converted into T (shown in figure 1), so that the 243 th site of the corresponding coded amino acid sequence is changed from arginine to methionine, namely the nucleotide sequence of the OsTubA2 gene of the mutant is shown as SEQ ID NO:2, and the amino acid sequence of the coded OsTubA2 protein is shown as SEQ ID NO:1.

(4) Herbicide resistance identification of rice OsTubA2R243M mutant

And (3) carrying out passage on the 45 mutant rice carrying the OsTubA2R243M mutation, randomly selecting two strains, germinating 10 seeds in each strain, extracting genome DNA from leaves, performing amplification sequencing by using the R243-seq FP and the R243-seq RP, and selecting 3 rice mutants carrying the OsTubA2R243M homozygous mutation from each strain to strictly self-seed. And (3) carrying out herbicide resistance identification by using the obtained homozygous mutant seeds: adding 30mg/L pendimethalin herbicide into MS culture medium, shelling and sterilizing wild type rice seeds and the homozygous mutant seeds respectively, and then placing the seeds on the culture medium containing pendimethalin herbicide for germination and growth for 7 days; in which wild type seeds did not germinate or grow, whereas OsTubA2R243M homozygous mutant rice grew normally (FIG. 2).

From the above experiments it can be confirmed that: the PE2-TubA2-R243 vector can be used for carrying out base editing on an OsTubA2 gene, so that the base at the 1906 guanine (G) position of the gene is replaced by T, thereby changing the arginine at the 243 position of the protein sequence into methionine, and endowing a plant containing OsTubA2 mutant protein with high-strength dinitrophenylalanine herbicide resistance.

Comparative experiment 2

From the four lines in the experiment, 3 lines are selected, 12 rice mutants carrying OsTubA2R243M homozygous mutation are selected together for strict selfing and fructification, and corresponding seedlings are cultivated and divided into four groups, wherein each group comprises 3 lines. And carrying out herbicide resistance identification by using the obtained homozygous mutant seeds, and simultaneously, cultivating 12 rice seeds (corresponding to wild types) of the same variety under the same conditions to grow in a herbicide-free environment.

Specifically, 30mg/L pendimethalin herbicide is added into an MS culture medium, and the homozygous mutant seeds are respectively shelled, sterilized and then placed on the culture medium containing the pendimethalin herbicide for germination and growth for 15 days; wild type rice seeds were germinated and grown on medium for 15 days as shown in FIG. 3.

The high-resistance dinitroaniline herbicide rice mutant protein discovered by the invention can bring very high herbicide resistance to rice, so that the rice is hardly influenced by the dinitroaniline herbicide. As can be seen by comparison, the growth conditions of the plants in the culture medium containing the herbicide are almost the same as that of wild type in the culture medium without the herbicide, and the high resistance of the rice mutant plants with the high resistance to the dinitroaniline herbicide can be proved.

The above embodiments are merely preferred examples to illustrate the present invention, and it should be apparent to those skilled in the art that any obvious variations and modifications can be made without departing from the spirit of the present invention.

Sequence listing

<110> institute of Paddy Rice of agricultural science institute of Anhui province

<120> high-resistance dinitroaniline herbicide rice mutant protein and corresponding gene

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2843

<212> DNA

<213> mutant Gene (gene mutation)

<400> 1

agagaaaggc gtcttcgtac tcgcctctct ccgcgccctc ctccgccgcc gctcgccgcc 60

gttcgtctcc gccgccaccg ccgccgccat gagggagtgc atctcgatcc acatcgggca 120

ggccggtatc caggtcggga acgcgtgctg ggagctctat tgcctcgagc atggcatcca 180

ggtaaaacaa acaaaaacgg atctgatgct tccattcctc cgtttctcgt agtagcgcgc 240

ttcgatctgt gggtggatct gggtgatcct ggggtgtggt tcgttctgtt tgatagatct 300

gtcggtggat ctggccttct gtggttgtcg atgtccggat ctgcgttttg atcagtggta 360

gttcgtggat ctggcgaaat gttttggatc tggcagtgag acgctaagaa tcgggaaatg 420

atgcaatatt aggggggttt cggatgggga tccactgaat tagtctgtct ccctgctgat 480

aatctgttcc tttttggtag atctggttag tgtatgtttg tttcggatag atctgatcaa 540

tgcttgtttg ttttttcaaa ttttctacct aggttgtata ggaatggcat gcggatctgg 600

ttggattgcc atgatccgtg ctgaaatgcc cctttggttg atggatcttg atattttact 660

gctgttcacc tagatttgta ctcccgttta tacttaattt gttgcttatt atgaatagat 720

ctgtaactta ggcacatgta tggacggagt atgtggatct gtagtatgta cattgctgcg 780

agctaagaac tatttcagag caagcacaga aaaaaatatt tagacagatt gggcaactat 840

ttgatggtct ttggtatcat gctttgtagt gctcgtttct gcgtagtaat cttttgatct 900

gatctgaaga taggtgctat tatattctta aaggtcatta gaacgctatc tgaaaggctg 960

tattatgtgg attggttcac ctgtgactcc ctgttcgtct tgtcttgata aatcctgtga 1020

taaaaaaaat tcttaaggcg taatttgttg aaatcttgtt ttgtcctatg cagcctgatg 1080

gacagatgcc cggtgacaag accgttgggg gaggtgatga tgcttttaac accttcttca 1140

gtgagactgg tgctgggaag catgtccccc gtgctgtctt cgtcgatctt gagcctaccg 1200

tgattgatga ggtgaggact ggtgactacc gccagctctt ccaccctgag cagctcatca 1260

gtggcaagga ggatgcagcc aacaactttg cccgtggtca ctacaccagt aagttccatc 1320

tttactacta tctgttcaca atttctggaa atgtgattgt ttggatgtct aacatgtggt 1380

gccgttcgtt tcagttggca aggagattgt tgatctgtgc cttgaccgca tcaggaagct 1440

tgccgacaac tgcactggtc tccagggctt ccttgtgttc aacgctgttg gaggaggaac 1500

gggctccggt ctcggttccc ttctccttga gcgtctctct gtggactatg gcaagaagtc 1560

caagctcggg ttcaccgtgt acccgtcccc tcaggtctcc acctctgtgg ttgagccata 1620

caacagtgtc ctctccaccc actccctcct tgagcacacc gatgtcgctg tcctgctcga 1680

caatgaggcc atctatgaca tctgccgccg ctccctcgac attgagcgcc caacctacac 1740

caacctcaac aggcttgtgt cccaggtact gccctgcatc tttccttgca gcgctatgta 1800

ctccagttat ttgctgtaag atcaatgtaa tgtgcaattt gtcttgacat catgtggcta 1860

atgctaatgt gctgcaggtc atctcctcac tgactgcctc cctgatgttc gatggtgctc 1920

tgaatgtgga tgtcaacgag ttccaaacca acctggtgcc ctacccgagg atccacttca 1980

tgctttcctc ctacgccccg gtgatctcgg ccgagaaggc ctaccacgag cagctctccg 2040

tggcggagat caccaacagc gccttcgagc cgtcctccat gatggccaag tgcgacccgc 2100

gccacggcaa gtacatggcg tgctgcctga tgtaccgcgg cgacgtggtc cccaaggacg 2160

tgaacgccgc ggtggccacc atcaagacga agcgcaccat ccagttcgtg gactggtgcc 2220

ccacggggtt caagtgcggc atcaactacc agccgcccag cgtcgtcccg gggggagacc 2280

tggccaaggt gcagagggcc gtgtgcatga tctccaactc caccagcgtc gtcgaggtgt 2340

tctcccgcat cgacatcaag ttcgacctca tgtactccaa gcgcgccttc gtccactggt 2400

acgtcggcga gggcatggag gagggggagt tctccgaggc ccgcgaggac ctcgccgcgc 2460

tggagaagga ctacgaggag gtcggctccg agttcgacga tggtgacgag ggtgatgagg 2520

gtgacgagta ctagagaggt tcagggttct tgcctggtgc cttggcaatg cttgattact 2580

gctgctatcc tatgatctgt ccgtgtgggc ttctatctat cagtttgtgt gtctggtttt 2640

gaaaaacatt tgcttttcga ttatgcaggg tttgcttgta gctttcgctg ctgtgacctg 2700

tgttgtttat gtgaaccttc tttgtggcat ctttaatatc caagttcgtg gtttgtcgta 2760

aaacgaagcc tctacttcgt aaagttgtgt ctatagcatt gaaatcgttt ttttgctcga 2820

gaataattga cctttagttg gcg 2843

<210> 2

<211> 451

<212> PRT

<213> mutant protein

<400> 2

Met Arg Glu Cys Ile Ser Ile His Ile Gly Gln Ala Gly Ile Gln Val

1 5 10 15

Gly Asn Ala Cys Trp Glu Leu Tyr Cys Leu Glu His Gly Ile Gln Pro

20 25 30

Asp Gly Gln Met Pro Gly Asp Lys Thr Val Gly Gly Gly Asp Asp Ala

35 40 45

Phe Asn Thr Phe Phe Ser Glu Thr Gly Ala Gly Lys His Val Pro Arg

50 55 60

Ala Val Phe Val Asp Leu Glu Pro Thr Val Ile Asp Glu Val Arg Thr

65 70 75 80

Gly Asp Tyr Arg Gln Leu Phe His Pro Glu Gln Leu Ile Ser Gly Lys

85 90 95

Glu Asp Ala Ala Asn Asn Phe Ala Arg Gly His Tyr Thr Ile Gly Lys

100 105 110

Glu Ile Val Asp Leu Cys Leu Asp Arg Ile Arg Lys Leu Ala Asp Asn

115 120 125

Cys Thr Gly Leu Gln Gly Phe Leu Val Phe Asn Ala Val Gly Gly Gly

130 135 140

Thr Gly Ser Gly Leu Gly Ser Leu Leu Leu Glu Arg Leu Ser Val Asp

145 150 155 160

Tyr Gly Lys Lys Ser Lys Leu Gly Phe Thr Val Tyr Pro Ser Pro Gln

165 170 175

Val Ser Thr Ser Val Val Glu Pro Tyr Asn Ser Val Leu Ser Thr His

180 185 190

Ser Leu Leu Glu His Thr Asp Val Ala Val Leu Leu Asp Asn Glu Ala

195 200 205

Ile Tyr Asp Ile Cys Arg Arg Ser Leu Asp Ile Glu Arg Pro Thr Tyr

210 215 220

Thr Asn Leu Asn Arg Leu Val Ser Gln Val Ile Ser Ser Leu Thr Ala

225 230 235 240

Ser Leu Met Phe Asp Gly Ala Leu Asn Val Asp Val Asn Glu Phe Gln

245 250 255

Thr Asn Leu Val Pro Tyr Pro Arg Ile His Phe Met Leu Ser Ser Tyr

260 265 270

Ala Pro Val Ile Ser Ala Glu Lys Ala Tyr His Glu Gln Leu Ser Val

275 280 285

Ala Glu Ile Thr Asn Ser Ala Phe Glu Pro Ser Ser Met Met Ala Lys

290 295 300

Cys Asp Pro Arg His Gly Lys Tyr Met Ala Cys Cys Leu Met Tyr Arg

305 310 315 320

Gly Asp Val Val Pro Lys Asp Val Asn Ala Ala Val Ala Thr Ile Lys

325 330 335

Thr Lys Arg Thr Ile Gln Phe Val Asp Trp Cys Pro Thr Gly Phe Lys

340 345 350

Cys Gly Ile Asn Tyr Gln Pro Pro Ser Val Val Pro Gly Gly Asp Leu

355 360 365

Ala Lys Val Gln Arg Ala Val Cys Met Ile Ser Asn Ser Thr Ser Val

370 375 380

Val Glu Val Phe Ser Arg Ile Asp Ile Lys Phe Asp Leu Met Tyr Ser

385 390 395 400

Lys Arg Ala Phe Val His Trp Tyr Val Gly Glu Gly Met Glu Glu Gly

405 410 415

Glu Phe Ser Glu Ala Arg Glu Asp Leu Ala Ala Leu Glu Lys Asp Tyr

420 425 430

Glu Glu Val Gly Ser Glu Phe Asp Asp Gly Asp Glu Gly Asp Glu Gly

435 440 445

Asp Glu Tyr

450

Claims (7)

1. The rice OsTubA2 mutant protein with high dinitroaniline herbicide resistance is characterized in that the amino acid sequence of the OsTubA2 mutant protein is obtained by mutating the amino acid sequence of wild rice OsTubA2 at the 243 th position.

2. An OsTubA2 mutant protein according to claim 1,

(i) The amino acid sequence is shown as SEQ ID NO.1 in the sequence table;

(ii) (ii) a protein derived from (i) having an amino acid substitution mutation at position 243 in the sequence of (i).

3. An OsTubA2 mutant protein according to claim 2, wherein the amino acid sequence has a single amino acid substitution at arginine at position 243.

4. An OsTubA2 mutant gene characterized in that,

(i) Encoding a protein according to any one of claims 1 to 3; or

(ii) (ii) a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence defined in (i); or

(iii) The nucleotide sequence is selected from a sequence shown in SEQ ID NO.2 in a sequence table.

5. A method for obtaining an OsTubA2 mutant gene according to claim 4, comprising the steps of:

1) Constructing a guided editing expression vector and an expression cassette containing an OsTubA2 mutant target site;

2) Transferring the expression vector into rice through genetic transformation to obtain a target rice containing the OsTubA2 mutant gene according to claim 4;

3) Expressing a rice OsTubA2 mutant protein according to claim 1 or 2 in target rice.

6. A recombinant vector and an expression cassette containing an OsTubA2 mutant gene according to claim 4.

7. An application of the OsTubA2 mutant gene as claimed in claim 4, which comprises introducing the OsTubA2 mutant gene into recipient rice cells by physicochemical mutagenesis, gene editing, transgene, hybridization or backcross, thereby imparting the rice with the characteristics of dinitroaniline herbicide such as pendimethalin resistance.

Images