CN115125294A

CN115125294A - Pathogen nucleic acid detection kit, pretreatment method and detection method

Info

Publication number: CN115125294A
Application number: CN202110312022.1A
Authority: CN
Inventors: 王莹莹; 武爱迪; 刘遵东; 刘杨杨; 姚文钧; 祁秋雨; 米一川; 王法文; 项光新; 成岗
Original assignee: Beijing Novogene Technology Co ltd
Current assignee: Beijing Novogene Technology Co ltd
Priority date: 2021-03-24
Filing date: 2021-03-24
Publication date: 2022-09-30

Abstract

The invention provides a pathogen nucleic acid detection kit, a pretreatment method and a detection method. The kit comprises an RT-qPCR amplification system, an amplification primer of a pathogen gene and a probe, wherein the RT-qPCR amplification system comprises antibody-modified hot start DNA polymerase, thermosensitive UDG, a murine RNase inhibitor and

v reverse transcriptase, wherein the antibody-modified hot start DNA polymerase comprises

Hotstart J-Taq DNA polymerase. The various enzymes have a high concentration, and

the amplification efficiency of the Hotstart J-Taq DNA polymerase is high, and the Hotstart J-Taq DNA polymerase has strong anti-interference performance and high compatibility to a sample to be detected with more impurities, so that nucleic acid extraction or purification is not needed, and efficient and rapid detection within 20min of direct amplification is realized.

Description

Pathogen nucleic acid detection kit, pretreatment method and detection method

Technical Field

The invention relates to the field of detection kits, and particularly relates to a pathogen nucleic acid detection kit, a pretreatment method and a detection method.

Background

Pathogens, plagues and the like are closely related to human health, and with the outbreak of COVID-19 (new coronary pneumonia), SARS-CoV-2 (also called novel coronavirus in the application) is discovered from the end of 2019, and various detection products aiming at the pathogens (SARS-CoV-2) emerge on the market. However, the situation of global rapid spread still exists, and the early and rapid detection and diagnosis of SARS-CoV-2 infection or spread still has extremely important significance for isolating and controlling epidemic situation.

The existing relatively quick detection products on the market are detected based on an RT-qPCR method, and have at least the following characteristics: (1) the reaction time of the detection kit on the market is 30-70 min at present; (2) nucleic acid extraction and purification is required; (3) the false virus or plasmid is used for optimizing a primer, a probe and a system, so that the actual situation of a sample cannot be truly reflected; (4) the required enzymes are produced abroad, so the cost is high; (5) the reagent is required to be subpackaged into consumables, and then the machine is operated to complete detection. The following will describe the daan gene as an example.

The kit provided by the Daan gene is used for rapidly detecting novel coronavirus based on a thermal convection PCR method, the kit adopts the Daan gene extraction kit to extract and purify nucleic acid, adopts a Qiagen RT-qPCR amplification kit to amplify the nucleic acid, and realizes that 50-cycle rapid PCR amplification detection is completed in 18min by thermal convection PCR, and the detection sensitivity is 300 copies/mL. Although this method can achieve rapid detection, it is rapid detection after nucleic acid extraction and purification, and considering the steps of nucleic acid extraction and purification, it is still not convenient and rapid, especially when detection is performed in an environment unsuitable for nucleic acid extraction.

However, in the one-step detection method for hands-free nucleic acid, a rapid detection scheme which is equivalent to the time required for detection after nucleic acid extraction of the Daan gene has not been found at present.

Disclosure of Invention

The invention mainly aims to provide a pathogen nucleic acid detection kit, a pretreatment method and a detection method, so as to provide a rapid and accurate pathogen detection scheme free of nucleic acid extraction.

In order to achieve the above objects, according to one aspect of the present invention, there is provided a pathogen nucleic acid detection kit comprising an RT-qPCR amplification system, pathogen gene amplification primers, and a probe, wherein the RT-qPCR amplification system comprises an antibody-modified hot start DNA polymerase, a thermosensitive UDG, a murine RNase inhibitor, and a probe

Hotstart J-Taq DNA polymerase.

Further, the antibody-modified hot-start DNA polymerases also include the hot-start enzymes of near shore protein corporation; preferably, in the RT-qPCR amplification system,

the working concentration of the Hotstart J-Taq DNA polymerase is 5U-22.5U/reaction, and more preferably 12.5-17.5U/reaction; the working concentration of the hot start enzyme of the near-shore protein company is 1U-10U/reaction, and more preferably 4U-6U/reaction; the working concentration of the thermosensitive UDG is 0.1U-20U/reaction, and more preferably 0.4U-1U/reaction; the work concentration of the mouse RNase inhibitor is 2U-30U/reaction, and more preferably 6U-10U/reaction;

the working concentration of the V reverse transcriptase is 5U-80U/reaction, and more preferably 30U-50U/reaction; preferably, the kit comprises a sample container and a sample preservation solution pre-filled in the sample container; preferably the sample container is a dropper bottle.

Further, the pathogen is an RNA virus, more preferably the RNA virus is a coronavirus, and still more preferably the coronavirus is SARS-CoV-2.

Further, the pathogen is SARS-CoV-2, and the pathogen gene is ORF1ab gene and/or N gene.

Further, the primer sequence of the ORF1ab gene is: the amino acid sequence of SEQ ID NO: 1: CCCTGTGGGTTTTACACTTAA and SEQ ID NO: 2: CGATTGTGCATCAGCTGA, the probe is SEQ ID NO: 3: CCGTCTGCGGTATGTGGAAAGGTTATGG, respectively; preferably, the primer sequence of rnaspep gene is SEQ ID NO: 4: AGATTTGGACCTGCGAGCG and SEQ ID NO: 5: GAGCGGCTGTCTCCACAAGT, respectively; the probe is SEQ ID NO: 6: TTCTGACCTGAAGGCTCTGCGCG; preferably, the primer sequence of the N gene is SEQ ID NO: 7: GGGAACTTCTCCTGCTAGAAT and SEQ ID NO: 8: CAGACATTTTGCTCTCAAGCTG, respectively; the probe is SEQ ID NO: 9: TTGCTGCTGCTTGACAGATT; preferably, the primer concentration of the ORF1ab gene is 1-2 mu M; the concentration of the probe is 0.1-0.2 mu M; the primer concentration of the RNaseP gene is 0.5-1 mu M; the concentration of the probe is 0.05 mu M; the primer concentration of the N gene is 0.8-1 mu M; the probe concentration was 0.1. mu.M.

Further, when the ORF1ab gene, the N gene and the reference gene derived RNaseP gene are amplified independently from each other, the primer concentration of the ORF1ab gene is 1-2 μ M; the concentration of the probe is 0.1-0.2 mu M; the primer concentration of the RNaseP gene is 0.5-1 mu M; the concentration of the probe is 0.05 mu M; the primer concentration of the N gene is 1 mu M; the concentration of the probe is 0.1 mu M; when any one of the ORF1ab gene and the N gene was subjected to mixed amplification with the RNaseP gene, the primer concentration of the ORF1ab gene was 2. mu.M; the concentration of the probe is 0.2 mu M; the primer concentration of the RNaseP gene is 0.5. mu.M; the concentration of the probe is 0.05 mu M; the primer concentration of the N gene is 0.8-1 mu M; the concentration of the probe is 0.1 mu M; when the ORF1ab gene, N gene and RNaseP gene were subjected to mixed amplification, the primer concentration of ORF1ab gene was 2. mu.M; the concentration of the probe is 0.2 mu M; the primer concentration of the RNaseP gene is 0.5. mu.M; the concentration of the probe is 0.05 mu M; the primer concentration of the N gene is 0.8 mu M; the probe concentration was 0.1. mu.M.

Further, in the kit, an RT-qPCR amplification system, and amplification primers and probes of pathogen genes are pre-stored in a PCR reaction tube in the form of a pre-mixed solution.

In order to achieve the above object, according to a second aspect of the present invention, there is provided a pretreatment method for nucleic acid detection of a pathogen, characterized in that the pretreatment method comprises: mixing a sample to be detected in the sample preservation solution with the nucleic acid detection premix to obtain a system to be reacted; wherein the sample preservation solution is the sample preservation solution in any one of the kits, and the nucleic acid detection premixed solution is a mixed solution of an RT-qPCR amplification system, a pathogen gene amplification primer and a probe in any one of the kits.

Further, the pathogen is an RNA virus, preferably the RNA virus is a coronavirus, more preferably the coronavirus is SARS-CoV-2; preferably, the pathogen gene amplification primers and probes are the pathogen gene amplification primers and probes in any one of the above kits, and the internal reference gene amplification primers and probes, preferably, the internal reference gene is human RNase gene.

Further, the sample to be tested is a throat swab sample, an alveolar lavage fluid, a blood sample, a sputum sample, a stool sample or an environmental sample.

According to a third aspect of the present invention, there is provided a method of detecting a nucleic acid of a pathogen, the method comprising: and (3) carrying out RT-qPCR reaction after pretreating the pathogen sample to be detected by adopting any one of the pretreatment methods to obtain a detection result.

Further, the RT-qPCR reaction is thermal convection PCR, and the reaction conditions of the RT-qPCR reaction are preferably as follows: carrying out reverse transcription at 49-51 ℃ for 290-305 s to obtain a reverse transcription product; pre-melting the reverse transcription product at 97-98 ℃ for 20-30 s to obtain a pre-melting product; respectively carrying out 49-51 melting-annealing cycles on the pre-melting products to obtain detection results; wherein the melting temperature is 97-98 ℃, the melting time is 3-5 s, the annealing temperature is 56-57 ℃, and the annealing time is 7-9 s.

By applying the technical scheme of the application, various enzymes in the RT-qPCR amplification system have higher concentration, and

the amplification efficiency of the Hotstart J-Taq DNA polymerase is high, and the Hotstart J-Taq DNA polymerase has strong anti-interference performance and high compatibility to a sample to be detected with more impurities, so that nucleic acid extraction or purification is not needed, and efficient and rapid detection within 20min of direct amplification is realized, and the detection time is equivalent to that after nucleic acid extraction.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this application, illustrate embodiments of the invention and, together with the description, serve to explain the invention and not to limit the invention. In the drawings:

FIGS. 1A to 1C are graphs showing the effect of different RT-qPCR reaction systems on detection performance in example 5 according to the present invention;

FIGS. 2A to 2F are graphs showing the results of verification for different detection limits in example 9;

FIGS. 3A to 3V show the effects of various interfering substances on the detection performance of a new corona-positive sample in example 11.

Detailed Description

It should be noted that the embodiments and features of the embodiments in the present application may be combined with each other without conflict. The present invention will be described in detail with reference to examples.

As mentioned in the background, in order to quickly suppress the rapid spread of a highly contagious pathogen (e.g., SARS-CoV, MERS-CoV, or SARS-CoV-2, etc.), it is necessary to provide a protocol that enables rapid and accurate detection or screening. Most of the existing rapid nucleic acid detection methods are based on nucleic acid extraction for detection, and the time required for extracting nucleic acid is added, so that the time of the whole detection process is relatively long. Therefore, the application is researched and developed on the basis of nucleic acid detection of SARS-CoV-2, and provides a nucleic acid detection scheme suitable for a plurality of pathogens, and can realize rapid detection without nucleic acid extraction.

The development process of the present application will be briefly described below by taking an improved protocol for SARS-CoV-2 nucleic acid detection as an example. The method comprises the following specific steps: 1) on the basis of the existing multiple sample preserving fluids, the influence of the preserving fluids on nucleic acid detection is screened and compared; ) Further optimizing the optimal mixture ratio of the sample preservation solution and the sample; 3) screening the most suitable RT-qPCR amplification system; 4) further optimizing the component proportion in the RT-qPCR amplification system (mainly optimizing the working concentration of HieffUnicon hotspot J-Taq DNApolymerase); 5) optimizing amplification primers and probes of each gene to be detected according to 1-3 times on the basis of the optimal sample preserving fluid and the optimal RT-qPCR amplification system, so as to obtain the optimal working concentration of the primers and the probes during gene mixing, and finally mixing the optimized gene amplification primer probes and the optimized RT-qPCR amplification system to form a premixed solution; 6) the lowest detection limit of the kit of the present application was determined by detecting virus-simulated positive pharyngeal swabs of different copy numbers using the pre-mixed solution and the optimal sample preservation solution determined above. 7) When the components of the kit optimized for detecting the new coronavirus are used for detecting whether cross reaction exists with the detection of other pathogenic microorganisms or not, 44 different pathogenic microorganism samples are further detected, and thus the detection specificity of the kit is confirmed. 8) In order to further verify the anti-interference performance of the nucleic acid extraction-free detection result, the simulated positive sample added with 23 different interference substances is also detected, and the existence of the interference substances is confirmed to not influence the accuracy of the detection result.

According to the improved scheme, the novel coronavirus is detected by adopting the non-extraction rapid RT-qPCR, a sample is only required to be added into a reaction system for PCR reaction, and a detection result can be obtained after 20 min.

Aiming at a throat swab sample, the direct sample nucleic acid amplification detection is carried out by matching with a sample preservation solution under the strong alkaline property and a high-compatibility amplification system under the condition of not needing nucleic acid extraction or purification. The amplification time is 20min, and the detection sensitivity is equivalent to that of the common fluorescent quantitative PCR. Meanwhile, the improved scheme can be used for detecting nucleic acid extracted from a throat swab sample, alveolar lavage fluid, a blood sample, a sputum sample, a stool sample or an environment sample, the amplification time is 20min, and the detection sensitivity is superior to that of a rapid detection platform or is equivalent to that of common fluorescent quantitative PCR.

On the basis of the above research results, the applicant proposed the technical solution of the present application. In a typical embodiment, a pathogen nucleic acid detection kit is provided, and the kit comprises an RT-qPCR amplification system, pathogen gene amplification primers and a probe, wherein the RT-qPCR amplification system comprises an antibody-modified hot start DNA polymerase, a thermosensitive UDG, a murine RNase inhibitor and an antibody-modified hot start DNA polymerase

Hotstart J-Taq DNA polymerase.

In the kit, various enzymes in an RT-qPCR amplification system have higher concentration, and a PCR amplification body for a sample to be detected with more impurities has strong anti-interference performance and high compatibility, and in addition, the kit contains

The amplification efficiency of the Hotstart J-Taq DNA polymerase is high, and nucleic acid extraction or purification is not needed, so that the detection efficiency and sensitivity of directly amplifying and detecting sample nucleic acid are improved. Therefore, the direct amplification detection time of the RT-qPCR amplification system containing the components is equivalent to the detection time after nucleic acid extraction (controlled within 20 min)。

The RT-qPCR amplification system in the existing kit is screened, and the RT-qPCR amplification system containing the components is found to have the highest detection sensitivity when detecting a simulated sample without nucleic acid extraction. And further experiments show that when different interference substances are added into a positive novel coronavirus sample which is free from nucleic acid extraction for detection, the RT-qPCR amplification system can still accurately detect a virus gene. Thus, the kit of the present application protects the RT-qPCR amplification system comprising the above components.

In the above RT-qPCR amplification system, the antibody-modified hot-start DNA polymerase with higher activity is suitable for the present application, and in the above preferred embodiment, the antibody-modified hot-start DNA polymerase includes

The hot start DNA polymerase has high activity, strong compatibility and strong anti-interference capability to various impurities in a sample free from nucleic acid extraction, so that the hot start DNA polymerase is more suitable for being applied to nucleic acid hands-free rapid detection. The specific sources of the above components are not particularly limited, and the preferred sources of the components in the present application are:

hotstart J-Taq DNA polymerase (200U/. mu.L) (cat Nos. 13136ES01, 13136ES94), thermosensitive UDG (Uracil DNA Glycosylase heat-label, cat No. 10303ES60), Murine RNase inhibitor (Murine RNase inhibitor (40U/. mu.L), cat No. 10603ES05), fifth generation thermostable reverse transcriptase (Takara Shuzo)

V Reverse Transcriptase, cat # stock: 11300ES 92).

Because the RT-qPCR amplification system in the existing kit is selected, the RT-qPCR amplification system in the system is further processed on the basis

Optimization of the amount of Hotstart J-Taq DNA polymeraseAnd (4) screening. In a preferred embodiment, the antibody-modified hot-start DNA polymerase further comprises a hot-start enzyme from Toshiba protein (preferably hot-start enzyme from E097), and the working concentrations of the components in the RT-qPCR amplification system are respectively

The working concentration of the Hotstart J-Taq DNA polymerase is 5U-22.5U/reaction, more preferably 12.5-17.5U/reaction, and further preferably 15U/reaction; the working concentration of the hot start enzyme of the near-shore protein company is 1U-10U/reaction, and more preferably 4U-6U/reaction; the working concentration of the thermosensitive UDG is 0.1U-20U/reaction, more preferably 0.4U-1U/reaction, further preferably 0.5U/reaction, and the working concentration of the murine RNase inhibitor is 2U-30U/reaction, more preferably 6U-10U/reaction, further preferably 8U/reaction;

the working concentration of V reverse transcriptase is 5U to 80U per reaction, more preferably 30U to 50U per reaction, and still more preferably 40U per reaction.

In the kit, in order to improve the convenience of nucleic acid detection, the kit preferably comprises a sample container and a sample preservation solution pre-filled in the sample container, wherein the sample preservation solution is preferably (Tianjinnuo grass-derived bioinformatics science and technology ltd, jin instrument 20200452, FP 3120, FP 3250 and FP 33100) pre-filled in a sampling container, and the container is preferably a dropper bottle, so that a sample can be directly contained in the dropper bottle after sampling, and the detection can be conveniently carried out by directly dropping one or more drops in the subsequent process.

The purpose of the above-mentioned sample preservation solution is to inactivate pathogens and release nucleic acids, and also to prevent degradation of pathogen nucleic acids, especially for RNA viruses. The existing sample-holding liquids having the above-mentioned properties are all suitable for use in the present application.

As mentioned above, the improved kit of the present application is suitable for various pathogens, especially viruses with strong infectivity. Thus, preferably the pathogen is a virus, more preferably an RNA virus (more degradable than a DNA virus), more preferably an RNA virus is a coronavirus (both infectious and virulent), and even more preferably a coronavirus is SARS-CoV-2 (which is currently still rapidly spread globally).

When nucleic acid detection is performed on different pathogens, the gene with the most representative and specific property of each pathogen can be selected as a target gene for detection. When SARS-CoV-2 is detected, the nucleic acid to be detected may be any one or more of ORF1ab gene and N gene. Of course, other genes, such as the S gene, etc., can be used to characterize the gene from the corresponding pathogen.

For the above three preferred genes, suitable fragments can be selected as primers and probes for detection, and the specific design principle is consistent with that of the existing primers and probes, which is not repeated herein. In a preferred embodiment, the primer sequence of ORF1ab gene is: SEQ ID NO: 1: CCCTGTGGGTTTTACACTTAA and SEQ ID NO: 2: CGATTGTGCATCAGCTGA, the probe is SEQ ID NO: 3: CCGTCTGCGGTATGTGGAAAGGTTATGG, respectively; preferably, the primer sequence of the RNaseP gene is: SEQ ID NO: 4: AGATTTGGACCTGCGAGCG and SEQ ID NO: 5: GAGCGGCTGTCTCCACAAGT; the probe is SEQ ID NO: 6: TTCTGACCTGAAGGCTCTGCGCG; preferably, the primer sequence of the N gene is: the amino acid sequence of SEQ ID NO: 7: GGGAACTTCTCCTGCTAGAAT and SEQ ID NO: 8: CAGACATTTTGCTCTCAAGCTG, respectively; the probe is SEQ ID NO: 9: TTGCTGCTGCTTGACAGATT are provided.

Further, in the case where one gene is detected alone or a plurality of genes are detected simultaneously or the like, the concentrations of the primers and probes for the respective genes can be optimized to obtain the optimum amplification efficiency and amplification specificity, based on the sequences of the primers and probes.

In a preferred embodiment, the primer concentration of ORF1ab gene is 1-2 μ M; the concentration of the probe is 0.1-0.2 mu M; the primer concentration of the RNaseP gene is 0.5-1 mu M; the concentration of the probe is 0.05 mu M; the primer concentration of the N gene is 0.8-1 mu M; the probe concentration was 0.1. mu.M.

In a more preferred embodiment, when the ORF1ab gene, the N gene and the RNaseP gene are each independently amplified, the primer concentration of the ORF1ab gene is 1-2. mu.M; the concentration of the probe is 0.1-0.2 mu M; the primer concentration of the RNaseP gene is 0.5-1 mu M; the concentration of the probe is 0.05 mu M; the primer concentration of the N gene is 1 mu M; the probe concentration was 0.1. mu.M.

In a more preferred embodiment, when the RNaseP gene and any one of the ORF1ab genes and the N gene are subjected to mixed amplification, the primer concentration of the ORF1ab gene is 2. mu.M; the concentration of the probe is 0.2 mu M; the primer concentration of the RNaseP gene is 0.5. mu.M; the concentration of the probe is 0.05 mu M; the primer concentration of the N gene is 0.8-1 mu M; the probe concentration was 0.1. mu.M.

In a more preferred embodiment, when the ORF1ab gene, the N gene and the RNaseP gene are subjected to mixed amplification, the primer concentration of the ORF1ab gene is 2. mu.M; the concentration of the probe is 0.2 mu M; the primer concentration of the RNaseP gene is 0.5. mu.M; the concentration of the probe is 0.05 mu M; the primer concentration of the N gene is 0.8 mu M; the probe concentration was 0.1. mu.M.

The concentrations of the primers and the probes in the RT-qPCR reaction system refer to working concentrations, and are higher than the use concentrations in the existing SARS-CoV-2 detection scheme.

The sample preservation solution is a reagent capable of releasing nucleic acid in a sample, can protect RNA in a short period of time, and can be an existing nucleic acid releasing agent, specifically, a chemical reagent of strong alkali or strong acid. For example, the additive may be one or more of potassium chloride 100 to 200mmol/L, lithium chloride 50 to 200mmol/L, triethanolamine lauryl sulfate 0.1 to 1% by mass/volume, ethylphenyl polyethylene glycol (NP-40) 0.1 to 1% by volume, sodium dodecyl sulfate 0.01 to 2% by mass/volume, ethanol 0.05 to 1% by mass/volume, and the like, and is not limited to the above. To facilitate testing, the sample preservation fluid is typically pre-loaded in a sample container and the sampling swab is simply placed in the sample container.

In order to further reduce the operation steps and improve the detection efficiency, in a preferred embodiment of the present application, in the kit, the RT-qPCR amplification system, the amplification primers of the target gene, and the probe are present in the form of a premixed solution. After sampling, the sample is added into the sample preservation solution and is fully and uniformly mixed, and then the sample is dripped into the reaction tube for subsequent reaction detection, so that the operation step of loading the sample into a machine for reaction after subpackage is omitted. Not only improves the detection efficiency, but also avoids the problems of errors, sample mixing and the like caused by split charging operation.

In a preferred embodiment, the collected throat swab is placed in 1ml of a sample preservation solution as a sample to be tested. During detection, only 10 mu L of sample needs to be added into the PCR premix solution and then the PCR premix solution is centrifuged to detect. The method does not need nucleic acid extraction, does not need standing treatment before the detection by a machine (such as standing for 10min to fully release nucleic acid), and also saves split charging operation, thereby greatly accelerating the detection process and ensuring the time of the whole detection process to be 18-20 min.

In a second exemplary embodiment of the present application, there is provided a pretreatment method for pathogen nucleic acid detection, the pretreatment method comprising: mixing a sample to be detected in a sample preservation solution with the nucleic acid detection premixed solution to obtain a system to be reacted; wherein the nucleic acid detection premixed solution is a mixed solution of an RT-qPCR amplification system, a target gene amplification primer and a probe, and the RT-qPCR amplification system comprises

Hotstart J-Taq DNA polymerase, thermosensitive UDG, murine RNase inhibitor and

v reverse transcriptase.

According to the pretreatment method, an RT-qPCR amplification system with strong anti-interference and high compatibility is selected to be mixed with a target gene amplification primer and a probe to prepare a premixed solution, and a sample preservation solution with sample preservation and lysis functions is prepared, so that a sample to be detected can be quickly cracked and released in the sample preservation solution, and then the premixed solution is mixed with a nucleic acid detection premixed solution according to needs to be used for on-machine detection, and the nucleic acid does not need to be subjected to standing release, extraction and/or purification, so that quick, efficient and accurate detection is realized. The components in the RT-qPCR amplification system are all commercially available products and can be purchased.

It is to be noted that the above-mentioned pathogen may be any kind of microorganism. In the present application, preferably the pathogen is an RNA virus, more preferably the RNA virus is a coronavirus, and still more preferably the coronavirus is SARS-CoV-2.

When the pathogen is SARS-CoV-2, in the treatment method, the pathogen gene amplification primer and probe are the pathogen gene amplification primer and probe mentioned in the above kit, preferably, the pathogen gene amplification primer and probe are also included, more preferably, the internal reference gene is human RNase P gene; sample preservation solution the sample preservation solution in the kit is not described herein again.

In addition, the test sample detected by the kit and the pretreatment method of the present application includes, but is not limited to, one or more of a pharyngeal swab sample, an alveolar lavage fluid, a blood sample, a sputum sample, a stool sample and an environmental sample.

In a third exemplary embodiment of the present application, there is also provided a method for detecting a nucleic acid of a pathogen, the method comprising: and (3) carrying out RT-qPCR reaction after pretreating the pathogen sample to be detected by adopting the pretreatment method to obtain a detection result.

According to the nucleic acid detection method, nucleic acid extraction, purification or standing cracking is not needed, detection can be performed only by uniformly mixing a sample and a premixed solution and then loading the mixed solution on a machine, the detection speed is high (below 20min, only 17-18 min) and the detection specificity and sensitivity are equivalent to the detection effect after nucleic acid extraction, so that the detection method can meet the detection scene or object (such as port detection) with high time requirement, and is also suitable for rapid screening of large-scale people.

The reaction conditions for pathogen nucleic acid detection can be obtained by optimizing and adjusting according to actual needs. In a preferred embodiment of the present application, the RT-qPCR reaction is thermal convection PCR, and preferably the reaction conditions of the RT-qPCR reaction are as follows: carrying out reverse transcription at 49-51 ℃ for 290-305 s to obtain a reverse transcription product; pre-melting the reverse transcription product at 97-98 ℃ for 20-30 s to obtain a pre-melting product; respectively carrying out 49-51 unzipping-annealing cycles on the pre-unzipping products to obtain detection results; wherein the melting temperature is 97-98 ℃, the melting time is 3-5 s, the annealing temperature is 56-57 ℃, and the annealing time is 7-9 s.

The fluorescence thermal convection PCR uses heating to form a temperature gradient, generates convection after causing density difference, integrates three steps of denaturation, annealing and extension into one step, and is synchronously carried out in different temperature areas of the reaction tube, so that the whole amplification detection process is quicker, and the reaction is quicker and more convenient. In order to further shorten the detection time, the above preferred embodiment optimizes and improves the detection conditions, so that the detection time of the present application can be controlled within shorter 17-18 min, and the detection specificity and sensitivity are excellent without nucleic acid extraction.

The advantageous effects of the present application will be further described with reference to specific examples. It should be noted that, the following examples mainly illustrate the provision of a novel rapid detection kit for coronavirus nucleic acid, and mainly include the following steps:

1) screening out a suitable sample preservation solution which also has a cracking function;

2) mixing the sample preservation solution and the sample in an optimal ratio;

3) screening out a commercially available preservation solution capable of realizing one-step amplification;

4) screening kit

The optimal concentration of Hotstart J-Taq DNA Polymerase;

5) screening out a kit suitable for an anti-interference amplification system;

6) screening out primer probes suitable for amplification;

7) screening out the concentration of the novel coronavirus ORF1ab and N gene primer probes suitable for rapid amplification;

8) optimizing the temperature and time in the reaction stage;

9) confirming and verifying the detection limit through simulating a positive sample;

10) and (3) detecting and verifying the anti-interference capability of the kit.

Example 1 selection of a suitable sample preservation solution (containing lysis)

The specific experimental scheme is as follows: the method comprises the steps of collecting healthy human pharynx swabs, putting the collected healthy human pharynx swabs into 1mL of sample preservation solution (product number is FP 33100, FP 3120 and FP 3250) to serve as pharynx swab solution.

The inactivated new coronavirus culture (new coronavirus SARS-CoV-2 quality control product, Beina organism, Cathayen: BNCC319349(SCV2QC), the same below) is 1.0 × 10 ⁴ copy/mL diluted 1.0X 10 with throat swab solution ³ copy/mL, as a simulated positive pharyngeal swab solution.

A portion of the samples was subjected to nucleic acid extraction (using the QIAamp Viral RNA Mini kit (50), Qiagen cat # 52904) as a control. The following reaction system was used to simulate a positive pharyngeal swab solution (Hifair V Enzyme Mix, Hifair Biotech, Inc. (Shanghai) includes:

hotstart J-Taq DNA Polymerase (200U/. mu.l) (cat # 13136ES01, 13136ES94), Uracil DNA Glycosylase (UDG) heat-resistant-labile UDG (cat # 10303ES60), Murine RNase inhibitor (40U/. mu.l) Murine RNase inhibitor (cat # 10603ES05),

V Reverse Transcriptase fifth generation thermostable Reverse Transcriptase (cat # 11300ES 92)).

In the Hifair V Enzyme Mix in the reaction system shown in the following table, the component ratios of the components are shown in the component ratio corresponding to 15U/reaction column in example 4. Furthermore, HotstatTaq enzyme, which is an antibody-modified hot-start DNA polymerase of near-shore protein technology, Inc. (manufacturer: near-shore protein technology, Inc., cat # E097)

Table 1:

detection conditions are as follows:

the pre-mixing was performed 20 times on a Q20 instrument (Tianjinuohe biogenic bioinformatics technologies, Inc., manufacturer, name: nucleic acid amplification detection Analyzer model Q20).

Table 2:

the test results are as follows:

table 3:

1X 10 from the above table ⁴ Under the condition of copy/mL concentration, the direct amplification reaction can not be carried out without adding the sample preserving fluid, and under the condition that the template concentration is reduced by one order of magnitude, the sample preserving fluid is added to carry out the direct amplification reaction, and the amplification effect is equivalent to the amplification effect of extracting RNA, thereby proving that the sample preserving fluid has the lysis effect.

In the subsequent embodiments, the sample protection solution is used as a sample preservation solution before the sample is subjected to pre-amplification, and is hereinafter referred to as a sethoxydim source sample protection solution for short.

Example 2 optimal mixture ratio of Nuo-He immunogenic sample preservation solution and sample

The specific experimental scheme is as follows: diluting the noro grass original sample preservation solution and the inactivated new coronavirus culture in a ratio (1: 2, 1: 4 and 1: 9) to determine the optimal ratio.

The reaction system and the detection conditions are shown in Table 1 and Table 2, respectively.

The test results are as follows:

table 4:

the results show that: when the Nordheim original preservation solution and the inactivated new coronavirus culture are mixed according to the ratio of 1: the dilution of more than 4 can stabilize the detection result without influencing the detection.

Example 3: detection of effect of commercially available sample preservation solution on one-step amplification

The specific experimental scheme is as follows: collecting throat swab of healthy human, placing into storage solution of Noheo original sample as throat swab solution, and inactivating 6 μ L of novel coronavirus culture 1.0 × 10 ⁴ copy/mL diluted to 1.0X 10 with 54. mu.L throat swab solution ³ copy/mL. The test inactivation type (without guanidinium salts) sample preservation solution, the sample preservation solution 1 (Jicang mechanical preparation 20200006, Yongkang medical supplies Co., Ltd., one-time use virus sampling tube Shenzhen), the sample preservation solution 2 (Jicang mechanical preparation 20190041, Xiyan medical preparation Co., Ltd., Shenzhen, one-time use virus sampling tube Shenzhen), and the simulated positive pharyngeal swab sample (diluted with Nuo He immunogenic sample preservation solution) are diluted in proportion to evaluate the optimal dilution proportion.

The test results are as follows:

table 5:

the above results indicate that two pharyngeal swabs stored by the commercial sample preservation solution are diluted according to 2 when the pharyngeal swabs and the nochloropsis grass source sample preservation solution are diluted: 5, the positive sample can be normally detected.

Example 4: reagent kit

Hotstart J-Taq DNA Polymerase concentration screening

The specific experimental scheme is as follows: collecting pharynx swab of healthy person, adding into 1mL Nuo He original sample storage solution as pharynx swab solution, and adding inactivated novel coronavirus culture 1.0 × 10 ⁴ copy/mL diluted 1.0X 10 with throat swab solution ³ copy/mL. The optimum enzyme addition amount and the other component ratios were selected from 5U/reaction to 22.5U/reaction, see the following table.

Table 6:

the reaction system is as shown in Table 1 except that

In the case of the V Enzyme Mix,

the concentrations of Hotstart J-Taq DNA Polymerase were 5U/reaction, 12.5U/reaction, 15U/reaction, 17.5U/reaction, and 22.5U/reaction, respectively.

The detection conditions were as in Table 2.

The results of the measurements are shown in the following table:

table 7:

the results showed that detection of the fluorescence value of ORF1ab, when the amplification was carried out using the triple primers, the amplification reaction was not carried out using the 5U/reaction ORFab, and detection was carried out at all the other concentrations. Among them, 15U/reaction fluorescence value is higher than 12.5U/reaction and 17.5U/reaction, and 22.5U/reaction is preferable because the addition of the enzyme is excessive and the cost is increased.

The origin of Hotstart Taq in the reaction system is the same as that described above, and it is a hot-start DNA polymerase modified with an antibody of Torissin corporation, and the enzyme is also provided with a DNA polymerase having the same activity as that of Hotstart Taq

The catalytic activity of the Hotstart J-Taq DNA Polymerase was similar to that of the enzyme, but the concentration was relatively low (concentration was only 5U/. mu.L), and the enzyme was used in the same manner as that of the enzyme

Under the same reaction conditions as those of Hotstart J-Taq DNA Polymerase, much volume of the enzyme needs to be added (more than 25. mu.L of the above table), and thus it is difficult to achieve the same reaction system as that of the reaction system

The same effect of Hotstart J-Taq DNA Polymerase.

The antibody-modified hot-start DNA polymerase of Torissin corporation additionally added here can also be added in an appropriate system

The concentration of Hotstart J-Taq DNA Polymerase, as can be seen from the following: it will be appreciated that from the above-described system,

the concentration of Hotstart J-Taq DNA Polymerase was set to 22.5U/reaction, except that Hotstart Taq from Nippon protein was not added. The specific results are as follows:

hotstart J-Taq DNA Polymerase (200U/. mu.L) was diluted to 12.5U/. mu.L with an antibody diluent (Kyoho Seisakusho Biotech (Shanghai) Co., Ltd., cat # 11371ES10, standard: 10 mL).

The reaction system is as follows:

table 8:

the detection conditions were as in Table 2.

The results of the measurements are shown in the following table:

table 9:

the results show that: next saint creatures

Hotstart J-Taq DNA Polymerase 0.2U/. mu.L-0.5U/. mu.L can be reacted, and enzyme tests of two manufacturers of Hotstart Taq DNA Polymerase of the next holy organism and the near shore protein can be carried out.

Example 5: RT-qPCR reaction system screening

The specific scheme is as follows: collecting pharynx swab of healthy person, adding into 1mL Nuo He original sample preservation solution as pharynx swab solution, and adding inactivated novel coronavirus culture 1.0 × 10 ⁴ copy/mL diluted 1.0X 10 with throat swab solution ³ copy/mL. The detection is carried out by 3 (Tiangen, next holy and Novozam) RT-qPCR one-step kits, each sample is subjected to three repeated experiments to carry out dual ORF1ab/RNaseP amplification, and the kit with the best amplification effect is judged according to the Ct value of ORF1ab for further optimization.

Table 10: alternative RT-qPCR kit

Reaction system:

A. holy biology next (kit cargo number 13160ES60)

Table 11:

name(s)	Concentration of	Volume of	Final concentration
				4×Hifair V MP Buffer	/	6.25	1×
Hifair V Enzyme Mix	/	2	/
				Hotstart Taq	5U/μL	1	0.2U/μL
ORF1ab-F	100μM	0.5	2μM
				ORF1ab-R	100μM	0.5	2μM
ORF1ab-P-FAM	10μM	0.5	0.2μM
				RNaseP-F	100μM	0.25	1μM
RNaseP-R	100μM	0.25	1μM
				RNaseP-P-Cy5	10μM	0.25	0.1μM
Sample(s)	/	7
				NFW		6.5
Total of	/	25

B. Tiangen (kit goods number FP314)

Table 12:

C. novozan (kit goods number Q222-CN-NH2)

Table 13:

name (R)	Concentration of	Volume of	Final concentration
				4×OneStep U+Mix	/	6.25	1×
OneStep U+Enzyme Mix 2	/	2	/
				Hotstart Taq	5U/μL	1	0.2U/μL
ORF1ab-F	100μM	0.5	2μM
				ORF1ab-R	100μM	0.5	2μM
ORF1ab-P-FAM	10μM	0.5	0.2μM
				RNaseP-F	100μM	0.25	1μM
RNaseP-R	100μM	0.25	1μM
				RNaseP-P-Cy5	10μM	0.25	0.1μM
Sample(s)	/	7
				NFW		7.25
Total of	/	25

Hotstart Taq was purchased from a near shore protein in all three systems.

The detection conditions were as in Table 2.

The test results are shown in the following table and fig. 1A, 1B and 1C.

Table 14:

the results showed that the Ct value of ORF1ab was detected, the next saint organism, Novozam, was better resistant to interference than the day roots for direct amplification, and the next saint organism was better than Novozam, so the next saint organism kit was designated as a spare kit and subsequent system optimization was performed on this basis.

Example 6: screening out primer probes suitable for amplification

The novel coronavirus N gene primer probe published by WHO is as follows:

WHO：

N-F：GGGGAACTTCTCCTGCTAGAAT(SEQ ID NO：7)；

N-R:CAGACATTTTGCTCTCAAGCTG(SEQ ID NO：8)；

N-Probe：TTGCTGCTGCTTGACAGATT(SEQ ID NO：9)。

hong Kong university:

HKU-NF：TAATCAGACAAGGAACTGATTA(SEQ ID NO：10)；

HKU-NR：CGAAGGTGTGACTTCCATG(SEQ ID NO：11)；

HKU-NP-Probe：GCAAATTGTGCAATTTGCGG(SEQ ID NO：12)。

detection conditions are as follows: as in table 2.

The probe concentration was 0.4. mu.M, and the results were as follows:

table 15:

the results show that the primer probe result of the WHO novel coronavirus N gene is obviously better than that of hong Kong university according to the Ct value, so the primer probe of the WHO novel coronavirus N gene is preferred.

Therefore, in the present application, unless otherwise specified, the specific sequences of RNase primers and probes used in the tests in other examples are the sequences published by WHO, and ORF1ab/N uses Chinese CDC to provide primer probes.

The pseudovirus mentioned in this and subsequent examples had the same effect as the virus culture in the previous examples, and was replaced by the pseudovirus since no virus culture was purchased at that time. Wherein the pseudovirus is: the coat protein of the bacteriophage is used for wrapping a section of RNA sequence of the new coronavirus to form virus-like substances so as to replace the new coronavirus. Unlike the previous virus cultures, the pseudovirus provides a part of the viral sequence, not the whole genome (the pseudovirus was prepared according to the method disclosed in CN 058765A).

Example 7: optimized single/double/triple system primer probe concentration of throat swab sample

Based on the reaction system determined in example 5 and the gene amplification primers and probes determined in example 6, the concentration of the final 1-3 heavy primer probes was determined based on the results of the Ct values of ORF1ab/N/RNaseP after amplification (shown in the following Table). The following screening was performed under the same test conditions as those in the previous examples. The method comprises the following specific steps:

detection conditions are as follows: as in table 2.

Single primer probe concentration screening (pseudovirus sample test)

(1) Single primer Probe concentration screening, ORF1ab primer (at 0.4. mu.M probe concentration).

Table 16:

as can be seen from the above table, the primer concentration is 0.5-2. mu.M, preferably 1-2. mu.M, when ORF1ab single gene is detected.

(2) ORF1ab Probe concentration optimization (primer concentration 2. mu.M in this case)

Table 17:

as can be seen from the above table, the concentration of ORF1ab single probe in the detection of ORF1ab single gene is detected at all 4 concentrations, preferably 0.1-0.2. mu.M from the viewpoint of saving dosage, and more preferably 0.2. mu.M for insurance.

(3) N primer concentration (in this case, the probe concentration is 0.4. mu.M)

Table 18:

as can be seen from the above table, a suitable range of N single primer concentration is 0.5-1. mu.M, preferably 0.5-1. mu.M.

(4) N Single probe (in this case, the primer concentration is 0.5. mu.M)

Table 19:

as can be seen from the above table, the probe concentration at the time of N-singleplex detection is preferably 0.1. mu.M.

(5) RNaseP primer (at a probe concentration of 0.3. mu.M)

Table 20:

as can be seen from the above table, the primer concentration of RNaseP alone is suitably 0.5-1. mu.M, preferably 0.5. mu.M.

(6) RNaseP probe (in this case, the concentration of the primer is 0.5. mu.M)

Table 21:

as can be seen from the above table, the RNaseP single probe concentration can be amplified at 0.05-0.1. mu.M, preferably 0.05. mu.M.

Second, double primer probe concentration screening (simulation positive throat swab sample test)

(1) ORF1ab primer concentration was 2. mu.M, probe concentration was 0.2. mu.M; the concentration of the N gene probe was 0.1. mu.M.

Table 22:

the difference in Ct value is not large according to the detection result, and the result is more preferable when the fluorescence value of N primer is 0.8. mu.M, so that the N primer concentration is preferably 0.8. mu.M.

Triple, triple primer Probe concentration test (simulation Positive throat swab sample test)

ORF1 ab: the primer concentration adopts 2 MuM, and the probe concentration is 0.2 MuM; the concentration of the N primer is 0.8 mu M, and the concentration of the probe is 0.1 mu M; RNaseP: the primer concentration was 0.5. mu.M, and the probe concentration was 0.05. mu.M.

Table 23:

in summary, the results of the 1-3 primer probe concentration screening are shown in the following table.

Table 24: the most preferable concentration of the 1-3-fold primer probe

Example 8 reaction stage temperature, time optimization

Reaction system: as in table 1.

The Tm value was set to 57/58 ℃, and the optimum annealing temperature was determined.

Table 25:

and (3) detection results:

table 26:

according to the detection result, the Ct value shows that 57 ℃ is obviously better than 58 ℃.

Setting the reverse transcription time of 3/5min, and determining the suitable reverse transcription time.

Table 27:

and (3) detection results:

table 28:

according to the detection result, the Ct value shows that RT 5min is obviously better than 3 min.

Setting the pre-delinking time to be 10s/30s, and determining the suitable pre-delinking time.

Table 29:

and (3) detection results:

table 30:

according to the detection result, the Ct value shows that 30s of pre-melting is obviously better than 10 s.

In summary, the optimal reaction conditions are shown in the following table.

Table 31:

example 9: low detection Limit (LoD) verification

The concentration is 1.0X 10 ⁶ The copy/mL inactivated culture of the novel coronavirus (novel coronavirus SARS-CoV-2 quality control, Beina organism, cat # BNCC319349(SCV2QC)) was diluted to 1.25X 10 with pharyngeal swabs collected from healthy persons ⁵ 、2.5×10 ⁴ 、5.0×10 ³ 、1.0×10 ³ 300 copies/mL, and 20 times of tests are carried out on each concentration gradient, and the concentration reaching 90% -95% positive detection rate is preliminarily determined as the lowest detection limit (LoD). The results are shown in the following table.

The test results are shown in the following table and fig. 2A to 2F:

table 32:

from the Ct value results, 1.25X 10 ⁵ 、2.5×10 ⁴ 、5.0×10 ³ 、1.0×10 ³ copies/mL are detected for all three replicates, thus the lowest detection limit is initially determinedIs 1.0X 10 ³ copy/mL, and additionally set three gradients 5.0X 10 in its concentration range ³ 、1.0×10 ³ copy/mL and 300 copy/mL.

The concentration is 1.0X 10 ⁶ The inactivated new coronavirus culture (new coronavirus SARS-CoV-2 quality control, Beina organism, Cat. No.: BNCC319349(SCV2QC)) was diluted to 5.0X 10 with pharyngeal swab collected from healthy human ³ 、1.0×10 ³ 500 copies/mL and 300 copies/mL, and 20 times of tests are carried out on each concentration gradient, and the concentration reaching 90% -95% positive detection rate is preliminarily determined as the lowest detection limit (LoD). The results are shown in the following table.

Table 33:

according to the result of Ct value, 500 copies/mL ORF20/20 and 300 copies/mL ORF 14/20 are detected, so that the 500 copies/mL virus concentration is initially determined as the lowest detection limit of the kit.

Example 10: specificity analysis

1) 44 different types of pathogenic microorganisms are tested to detect the specificity condition of the amplification system.

2) To a concentration of 2.0X 10 ³ The inactivated new coronavirus strain is added with possible interference substances per mL and detected. The specific operation is as follows: samples (1: 9 dilution, concentration after dilution shown in the table) of 44 different types of pathogenic microorganisms placed in the norsticho source sample preservation solution are respectively tested, and the specificity condition of an amplification system is detected.

Table 34: 44 different types of pathogenic microorganisms

44 different types of pathogenic microorganisms are tested, wherein the detection results of ORF1ab/N genes of the pathogenic microorganisms are negative. As part of pathogenic microorganisms are cultured by adopting human cells, the detection result of the RNaseP gene is positive.

Example 11: experiment of interferents

To a concentration of 2.0X 10 ³ The copy/mL inactivated new coronavirus strain is added with possible interference substances, and the detection is carried out according to the optimal concentration of each gene primer probe, the optimal RT-qPCR kit and the optimal detection condition in triple detection determined in the previous embodiment. The specific interferent species and concentrations are shown in the table below. It was confirmed whether the system had an influence on the detection performance in the presence of an interfering substance.

Table 35: substance for interference experiment and detection result

As can be seen from the above-mentioned results and FIGS. 3A to 3V, 2.0X 10 of the 23 interfering substances added were measured by the method of the present application ³ copies/mL inactivated virus cultures were detected.

Example 12: validation of 100 clinical samples

The number of the PPS cases brought by the detection results (examination reagents: Tianjinnuo biogenic biological information technology Co., Ltd., contrast reagents: Shanghai Berjie medical technology Co., Ltd.) of the two kits in the clinical test is 100, wherein the number of the PPS cases with the negative result of the examination reagents and the positive result of the contrast reagents is 3; negative results in 21 cases of both tests. The number of cases with negative examination results of the examination reagent and the control reagent is 2; 74 cases with positive results (see table below for details)

Table 36: results of assay of coincidence rate of two kinds of kits (PPS)

The test results of 100 clinical samples of Hubei CDC show that the positive coincidence rate is 96.10%, and the negative coincidence rate is 91.30%.

Attached: total analysis set (FAS): a collection of subjects on an intent-to-treat (ITTA) principle. FAS refers to the analytical data set consisting of all subjects who signed an informed consent for testing and evaluation. And compliance with protocol analysis set (PPS): a subset of FAS refers to cases that have completed the relevant tests and rejected a severe violation of the protocol (violation of inclusion or exclusion criteria, affecting primary endpoint evaluation), whose dataset was determined upon further review after completion of the test.

From the above description, it can be seen that the above-described embodiments of the present invention achieve the following technical effects: compared with the existing commercialized kit, the novel coronavirus nucleic acid detection kit based on molecular POCT has the advantages of simple operation, short detection time, no need of nucleic acid extraction and purification and immediate detection, and the detection sensitivity is not lower than that of the like products.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Beijing Nuo He-derived science and technology Ltd

<120> pathogen nucleic acid detection kit, pretreatment method and detection method

<130> PN146415TJNH

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 1

ccctgtgggt tttacactta a 21

<210> 2

<211> 18

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 2

cgattgtgca tcagctga 18

<210> 3

<211> 28

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 3

ccgtctgcgg tatgtggaaa ggttatgg 28

<210> 4

<211> 19

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 4

agatttggac ctgcgagcg 19

<210> 5

<211> 20

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 5

gagcggctgt ctccacaagt 20

<210> 6

<211> 23

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 6

ttctgacctg aaggctctgc gcg 23

<210> 7

<211> 22

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 7

ggggaacttc tcctgctaga at 22

<210> 8

<211> 22

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 8

cagacatttt gctctcaagc tg 22

<210> 9

<211> 20

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 9

ttgctgctgc ttgacagatt 20

<210> 10

<211> 22

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 10

taatcagaca aggaactgat ta 22

<210> 11

<211> 19

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 11

cgaaggtgtg acttccatg 19

<210> 12

<211> 20

<212> DNA

<213> novel coronavirus (SARS-CoV-2)

<400> 12

gcaaattgtg caatttgcgg 20

Claims

1. The pathogen nucleic acid detection kit is characterized by comprising an RT-qPCR amplification system, an amplification primer and a probe of a pathogen gene, wherein the RT-qPCR amplification system comprises an antibody-modified hot start DNA polymerase, a thermosensitive UDG, a murine RNase inhibitor and a probe

Hotstart J-Taq DNA polymerase.

2. The kit of claim 1, wherein the antibody-modified hot-start DNA polymerase further comprises a hot-start enzyme from near shore protein;

preferably, in the RT-qPCR amplification system, the

The working concentration of the Hotstart J-Taq DNA polymerase is 5U-22.5U/reaction, and more preferably 12.5-17.5U/reaction; the working concentration of the hot start enzyme of the near-shore protein company is 1U-10U/reaction, and more preferably 4U-6U/reaction; the working concentration of the thermosensitive UDG is 0.1U-20U/reaction, and more preferably 0.4U-1U/reaction; the work concentration of the murine RNase inhibitor is 2U-30U/reaction, and more preferably 6U-10U/reaction; the above-mentioned

The working concentration of the V reverse transcriptase is 5U-80U/reaction, and more preferably 30U-50U/reaction;

preferably, the kit comprises a sample container and a sample preservation solution preloaded in the sample container; preferably, the sample container is a dropper bottle.

3. The kit of claim 1, wherein the pathogen is an RNA virus, more preferably the RNA virus is a coronavirus, and even more preferably the coronavirus is SARS-CoV-2.

4. The kit according to claim 1, wherein the pathogen is SARS-CoV-2, and the pathogen gene is ORF1ab gene and/or N gene; preferably, the kit further comprises an amplification primer and a probe of a reference gene, and more preferably, the reference gene is a human RNaseP gene.

5. The kit according to claim 4, wherein the primer sequence of ORF1ab gene is: SEQ ID NO: 1: CCCTGTGGGTTTTACACTTAA and SEQ ID NO: 2: CGATTGTGCATCAGCTGA, the probe is SEQ ID NO: 3: CCGTCTGCGGTATGTGGAAAGGTTATGG;

preferably, the primer sequence of the rnaspep gene is SEQ ID NO: 4: AGATTTGGACCTGCGAGCG and SEQ ID NO: 5: GAGCGGCTGTCTCCACAAGT, respectively; the probe is SEQ ID NO: 6: TTCTGACCTGAAGGCTCTGCGCG, respectively;

preferably, the primer sequence of the N gene is SEQ ID NO: 7: GGGAACTTCTCCTGCTAGAAT and SEQ ID NO: 8: CAGACATTTTGCTCTCAAGCTG, respectively; the probe is SEQ ID NO: 9: TTGCTGCTGCTTGACAGATT;

preferably, the primer concentration of the ORF1ab gene is 1-2 mu M; the concentration of the probe is 0.1-0.2 mu M;

the primer concentration of the RNaseP gene is 0.5-1 mu M; the concentration of the probe is 0.05 mu M;

the primer concentration of the N gene is 0.8-1 mu M; the probe concentration was 0.1. mu.M.

6. The kit according to claim 5, wherein when the ORF1ab gene, the N gene and the RNaseP gene are each independently amplified,

the primer concentration of the ORF1ab gene is 1-2 mu M; the concentration of the probe is 0.1-0.2 mu M;

the primer concentration of the N gene is 1 mu M; the concentration of the probe is 0.1 mu M;

when any one of the ORF1ab gene and the N gene is subjected to mixed amplification with the RNaseP gene,

the primer concentration of the ORF1ab gene is 2 mu M; the concentration of the probe is 0.2 mu M;

the primer concentration of the RNaseP gene is 0.5 mu M; the concentration of the probe is 0.05 mu M;

the primer concentration of the N gene is 0.8-1 mu M; the concentration of the probe is 0.1 mu M;

when the ORF1ab gene, the N gene and the RNaseP gene are subjected to mixed amplification,

the primer concentration of the ORF1ab gene is 2 μ M; the concentration of the probe is 0.2 mu M;

the primer concentration of the N gene is 0.8 mu M; the probe concentration was 0.1. mu.M.

7. The kit according to any one of claims 1 to 6, wherein the RT-qPCR amplification system and the amplification primers and probes for the pathogen gene are pre-stored in a PCR reaction tube in the form of a pre-mixed solution.

8. A pretreatment method for detection of nucleic acid of a pathogen, the pretreatment method comprising:

mixing a sample to be detected in the sample preservation solution with the nucleic acid detection premix to obtain a system to be reacted; wherein the sample preservation solution is the sample preservation solution in the kit of any one of claims 2, and the nucleic acid detection premix solution is a mixture of the RT-qPCR amplification system, the pathogen gene amplification primer and the probe in the kit of any one of claims 1 to 7.

9. The pretreatment method according to claim 8, wherein the pathogen is an RNA virus, preferably the RNA virus is a coronavirus, more preferably the coronavirus is SARS-CoV-2;

preferably, the pathogen gene amplification primers and probes are the pathogen gene amplification primers and probes in the kit of any one of claims 4-6, and.

10. The pretreatment method according to claim 8, wherein the sample to be tested is a throat swab sample, an alveolar lavage fluid, a blood sample, a sputum sample, a stool sample, or an environmental sample.

11. A method for detecting a nucleic acid of a pathogen, the method comprising:

the pretreatment method of any one of claims 8 to 10 is adopted to carry out RT-qPCR reaction after pretreatment of the pathogen sample to be detected, and detection results are obtained.

12. The detection method according to claim 11, wherein the RT-qPCR reaction is a thermal convection PCR, preferably the RT-qPCR reaction has reaction conditions:

carrying out reverse transcription at 49-51 ℃ for 290-305 s to obtain a reverse transcription product;

pre-melting the reverse transcription product at 97-98 ℃ for 20-30 s to obtain a pre-melting product;

respectively carrying out 49-51 unzipping-annealing cycles on the pre-unzipping products to obtain the detection result;

the melting temperature is 97-98 ℃, the melting time is 3-5 s, the annealing temperature is 56-57 ℃, and the annealing time is 7-9 s.