CN115125270A

CN115125270A - Alpha-globin overexpression vector and application thereof

Info

Publication number: CN115125270A
Application number: CN202110304017.6A
Authority: CN
Inventors: 吴宇轩; 程艳; 徐赛娟; 赵飞燕; 席在喜; 刘明耀
Original assignee: East China Normal University; Bioray Laboratories Inc
Current assignee: East China Normal University; Bioray Laboratories Inc
Priority date: 2021-03-22
Filing date: 2021-03-22
Publication date: 2022-09-30
Also published as: WO2022199552A1

Abstract

The invention discloses an alpha-globin overexpression vector and application thereof, wherein the alpha-globin overexpression vector sequentially comprises: (1) a locus control region, an alpha-globin promoter, an HBA2 gene and an HBA2 gene 3' sequence fragment, wherein the locus control region is HS 40; or (2) locus control regions HS4, HS3 and HS2, the beta-globin promoter, the HBA2 gene and the 3' sequence fragment of the HBB gene. The overexpression vector provided by the invention can efficiently transduce the target gene, can stably express the target gene for a long time, and has high infection efficiency and expression stability.

Description

Alpha-globin overexpression vector and application thereof

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to an alpha-globin overexpression vector and application thereof.

Background

Normal hemoglobin is a tetramer consisting of two alpha-globin chains and two beta-globin chains. There are two functional alpha-hemoglobin genes, named HBA1 and HBA2, respectively. Alpha thalassemia (alpha thalassemia) is an autosomal recessive genetic disorder caused by an imbalance in alpha chain and non-alpha chain synthesis due to a loss or dysfunction of the alpha globin gene resulting in reduced or no alpha-globin chain synthesis. The common deletion on the alpha-globin gene cluster is beta 0/- - ^SEA And-alpha ^4.2 /-α ^4.2 And the like, the mechanism of occurrence is deletion due to homologous and non-homologous recombination of one or two chromosomes of the alpha globin gene, and the gene deletion can lead the expression level of the alpha globin gene to be down-regulated so as to reduce the production of the alpha globin chain.

Alpha thalassemia is reported to be one of the most common monogenic genetic diseases in the world, particularly common in the mediterranean, southeast asia, africa, middle east and indian subcontinent, with a high incidence in the south area of the Yangtze river in China. According to the World Health Organization (WHO) estimates, 20% of the world population may have one or more alpha-globin genes deleted. In southern provinces and southeast Asia of China, the most common deletion types are-SEA (southeast Asia deletion type), -alpha ^4.2 (left deletion) and-alpha ^3.7 Three types (right deletion). In the past decades, north has changed due to changes in population architectureThe incidence of alpha thalassemia in europe and north america is increasing. Currently, effective treatment means for thalassemia at home and abroad include allogeneic hematopoietic cell transplantation, normative long-term blood transfusion, and deferral therapy, but have rejection risks, complications, and other toxic effects, and thus a gene therapy regimen is being evaluated as a new one.

In recent years, due to the rapid advance of genetic engineering technology, CRISPR/Cas technology has become one of the hot spots of the scientific community. Research shows that compared with other gene editing tools, the CRISPR/Cas system has higher cutting efficiency in stem cells, can be used for constructing disease models, screening medicines, preparing therapeutic stem cells and the like, brings new hopes for disease treatment, but possible off-target risks cannot be ignored. Viral vectors have the characteristics of high infection rate and low cytotoxicity, and are still the preferred scheme for many scientific researches and clinical trials at present. Lentiviral vectors derived from HIV-1 lentivirus, comprising a plurality of accessory elements for increasing transduction efficiency, viral packaging and/or elements for increasing expression of therapeutic genes, and modified 5'LTR and/or 3' LTR, are incapable of transcribing RNA even in the presence of all viral proteins upon integration of such vectors into a cell of interest, rendering the virus replication-deficient to increase the safety of the lentivirus system. The lentivirus vector has the characteristics of capability of infecting cells in a non-dividing period, large capacity of accommodating exogenous target gene fragments, strong stability, high infection efficiency and the like.

The third generation lentivirus system, constructs gag, pol genes and rev or env genes on different plasmids, respectively, and introduces deletions in the 3' LTR of the viral genome to generate self-inactivating (SIN) lentivirus vectors, destroys the promoter/enhancer activity of LTRs, further improves safety, and reduces the risk of carcinogenesis. 2/3 clinical trials of gene therapy are using viral vectors to introduce genes into target cells and HIV-derived lentiviral vectors are currently used in large numbers. Gene therapy by lentiviral vectors has brought a new choice for hemoglobinopathies, and clinical studies have been carried out with encouraging results, but long-term efficacy and safety remain to be demonstrated. In vitro gene therapy, the addition of a normal globin gene together with appropriate cis-linked regulatory elements to Hematopoietic Stem Cells (HSCs) by vector transfer and chromosomally integrated gene delivery remains the method of choice. Lentiviral vector gene therapy requires very high hematopoietic stem cell infection efficiency and long-term stable α -globin expression for clinical significance.

However, the studies on globin overexpression vectors in the prior art are almost directed to beta-globin gene, so that an alpha-globin overexpression vector with an expression rate suitable for clinical application is urgently needed.

Disclosure of Invention

The invention aims to solve the technical problem of providing an alpha-globin overexpression vector with moderate expression rate and application thereof in order to overcome the defect that the prior art is lack of an overexpression vector for expressing an alpha-globin gene.

In humans, the regulatory sequences of the alpha-globin gene contain binding sites for various cis-and trans-acting factors, and the synergistic effect between them ensures the tissue and temporal specificity of the alpha globin gene expression. For the expression regulation of heterologous alpha-globin genes, a large amount of sequences of various functional regions need to be synthesized in the process of completely copying nature, the process is very complex and is difficult to realize in terms of cost; however, the expression of the heterologous HBB gene, which has been studied and developed to some extent, is based on the expression control of the regulatory element of the native HBB gene, and the selection of the expression control element of the heterologous α -globin gene has not been studied in the prior art, so that the expression of the heterologous α -globin gene is still a technical problem at present.

In order to solve the above technical problems, one of the technical solutions provided by the present invention is: an alpha-globin overexpression vector comprising, in order: (1) a locus control region, an alpha-globin promoter, an HBA2 gene and an HBA2 gene 3' sequence fragment, wherein the locus control region is HS 40;

or (2) locus control regions HS4, HS3 and HS2, the beta-globin promoter, the HBA2 gene and the 3' sequence fragment of the HBB gene.

The sequential inclusion refers to sequential inclusion from the 5 'end to the 3' end.

Preferably, the alpha-globin overexpression vector comprises a cis-acting element, an HBA2 gene and a 3' sequence fragment of HBA2 gene in sequence, wherein the cis-acting element is composed of a locus control region HS40 and an alpha-globin promoter.

The alpha-globin promoter of the invention is preferably the HBA2 promoter; more preferably, the sequence comprises the sequence shown in SEQ ID NO. 2, or the sequence with more than 80% of sequence identity with the sequence shown in SEQ ID NO. 2, for example, the sequence is shown in SEQ ID NO. 2.

The locus control region HS40 according to the present invention can be conventional in the art, and its sequence preferably comprises the sequence shown as SEQ ID NO. 1, or comprises a sequence having more than 80% sequence identity with the sequence shown as SEQ ID NO. 1, for example, its sequence is shown as SEQ ID NO. 1.

The 3' sequence fragment of the HBA2 gene of the invention can be conventional in the art, and the sequence preferably comprises a sequence shown as SEQ ID NO. 4, or a sequence with more than 80% sequence identity with the sequence shown as SEQ ID NO. 4, for example, the sequence shown as SEQ ID NO. 4.

The beta-globin promoter of the present invention is preferably the HBB promoter; more preferably, the sequence comprises the sequence shown as SEQ ID NO. 8, or the sequence has more than 80% of sequence identity with the sequence shown as SEQ ID NO. 8, for example, the sequence is shown as SEQ ID NO. 8.

The locus control region HS4 according to the present invention may be conventional in the art, and its sequence preferably comprises the sequence shown as SEQ ID NO. 5, or a sequence having more than 80% sequence identity with the sequence shown as SEQ ID NO. 5, for example, its sequence is shown as SEQ ID NO. 5.

The locus control region HS3 according to the present invention can be conventional in the art, and its sequence preferably comprises the sequence shown in SEQ ID NO. 6, or a sequence having more than 80% sequence identity with the sequence shown in SEQ ID NO. 6, for example, its sequence is shown in SEQ ID NO. 6.

The locus control region HS2 according to the present invention can be conventional in the art, and its sequence preferably comprises the sequence shown as SEQ ID NO. 7, or comprises a sequence having more than 80% sequence identity with the sequence shown as SEQ ID NO. 7, for example, its sequence is shown as SEQ ID NO. 7.

The HBB gene 3' sequence fragment of the invention may be conventional in the art, and its sequence preferably comprises the sequence shown as SEQ ID NO. 9, or a sequence having more than 80% sequence identity with the sequence shown as SEQ ID NO. 9, for example, the sequence shown as SEQ ID NO. 9.

The sequence of the HBA2 gene of the present invention may be conventional in the art; the sequence preferably comprises a sequence shown as SEQ ID NO. 3, or a sequence having more than 80% sequence identity with a sequence shown as SEQ ID NO. 3, for example, the sequence is shown as SEQ ID NO. 3.

The plasmid vector of the alpha-globin overexpression vector is preferably a Lenti vector, and the sequence of the Lenti vector preferably comprises a sequence shown as SEQ ID NO. 10 or a sequence with more than 80% of sequence identity with the sequence shown as SEQ ID NO. 10, for example, the sequence is shown as SEQ ID NO. 10.

The above-described sequence identity of 80% or more comprises 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity.

The second technical scheme provided by the invention is as follows: a transformant comprising the above-described alpha-globin overexpression vector.

The host cell of the transformant is preferably a erythroid cell.

The erythroid cells are preferably HUDEP2 or CD34 ⁺ Hematopoietic stem cells.

The third technical scheme provided by the invention is as follows: a lentiviral vector system comprising the overexpression vector described above.

The lentiviral vector system preferably further comprises psPAX2 and the pCAG-VSVG plasmid.

The fourth technical scheme provided by the invention is as follows: an application of the overexpression vector in preparing a preparation for treating thalassemia.

The thalassemia is preferably alpha-thalassemia.

The fifth technical scheme provided by the invention is as follows: the use of HS40, alpha-globin promoter, HBA2 gene 3 'sequence fragment, HS4, HS3, HS2, beta-globin promoter or HBB gene 3' sequence fragment as defined in the above technical scheme for the construction of an HBA2 overexpression vector.

The vector is preferably a lentiviral vector.

On the basis of the common knowledge in the field, the above preferred conditions can be combined randomly to obtain the preferred embodiments of the invention.

The reagents and starting materials used in the present invention are commercially available.

The positive progress effects of the invention are as follows:

the alpha-globin overexpression vector constructed by the invention can efficiently transduce the target gene, can stably express the target gene for a long time, and has high infection efficiency and expression stability; the invention can remarkably improve the expression of the alpha-globin gene in a deletion type alpha-thalassemia patient by using the gene therapy mediated by the lentiviral vector, so that the expression quantity of the alpha-globin gene reaches a moderate state, is not too high or too low, provides hope for successfully treating all alpha thalassemia patients, and has important clinical significance. After erythroid cell lines infected by the slow virus of the vector and hematopoietic stem cells induce erythroid differentiation, alpha globin can be over-expressed, so the vector combined with hematopoietic stem cell transplantation is expected to treat various mutation types of alpha thalassemia patients.

Drawings

FIG. 1 is a schematic representation of Lenti-A1(a) and Lenti-A2(b) lentiviral vectors.

FIG. 2 shows that the expression level of alpha-globin is increased after infection of HUDEP2 cells with lentiviral erythroid differentiation by RT-qPCR.

FIG. 3 shows the display of CD34 by RT-qPCR ⁺ After the cells are infected with lentivirus erythroid differentiation, the expression level of alpha-globin is increased.

FIG. 4 shows CD34 depleted of alpha by RT-qPCR showing infection by two lentiviruses Lenti-A1 and Lenti-A2 ⁺ The expression level of alpha-globin in the red blood cells after differentiation can be obviously improved after the hematopoietic stem cells are differentiatedComparison with group, P<0.05; increased α -globin expression following Lenti-A1 and Lenti-A2 lentivirus infection of cells).

FIG. 5 shows CD34 in alpha-poor patients as shown by RT-qPCR ⁺ Increased alpha-globin expression following lentivirus infection of hematopoietic stem cells (, P, compared to control group<0.05; the expression level of alpha-globin is higher after Lenti-A1 and Lenti-A2 lentivirus infect cells respectively).

Detailed Description

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. Experimental methods without specific conditions noted in the following examples, selected according to conventional methods and conditions, or according to commercial instructions; the material reagents, the sources of which are not specified, can be purchased conventionally as commercially available products.

Example 1 construction of an alpha-globin overexpression vector

Lenti-A1 (figure 1-a) is an overexpression vector carrying human alpha-globin gene, mainly comprising DNase I hypersensitive site HS40, human HBA2 gene promoter and gene sequence, about 8kb long, mainly selecting its own promoter and regulatory element, and can specifically express alpha-globin in erythroid cells.

Lenti-A2 (figure 1-b) is another overexpression vector carrying human alpha-globin gene constructed by the invention, mainly comprises human HBA2 gene, human beta-globin gene promoter and mini-LCR consisting of HS2, HS3 and HS4, and has the length of about 10 kb. The expression level of alpha globin in red blood cells is equivalent to that of endogenous alpha globin by connecting LCR consisting of HS 2-HS 4 core sequence with hemoglobin A2(HBA2) globin gene with beta globin promoter. The HBA2 gene itself is not expressed at high levels in cultured erythrocytes, but shows erythrocyte-specific high-level expression when linked to β -LCR.

Wherein the sequences of the elements are respectively shown as SEQ ID NO 1-10.

⁺ Example 2 construction of a Lentiviral vector System and its use in HUDEP2 and CD34 application of hematopoietic stem cells

The packaging method of the lentivirus vector system comprises the following steps: HEK 293T cells were routinely cultured in DMEM high glucose medium containing 10% FBS. 1 day before transfection, cells with good log phase state are taken, 15ml-20ml cell suspension is inoculated in a 15cm dish, and each 15cm dish is 2.1 multiplied by 10 ⁷ A cell. And carrying out transfection experiments when the cell density is 80-90%. The 293T cells were co-transfected with psPAX2, pCAG-VSVG and HBA overexpression vector three plasmids, 20. mu.g of the desired gene plasmid, psPAX 213.3. mu.g, pCAG-VSVG 6.7. mu.g, following the instructions of the PEI transfection reagent.

Complete medium (DMEM with 10% FBS) was replaced after 6 h. Collecting virus liquid after 48h, ultracentrifuging for 2h at the rotating speed of 24000r/min, discarding supernatant after centrifugation, concentrating, then resuspending virus by using 1mL of X-VIVO to obtain virus concentrated solution, and storing at-80 ℃ for later use.

We have conducted experiments to introduce functional α -globin gene into HUDEP-2(Human Umbilical Cord Blood depleted Erythoid Progenitor-2) and CD34 by constructing lentiviral vectors ⁺ In hematopoietic stem cells, driven by cis regulatory elements, high red blood cell-specific expression is produced, thereby producing sufficient hemoglobin, reducing or eliminating the need for transfusion therapy. RT-PCR analysis showed that two lentiviral vectors could be found in HUDEP2 cells (Kurita R, Suda N, Sudo K, Miharada K, Hiroyama T, et al (2013) assessment of immobilized Human Erythroid Progeneator Cell Lines Able to product acquired Red Blood cells PLoS ONE 8(3) e59890.doi:10.1371/journal. point. 0059890) and CD34 ⁺ The expression level of alpha-globin was elevated 18 days after erythroid differentiation in cells (from normal human bone marrow) (FIGS. 2 and 3).

⁺ Example 3 construction of a model of deleted α -thalassemia-depleted CD34 cells and α -globin lentivirus vectors in the model Applications of

Normal humans have 4 alphaglobin genes (α α/α α, 2 α 2 and 2 α 1); deletion mutant α anemias are classified into the following types: deletion of 1 alpha globin gene (-alpha/alpha) is of stationary type; deletion of 2 alpha globin genes (-one)A/α α or- α/- α) is of standard type; deletion of 3 α globin genes (-/-) - α is called hemoglobinopathy H (HbH); the result that 4 alpha globin genes are all deleted (- -/- -) is the Hb Bart's fetal edema syndrome. The deletion of the alphaglobin gene is mainly caused by the deletion of large fragments of DNA, and the deletion ranges from 2.7kb to the whole gene cluster. Experiment by constructing-alpha ^4.2 The alpha-thalassemia deficiency disease model designs sgRNA aiming at an HBA2 gene exon region, and achieves the purpose of deleting DNA fragments by inducing double strand breaks at two ends of the region simultaneously. The RNP formed by the sgRNA and the Cas9 protein is transferred into human CD34+ hematopoietic stem cells through electrotransformation, homozygous cell strains and heterozygous cell strains are constructed, and the expression levels of alpha-globin and beta-globin and the ratio of the alpha-globin and the beta-globin are further tested. The expression level of alpha-globin is detected by RT-qPCR 18 days after in vitro erythroid differentiation, and the result shows that the expression level of alpha-globin is obviously reduced, thereby proving that the construction of a disease model is successful (figure 4). After the disease model is successfully constructed, Lenti-A1 and Lenti-A2 lentivirus vectors are infected, and the expression level of alpha-globin is detected 18 days after in vitro erythroid differentiation. The results show that both lentiviral vectors can significantly increase the expression level of alpha-globin (fig. 4), which indicates that both vectors are expected to be gene therapy vectors for alpha-poor diseases.

SgRNA sequence: GATGGAGAGCGTATGTTAAC are provided. (SEQ ID NO:11)

⁺ Example 4 use of alpha-globin overexpression Lentiviral vectors in HbH patients with poor disease CD34

The HbH disease (transfusion-dependent alpha-thalassemia, genotype- ^SEA /αα ^CS ) CD34 of thalassemia patients ⁺ Hematopoietic stem cells were verified. The HbH patient has CD34 ⁺ Hematopoietic stem cells were obtained by the following method: collecting peripheral blood 10ml of HbH patients with disease and poor place, separating mononuclear cells with Ficoll, and collecting CD34 with CD34 magnetic beads ⁺ Cells, resuspended in culture medium. The results show (fig. 5) that the α -globin level expressed in cells infected with virus is significantly higher than that of uninfected virus. From the research results that have been obtained above, we show that we areThe constructed alpha-globin over-expression vector is packaged into slow virus and then infects erythroid cell line or CD34 ⁺ After hematopoietic stem cells, alpha-globin can be efficiently expressed in erythroid cells induced to differentiate.

Sequence listing

<110> university of east China

Shanghai Bangyao Biological Technology Co.,Ltd.

<120> alpha-globin overexpression vector and application thereof

<130> P20017561C

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 350

<212> DNA

<213> Artificial Sequence

<220>

<223> HS40

<400> 1

cgaccctctg gaacctatca gggaccacag tcagccaggc aagcacatct gcccaagcca 60

agggtggagg catgcagctg tgggggtctg tgaaaacact tgagggagca gataactggg 120

ccaaccatga ctcagtgctt ctggaggcca acaggactgc tgagtcatcc tgtgggggtg 180

gaggtgggac aagggaaagg ggtgaatggt actgctgatt acaacctctg gtgctgcctc 240

cccctcctgt ttatctgaga gggaaggcca tgcccaaagt gttcacagcc aggcttcagg 300

ggcaaagcct gacccagaca gtaaatacgt tcttcatctg gagctgaaga 350

<210> 2

<211> 626

<212> DNA

<213> Artificial Sequence

<220>

<223> alpha-globin promoter

<400> 2

ggtgcctgtc actcaagcac actagtgact atcgccagag ggaaagggag ctgcaggaag 60

cgaggctgga gagcaggagg ggctctgcgc agaaattctt ttgagttcct atgggccagg 120

gcgtccgggt gcgcgcattc ctctccgccc caggattggg cgaagccctc cggctcgcac 180

tcgctcgccc gtgtgttccc cgatcccgct ggagtcgatg cgcgtccagc gcgtgccagg 240

ccggggcggg ggtgcgggct gactttctcc ctcgctaggg acgctccggc gcccgaaagg 300

aaagggtggc gctgcgctcc ggggtgcacg agccgacagc gcccgacccc aacgggccgg 360

ccccgccagc gccgctaccg ccctgccccc gggcgagcgg gatgggcggg agtggagtgg 420

cgggtggagg gtggagacgt cctggccccc gccccgcgtg cacccccagg ggaggccgag 480

cccgccgccc ggccccgcgc aggccccgcc cgggactccc ctgcggtcca ggccgcgccc 540

cgggctccgc gccagccaat gagcgccgcc cggccgggcg tgcccccgcg ccccaagcat 600

aaaccctggc gcgctcgcgg gccggc 626

<210> 3

<211> 835

<212> DNA

<213> Artificial Sequence

<220>

<223> HBA2

<400> 3

actcttctgg tccccacaga ctcagagaga acccaccatg gtgctgtctc ctgccgacaa 60

gaccaacgtc aaggccgcct ggggtaaggt cggcgcgcac gctggcgagt atggtgcgga 120

ggccctggag aggtgaggct ccctcccctg ctccgacccg ggctcctcgc ccgcccggac 180

ccacaggcca ccctcaaccg tcctggcccc ggacccaaac cccacccctc actctgcttc 240

tccccgcagg atgttcctgt ccttccccac caccaagacc tacttcccgc acttcgacct 300

gagccacggc tctgcccagg ttaagggcca cggcaagaag gtggccgacg cgctgaccaa 360

cgccgtggcg cacgtggacg acatgcccaa cgcgctgtcc gccctgagcg acctgcacgc 420

gcacaagctt cgggtggacc cggtcaactt caaggtgagc ggcgggccgg gagcgatctg 480

ggtcgagggg cgagatggcg ccttcctctc agggcagagg atcacgcggg ttgcgggagg 540

tgtagcgcag gcggcggctg cgggcctggg ccgcactgac cctcttctct gcacagctcc 600

taagccactg cctgctggtg accctggccg cccacctccc cgccgagttc acccctgcgg 660

tgcacgcctc cctggacaag ttcctggctt ctgtgagcac cgtgctgacc tccaaatacc 720

gttaagctgg agcctcggta gccgttcctc ctgcccgctg ggcctcccaa cgggccctcc 780

tcccctcctt gcaccggccc ttcctggtct ttgaataaag tctgagtggg cagca 835

<210> 4

<211> 477

<212> DNA

<213> Artificial Sequence

<220>

<223> 3' sequence of HBA2 Gene

<400> 4

gcctgtgtgt gcctgggttc tctctatccc ggaatgtgcc aacaatggag gtgtttacct 60

gtctcagacc aaggacctct ctgcagctgc atggggctgg ggagggagaa ctgcagggag 120

tatgggaggg gaagctgagg tgggcctgct caagagaagg tgctgaacca tcccctgtcc 180

tgagaggtgc caggcctgca ggcagtggct cagaagctgg ggaggagaga ggcatccagg 240

gttctactca gggagtccca gcatcgccac cctcctttga aatctccctg gttgaaccca 300

gttaacatac gctctccatc aaaacaaaac gaaacaaaac aaactagcaa aataggctgt 360

ccccagtgca agtgcaggtg ccagaacatt tctctcattc ccaccccttc ctgccagagg 420

gtaggtggct ggagtgaggg tgctggccct actcacactt cctgtgtcac ggtgacc 477

<210> 5

<211> 1157

<212> DNA

<213> Artificial Sequence

<220>

<223> HS4

<400> 5

actagtgcat gcaaatctga cactcagtgg gcctgggtga aggtgagaat tttattgctg 60

aatgagagcc tctggggaca tcttgccagt caatgagtct caggttcaat ttccttctca 120

gtcttggagt aacagaagct catgcattta ataaacggaa attttgtatt gaaatgagag 180

ccattggaaa tcatttactc cagactccta cttataaaaa gagaaactga ggctcagaga 240

agggtgggga ctttctcagt atgacatgga aatgatcagg cttggattca aagctcctga 300

ctttctgtct agtgtatgtg cagtgagccc cttttcctct aactgaaaga aggaaaaaaa 360

aatggaaccc aaaatattct acatagtttc catgtcacag ccagggctgg gcagtctcct 420

gttatttctt ttaaaataaa tatatcattt aaatgcataa ataagcaaac cctgctcggg 480

aatgggaggg agagtctctg gagtccaccc cttctcggcc ctggctctgc agatagtgct 540

atcaaagccc tgacagagcc ctgcccattg ctgggccttg gagtgagtca gcctagtaga 600

gaggcagggc aagccatctc atagctgctg agtgggagag agaaaagggc tcattgtcta 660

taaactcagg tcatggctat tcttattctc acactaagaa aaagaatgag atgtctacat 720

ataccctgcg tcccctcttg tgtactgggg tccccaagag ctctctaaaa gtgatggcaa 780

agtcattgcg ctagatgcca tcccatctat tataaacctg catttgtctc cacacaccag 840

tcatggacaa taaccctcct cccaggtcca cgtgcttgtc tttgtataat actcaagtaa 900

tttcggaaaa tgtattcttt caatcttgtt ctgttattcc tgtttcaatg gcttagtaga 960

aaaagtacat acttgttttc ccataaattg acaatagaca atttcacatc aatgtctata 1020

tgggtcgttg tgtttgctgt gtttgcaaaa actcacaata actttatatt gttactactc 1080

taagaaagtt acaacatggt gaatacaaga gaaagctatt acaagtccag aaaataaaag 1140

ttatcatctt gaggcct 1157

<210> 6

<211> 846

<212> DNA

<213> Artificial Sequence

<220>

<223> HS3

<400> 6

ctggttagaa ggttctactg gaggagggtc ccagcccatt gctaaattaa catcaggctc 60

tgagactggc agtatatctc taacagtggt tgatgctatc ttctggaact tgcctgctac 120

attgagacca ctgacccata cataggaagc ccatagctct gtcctgaact gttaggccac 180

tggtccagag agtgtgcatc tcctttgatc ctcataataa ccctatgaga tagacacaat 240

tattactctt actttataga tgatgatcct gaaaacatag gagtcaaggc acttgcccct 300

agctgggggt ataggggagc agtcccatgt agtagtagaa tgaaaaatgc tgctatgctg 360

tgcctccccc acctttccca tgtctgccct ctactcatgg tctatctctc ctggctcctg 420

ggagtcatgg actccaccca gcaccaccaa cctgacctaa ccacctatct gagcctgcca 480

gcctataacc catctgggcc ctgatagctg gtggccagcc ctgaccccac cccaccctcc 540

ctggaacctc tgatagacac atctggcaca ccagctcgca aagtcaccgt gagggtcttg 600

tgtttgctga gtcaaaattc cttgaaatcc aagtccttag agactcctgc tcccaaattt 660

acagtcatag acttcttcat ggctgtctcc tttatccaca gaatgattcc tttgcttcat 720

tgccccatcc atctgatcct cctcatcagt gcagcacagg gcccatgagc agtagctgca 780

gagtctcaca taggtctggc actgcctctg acatgtccga ccttaggcaa atgcttgact 840

cttctg 846

<210> 7

<211> 693

<212> DNA

<213> Artificial Sequence

<220>

<223> HS2

<400> 7

aggccttttg ccacctagct gtccaggggt gccttaaaat ggcaaacaag gtttgttttc 60

ttttcctgtt ttcatgcctt cctcttccat atccttgttt catattaata catgtgtata 120

gatcctaaaa atctatacac atgtattaat aaagcctgat tctgccgctt ctaggtatag 180

aggccacctg caagataaat atttgattca caataactaa tcattctatg gcaattgata 240

acaacaaata tatatatata tatatatata cgtatatgtg tatatatata tatatattca 300

ggaaataata tattctagaa tatgtcacat tctgtctcag gcatccattt tctttatgat 360

gccgtttgag gtggagtttt agtcaggtgg tcagcttctc cttttttttg ccatctgccc 420

tgtaagcatc ctgctgggga cccagatagg agtcatcact ctaggctgag aacatctggg 480

cacacaccct aagcctcagc atgactcatc atgactcagc attgctgtgc ttgagccaga 540

aggtttgctt agaaggttac acagaaccag aaggcggggg tggggcactg accccgacag 600

gggcctggcc agaactgctc atgcttggac tatgggaggt cactaatgga gacacacaga 660

aatgtaacag gaactaagga aaaactgaag ctt 693

<210> 8

<211> 265

<212> DNA

<213> Artificial Sequence

<220>

<223> beta-globin promoter

<400> 8

gtaaatacac ttgcaaagga ggatgttttt agtagcaatt tgtactgatg gtatggggcc 60

aagagatata tcttagaggg agggctgagg gtttgaagtc caactcctaa gccagtgcca 120

gaagagccaa ggacaggtac ggctgtcatc acttagacct caccctgtgg agccacaccc 180

tagggttggc caatctactc ccaggagcag ggagggcagg agccagggct gggcataaaa 240

gtcagggcag agccatctat tgctt 265

<210> 9

<211> 1090

<212> DNA

<213> Artificial Sequence

<220>

<223> 3' sequence of HBB Gene

<400> 9

tgatgtattt aaattatttc tgaatatttt actaaaaagg gaatgtggga ggtcagtgca 60

tttaaaacat aaagaaatga agagctagtt caaaccttgg gaaaatacac tatatcttaa 120

actccatgaa agaaggtgag gctgcaaaca gctaatgcac attggcaaca gcccctgatg 180

catatgcctt attcatccct cagaaaagga ttcaagtaga ggcttgattt ggaggttaaa 240

gttttgctat gctgtatttt acattactta ttgttttagc tgtcctcatg aatgtctttt 300

cactacccat ttgcttatcc tgcatctctc agccttgact ccactcagtt ctcttgctta 360

gagataccac ctttcccctg aagtgttcct tccatgtttt acggcgagat ggtttctcct 420

cgcctggcca ctcagcctta gttgtctctg ttgtcttata gaggtctact tgaagaagga 480

aaaacagggg tcatggtttg actgtcctgt gagcccttct tccctgcctc ccccactcac 540

agtgacccgg aatctgcagt gctagtctcc cggaactatc actctttcac agtctgcttt 600

ggaaggactg ggcttagtat gaaaagttag gactgagaag aatttgaaag gcggcttttt 660

gtagcttgat attcactact gtcttattac cctgtcatag gcccacccca aatggaagtc 720

ccattcttcc tcaggatgtt taagattagc attcaggaag agatcagagg tctgctggct 780

cccttatcat gtcccttatg gtgcttctgg ctctgcagtt attagcatag tgttaccatc 840

aaccacctta acttcatttt tcttattcaa tacctaggta ggtagatgct agattctgga 900

aataaaatat gagtctcaag tggtccttgt cctctctccc agtcaaattc tgaatctagt 960

tggcaagatt ctgaaatcaa ggcatataat cagtaataag tgatgataga agggtatata 1020

gaagaatttt attatatgag agggtgaaac cctcaaaatg aaatgaaatc agacccttgt 1080

cttacaccat 1090

<210> 10

<211> 5910

<212> DNA

<213> Artificial Sequence

<220>

<223> Lenti vector

<400> 10

ctggaattcg agctcggtac ctttaagacc aatgacttac aaggcagctg tagatcttag 60

ccacttttta aaagaaaagg ggggactgga agggctaatt cactcccaac gaagacaaga 120

tctgcttttt gcttgtactg ggtctctctg gttagaccag atctgagcct gggagctctc 180

tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt 240

agtgtgtgcc cgtctgttgt gtgactctgg taactagaga tccctcagac ccttttagtc 300

agtgtggaaa atctctagca gtagtagttc atgtcatctt attattcagt atttataact 360

tgcaaagaaa tgaatatcag agagtgagag gaacttgttt attgcagctt ataatggtta 420

caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag 480

ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggctctagc tatcccgccc 540

ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc 600

tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag 660

aagtagtgag gaggcttttt tggaggccta gggacgtacc caattcgccc tatagtgagt 720

cgtattacgc gcgctcactg gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg 780

ttacccaact taatcgcctt gcagcacatc cccctttcgc cagctggcgt aatagcgaag 840

aggcccgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa tgggacgcgc 900

cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg accgctacac 960

ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc gccacgttcg 1020

ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga tttagtgctt 1080

tacggcacct cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt gggccatcgc 1140

cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat agtggactct 1200

tgttccaaac tggaacaaca ctcaacccta tctcggtcta ttcttttgat ttataaggga 1260

ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga 1320

attttaacaa aatattaacg cttacaattt aggtggcact tttcggggaa atgtgcgcgg 1380

aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata 1440

accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg 1500

tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac 1560

gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact 1620

ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat 1680

gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga 1740

gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact caccagtcac 1800

agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat 1860

gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac 1920

cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct 1980

gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac 2040

gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac aattaataga 2100

ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg 2160

gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact 2220

ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac 2280

tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta agcattggta 2340

actgtcagac caagtttact catatatact ttagattgat ttaaaacttc atttttaatt 2400

taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga 2460

gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc 2520

tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt 2580

ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc 2640

gcagatacca aatactgttc ttctagtgta gccgtagtta ggccaccact tcaagaactc 2700

tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg 2760

cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg 2820

gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga 2880

actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc 2940

ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg 3000

gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg 3060

atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt 3120

tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc 3180

tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc gccgcagccg 3240

aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc 3300

gcctctcccc gcgcgttggc cgattcatta atgcagctgg cacgacaggt ttcccgactg 3360

gaaagcgggc agtgagcgca acgcaattaa tgtgagttag ctcactcatt aggcacccca 3420

ggctttacac tttatgcttc cggctcgtat gttgtgtgga attgtgagcg gataacaatt 3480

tcacacagga aacagctatg accatgatta cgccaagcgc gcaattaacc ctcactaaag 3540

ggaacaaaag ctggagctgc aagcttaatg tagtcttatg caatactctt gtagtcttgc 3600

aacatggtaa cgatgagtta gcaacatgcc ttacaaggag agaaaaagca ccgtgcatgc 3660

cgattggtgg aagtaaggtg gtacgatcgt gccttattag gaaggcaaca gacgggtctg 3720

acatggattg gacgaaccac tgaattgccg cattgcagag atattgtatt taagtgccta 3780

gctcgataca taaacgggtc tctctggtta gaccagatct gagcctggga gctctctggc 3840

taactaggga acccactgct taagcctcaa taaagcttgc cttgagtgct tcaagtagtg 3900

tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc tcagaccctt ttagtcagtg 3960

tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa agcgaaaggg aaaccagagg 4020

agctctctcg acgcaggact cggcttgctg aagcgcgcac ggcaagaggc gaggggcggc 4080

gactggtgag tacgccaaaa attttgacta gcggaggcta gaaggagaga gatgggtgcg 4140

agagcgtcag tattaagcgg gggagaatta gatcgcgatg ggaaaaaatt cggttaaggc 4200

cagggggaaa gaaaaaatat aaattaaaac atatagtatg ggcaagcagg gagctagaac 4260

gattcgcagt taatcctggc ctgttagaaa catcagaagg ctgtagacaa atactgggac 4320

agctacaacc atcccttcag acaggatcag aagaacttag atcattatat aatacagtag 4380

caaccctcta ttgtgtgcat caaaggatag agataaaaga caccaaggaa gctttagaca 4440

agatagagga agagcaaaac aaaagtaaga ccaccgcaca gcaagcggcc gctgatcttc 4500

agacctggag gaggagatat gagggacaat tggagaagtg aattatataa atataaagta 4560

gtaaaaattg aaccattagg agtagcaccc accaaggcaa agagaagagt ggtgcagaga 4620

gaaaaaagag cagtgggaat aggagctttg ttccttgggt tcttgggagc agcaggaagc 4680

actatgggcg cagcgtcaat gacgctgacg gtacaggcca gacaattatt gtctggtata 4740

gtgcagcagc agaacaattt gctgagggct attgaggcgc aacagcatct gttgcaactc 4800

acagtctggg gcatcaagca gctccaggca agaatcctgg ctgtggaaag atacctaaag 4860

gatcaacagc tcctggggat ttggggttgc tctggaaaac tcatttgcac cactgctgtg 4920

ccttggaatg ctagttggag taataaatct ctggaacaga tttggaatca cacgacctgg 4980

atggagtggg acagagaaat taacaattac acaagcttaa tacactcctt aattgaagaa 5040

tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg aattagataa atgggcaagt 5100

ttgtggaatt ggtttaacat aacaaattgg ctgtggtata taaaattatt cataatgata 5160

gtaggaggct tggtaggttt aagaatagtt tttgctgtac tttctatagt gaatagagtt 5220

aggcagggat attcaccatt atcgtttcag acccacctcc caaccccgag gggacccgac 5280

aggcccgaag gaatagaaga agaaggtgga gagagagaca gagacagatc cattcgatta 5340

gtgaacggat ctcgacggta tcgattagac tgtagcccag gaatatggca gctagattgt 5400

acacatttag aaggaaaagt tatcttggta gcagttcatg tagccagtgg atatatagaa 5460

gcagaagtaa ttccagcaga gacagggcaa gaaacagcat acttcctctt aaaattagca 5520

ggaagatggc cagtaaaaac agtacataca gacaatggca gcaatttcac cagtactaca 5580

gttaaggccg cctgttggtg ggcggggatc aagcaggaat ttggcattcc ctacaatccc 5640

caaagtcaag gagtaataga atctatgaat aaagaattaa agaaaattat aggacaggta 5700

agagatcagg ctgaacatct taagacagca gtacaaatgg cagtattcat ccacaatttt 5760

aaaagaaaag gggggattgg ggggtacagt gcaggggaaa gaatagtaga cataatagca 5820

acagacatac aaactaaaga attacaaaaa caaattacaa aaattcaaaa ttttcgggtt 5880

tattacaggg acagcagaga tccagtttgg 5910

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> SgRNA sequence

<400> 11

gatggagagc gtatgttaac 20

Claims

1. An alpha-globin overexpression vector comprising, in order: (1) a locus control region, an alpha-globin promoter, an HBA2 gene and an HBA2 gene 3' sequence fragment, wherein the locus control region is HS 40;

or (2) locus control regions HS4, HS3 and HS2, the β -globin promoter, the HBA2 gene and the 3' sequence fragment of the HBB gene.

2. The α -globin overexpression vector according to claim 1, comprising in sequence the cis-acting element consisting of the locus control region HS40 and the α -globin promoter, the HBA2 gene and the 3' sequence fragment of the HBA2 gene.

3. The α -globin overexpression vector according to claim 1 or 2, wherein said α -globin promoter is the HBA2 promoter; preferably, the alpha-globin promoter comprises the sequence shown in SEQ ID NO. 2;

and/or the locus control region HS40 comprises a sequence shown as SEQ ID NO. 1;

and/or the 3' sequence fragment of the HBA2 gene comprises a sequence shown as SEQ ID NO. 4.

4. The α -globin overexpression vector according to claim 1, wherein said β -globin promoter is HBB promoter; preferably, the beta-globin promoter comprises a sequence shown as SEQ ID NO. 8;

and/or the locus control region HS4 comprises a sequence shown as SEQ ID NO. 5, the locus control region HS3 comprises a sequence shown as SEQ ID NO. 6, and the locus control region HS2 comprises a sequence shown as SEQ ID NO. 7;

and/or the HBB gene 3' sequence fragment comprises a sequence shown as SEQ ID NO. 9.

5. The alpha-globin overexpression vector according to any one of claims 1 to 4, wherein said HBA2 gene comprises the sequence shown in SEQ ID NO. 3.

6. The α -globin overexpression vector according to any one of claims 1 to 5, wherein the plasmid vector is a Lenti vector;

preferably, the Lenti vector comprises a sequence shown as SEQ ID NO. 10.

7. A transformant comprising the α -globin overexpression vector of any one of claims 1 to 6;

preferably, the host cell of the transformant is a erythroid cell;

more preferably, the host cell of the transformant is HUDEP2 or CD34 ⁺ Hematopoietic stem cells.

8. A lentiviral vector system comprising the alpha-globin overexpression vector of any one of claims 1 to 6;

preferably, the lentiviral vector system further comprises psPAX2 and a pCAG-VSVG plasmid.

9. Use of an alpha-globin overexpression vector as defined in any one of claims 1 to 6 for the preparation of a formulation for the treatment of thalassemia; preferably, the thalassemia is alpha-thalassemia.

10. Use of HS40, the α -globin promoter or the HBA2 gene 3 'sequence fragment as defined in any one of claims 1 to 3, of HS4, HS3, HS2, the β -globin promoter or the HBB gene 3' sequence fragment as defined in claim 1 or 4 in the construction of an HBA2 overexpression vector;

preferably, the vector is a lentiviral vector.