CN115125256B - Submarine metal detection element, electrochemical detection sensor constructed by same and application of electrochemical detection sensor - Google Patents
Submarine metal detection element, electrochemical detection sensor constructed by same and application of electrochemical detection sensor Download PDFInfo
- Publication number
- CN115125256B CN115125256B CN202210643359.5A CN202210643359A CN115125256B CN 115125256 B CN115125256 B CN 115125256B CN 202210643359 A CN202210643359 A CN 202210643359A CN 115125256 B CN115125256 B CN 115125256B
- Authority
- CN
- China
- Prior art keywords
- submarine
- metal
- electrochemical
- detection element
- ions
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/21—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Electrochemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a submarine metal detection element, an electrochemical detection sensor constructed by the submarine metal detection element and application of the submarine metal detection element. The nucleotide sequence of the submarine metal detection element is shown as SEQ ID NO.2 or SEQ ID NO.3, and the submarine metal detection element has the effect of remarkably improving the release of metal Ni 2+ Ability to detect sensitivity of ions. The invention also utilizes a core gene cluster (ribADEH-C) transcribed by a submarine metal detection element to express riboflavin synthesis, improves the extracellular electron transfer efficiency mediated by an electron transfer medium through the increase of flavin synthesis, and realizes the induction of metal Ni by engineering bacteria 2+ Output of electrochemical signals after ions constructs a metal Ni 2+ The microbial electrochemical detection sensor for the ions provides a new thought and strategy for screening high-efficiency inducible promoters and detection modes.
Description
Technical Field
The invention belongs to the technical fields of molecular biology and microbial sensing, and particularly relates to a submarine metal detection element, an electrochemical detection sensor constructed by the submarine metal detection element and application of the electrochemical detection sensor.
Background
The submarine is an important component of modern navy, has the characteristics of high concealment and strong striking power, and is a very threatening ocean war weapon. Therefore, the method realizes the efficient and accurate detection of the movable submarines around the coastline of China, and has important strategic significance for the security of the ocean national defense of China. Current submarine detectionThe detection method mainly comprises sonar detection and non-sounding detection. However, conventional probing methods have certain limitations, such as easy exposure, large interference, etc. In recent years, with the rapid development of modern microbiology and molecular biology technologies, microbial-based biosensor technologies have received a great deal of attention. Therefore, the development of the microorganism sensor based on the detection of the metal ions released by the submarine warship body and the circulating water pipeline has important prospect. Through analysis of the submarine alloy composition and metal ions in seawater, the submarine alloy contains metal nickel, while the seawater contains almost no metal element, so that the metal Ni 2+ Can be used as inducer of the biosensor of submarine metal ions. Currently, the main challenge in developing biosensors for detecting submarine metal ions is to achieve high sensitivity and high selectivity specificity.
Pseudomonas putida (Pseudomonas putida) is a gram-negative bacillus that is widely distributed in nature and often has different metabolic patterns in different environments. The strain has been reported to have a certain tolerance to various metals, and can play a certain role in the environmental remediation of heavy metal pollution. This means that the genome of the strain contains a promoter element or the like which is involved in efficiently inducing metal ions. Response submarine metal Ni based on this 2+ No screening of promoter elements has been reported. Meanwhile, shewanella is used as an important electrochemical application mode strain, and the synthesis of riboflavin and flavine adenine dinucleotide can be increased by inducing a metal ion promoter element to express a riboflavin synthesis gene cluster, so that the formation of a biomembrane on the surface of an electrode can be promoted while the extracellular electron transfer efficiency of an electron transfer medium is improved, and the extracellular electron transfer efficiency is indirectly improved. Therefore, the invention responds to submarine metal Ni by constructing a Pseudomonas putida promoter library screening method 2+ Promoter element screening of (2) and implementation of submarine metal Ni by constructing Shewanella electrochemical detection sensor 2+ And (3) detecting ions.
Disclosure of Invention
The invention aims to provide a submarine metal detection element and an electric built by the submarine metal detection elementChemical detection sensors and applications. The invention screens out high-efficiency induction metal Ni by a method for constructing a pseudomonas putida promoter library 2+ The submarine metal detection element is transcribed to express a core gene cluster (ribADEH-C) synthesized by riboflavin, so that the extracellular electron transfer efficiency mediated by an electron transfer medium is improved, and the Shewanella engineering bacteria induction metal Ni is realized 2+ Output of electrochemical signals after ions constructs a metal Ni 2+ An ion microbial electrochemical detection sensor.
In order to achieve the aim of the invention, the invention is realized by adopting the following technical scheme:
the invention provides a submarine metal detection element, wherein the nucleotide sequence of the submarine metal detection element is shown as SEQ ID NO.2 or SEQ ID NO. 3.
Further, the submarine metal detection element is derived from pseudomonas putida and is obtained by screening a pseudomonas putida promoter library.
Further, the nucleotide sequence screened by using the promoter library is shown as a submarine metal detection element P shown as SEQ ID NO.2 1-10 Can respond to metal Ni with high sensitivity 2+ Ions.
Further, by said submarine metal detector element P 1-10 After directed evolution optimization, the obtained element P with the nucleotide sequence shown as SEQ ID NO.3 1-10-1 For submarine metal Ni 2+ The response sensitivity of the ions is significantly improved.
The invention also provides an electrochemical detection sensor containing the submarine metal detection element, and the electrochemical detection sensor simultaneously comprises the submarine metal detection element and a riboflavin synthesis core gene cluster fragment.
Further, the riboflavin synthesis core gene cluster fragment is a ribADEH gene fragment with a nucleotide sequence shown as SEQ ID NO.4 and a ribC gene fragment with a nucleotide sequence shown as SEQ ID NO. 5.
The invention also provides a preparation method of the electrochemical detection sensor, which comprises the following steps:
(1) Carrying out incomplete digestion on the extracted pseudomonas putida genome DNA, and recovering to obtain a genome digestion product to obtain a promoter library;
(2) After the promoter library in the step (1) is connected and transformed with a fluorescent reporter gene, verification screening is carried out, and the obtained recombinant strain is coated on a fluorescent reporter gene containing Ni with a certain concentration 2+ On LB solid plate, firstly, using plate fluorescence observation method to make preliminary screening, then using micro-pore plate enzyme-labeled instrument fluorescence photometry to make secondary screening to obtain the strain with obvious fluorescence signal, the promoter carried by said strain is response Ni 2+ Is a submarine metal detection element;
(3) Response Ni 2+ Performing directed evolution by utilizing error-prone PCR (polymerase chain reaction) on the ion submarine metal detection element, and performing primary screening and enzyme-labeled instrument re-screening on a plurality of obtained single colonies by using a flat plate fluorescent observation method respectively, so as to obtain the submarine metal detection element with stronger detection effect;
(4) Connecting the submarine metal detection element in the step (3) with a core gene cluster (ribADEH-C) synthesized by flavin, and cloning to an expression vector pYYDT to obtain a recombinant expression plasmid pYDT-P-ribADEH-ribC-P;
(5) And (3) conjugating and transferring the recombinant expression plasmid pYYDT-P-ribADEH-ribC-P in the step (4) to Shewanella to obtain recombinant engineering bacteria Sone (pYDT-P-ribADEH-ribC-P), namely the electrochemical detection sensor.
Furthermore, the fluorescent reporter gene is green fluorescent protein gene eGFP, and the nucleotide sequence of the fluorescent reporter gene is shown as SEQ ID NO. 1.
The invention also provides application of the submarine metal detection element in preparing an expression cassette, a kit or a preparation for detecting submarine metal ions.
Further, the concentration of the submarine metal ions is detected to be not lower than 0.1 mu mol/L.
The invention also provides an application of the submarine metal detection element or the electrochemical detection sensor in preparing an electrochemical device for detecting submarines in real time.
Furthermore, the electrochemical device is formed by using carbon felt, ag/AgCl correction electrodes and engineering bacteria or electrochemical detection sensors containing submarine metal detection elements.
Further, the electrochemical device detects metallic Ni released by the submarine 2+ When ions are generated, the electrochemical signal output of the ions is obviously improved; when the submarine leaves, the electrochemical signal output of the electrochemical device can be restored to a stable state.
Compared with the prior art, the invention has the following advantages and beneficial effects:
the invention utilizes pseudomonas putida genome to construct a promoter library, screens induction metal Ni 2+ And further improves the detection sensitivity by directed evolution, the promoter element P obtained 1-10-1 Has the remarkable improvement of metal Ni 2+ The detection sensitivity capability, the screening method is simple, the use is convenient, and the safety is high. The method of the invention overturns the traditional detection technology, and can purposefully and selectively screen the resposable submarine metal Ni from pseudomonas putida genome by constructing a promoter library and combining with an error-prone PCR directed evolution method 2+ An ion-sensitive promoter element.
The invention further connects the promoter element with the flavine synthesis gene cluster and then expresses the gene cluster in the electrochemical mode bacteria Shewanella, thereby realizing the improvement of the extracellular electronic transfer efficiency mediated by the electronic transfer medium, realizing the improvement of the output of the microorganism electrochemical signal through the electrochemical device, providing a new thought and strategy for screening the high-efficiency inducible promoter and the detection mode, and the screened promoter element can be used for the microorganism electrochemical sensing detection of submarines, can also be used for the detection of environmental pollutants in an ecological system, and has important significance for military, anti-terrorism, environmental protection and the like.
Drawings
FIG. 1 shows the results of initial screening of promoter library by plate observation.
FIG. 2 shows the detection result of the enzyme-labeled instrument.
FIG. 3 is an optimized P 1-10-1 Promoter plate observations were used to prime the results.
FIG. 4 is an optimized P 1-10-1 And (5) detecting a result by a promoter enzyme label instrument.
FIG. 5 is a schematic illustration of an electrochemical device of the Shewanella three-electrode system constructed.
FIG. 6 shows the presence or absence of metal Ni sensed by engineering bacterium Sone (pYDT-P-ribADEH-ribC-P) 2+ And outputting a graph by electrochemical signals after ions.
Detailed Description
The technical scheme of the invention is further described in detail below with reference to specific embodiments.
Example 1: high-efficiency induction metal Ni 2+ Screening and directed evolution of promoter elements for ions
(1) The extracted pseudomonas putida genome DNA is subjected to incomplete digestion by Sau3AI enzyme, and is connected with pUC19-eGFP plasmid digested by restriction enzyme BimH I to transform E.coli DH5 alpha competence, and the competence is coated on an LB solid plate containing 100mg/L ampicillin, so as to construct a promoter library containing recombinant plasmid pUC 19-P-eGFP.
(2) The single colony is subjected to film transfer, colonies with stronger fluorescence are observed under ultraviolet light, primary screening of the induction promoter is carried out, 14 strains with fluorescence difference are screened out at the same time, and partial results are shown in figure 1; further using enzyme-labeled instrument to perform fluorescence detection and re-screening on 14 strains, and finding that strain numbers 1-10 are compared with the strain without Ni 2+ At the time of Ni 2+ The fluorescence value is obviously enhanced in the presence condition, the result is shown in figure 2, and the nucleotide sequence of the promoter carried by the strain is shown in SEQ ID NO. 2.
(3) Amplification of P using error-prone PCR 1-10 After the promoter fragment is connected with eGFP screening carrier for conversion, the promoter fragment is respectively subjected to preliminary screening by a plate observation method and re-screening by an enzyme-labeled instrument, as shown in figure 3, so that P with better induction effect is obtained 1-10-1 The detection result of the promoter and the enzyme label instrument is shown in figure 4, the nucleotide sequence is shown in SEQ ID NO.3, and the promoter responds to metal Ni 2+ The fluorescence intensity of the fluorescent light is obviously enhanced, and when the minimum concentration of the fluorescent light is detected to be 0.1 mu mol/L, a more obvious fluorescent signal is also generated, and compared with a promoter before the undirected evolution, the detection limit is obviously improved.
Example 2: construction of engineering bacterium Sone (pYDT-P-ribADEH-ribC-P)
(1) Respectively amplifying by PCR with Bacillus subtilis genome as template to obtain ribADEH gene operon fragment (shown as SEQ ID NO. 4) and ribC fragment (shown as SEQ ID NO. 5), verifying and recovering, and respectively mixing with P 1-10-1 The promoter is fused by overlap PCR, and P is obtained after overlap PCR fusion again 1-10-1 -ribADEH-ribC-P 1-10-1 Fragments.
(1) With P 1-10-1 The promoter was used as a template, and P was obtained by amplification using primers F1 (TCGCTAAGGATGATTTCTGTGGTACTGGTCGCCAACCTGGCGTTTCTCA) and R1 (ACTCTTCCATGGGTATACAACCACACATTCAACA) 1-10-1 -1 fragment;
(2) with P 1-10-1 The promoter was used as a template, and P was obtained by amplification using primers F2 (ATCGTCTTCACGGGTATACAACCACACATTCAACA) and R2 (CTAGCTCCCCGGGATCCGAGGTACTGGTCGCCAACCTGGCGTTTCTCA) 1-10-1 -2 fragment;
(3) amplifying to obtain the ribADEH-1 gene operon fragment by using Bacillus subtilis genome as a template and using primers F11 (GTTGTATACCCATGGAAGAGTATTATATGAAGCTG) and R11 (TGCGGAAATAATTATTCAAATGAGCGGTTTAAAT);
(4) using Bacillus subtilis genome as template, using primers F22 (CATTTGAATAATTATTTCCGCAAATTGCTGAAATA) and R22 (GTTGTAIACCCGTGAAGACGAIACATATTACACAT), amplifying to obtain ribC-2 fragment;
(5) with P 1-10-1 Fragment-1 and the ribADEH-1 gene operon fragment were used as templates, and P was obtained by PCR fusion and amplification using primers F1 (TCGCTAAGGATGATTTCTGTGGTACTGGTCGCCAACCTGGCGTTTCTCA) and R11 (TGCGGAAATAATTATTCAAATGAGCGGTTTAAAT) 1-10-1 -a ribADEH fragment;
(6) with P 1-10-1 The-2 fragment and the ribC-2 fragment were used as templates, and P was obtained by PCR fusion and post-amplification using primers F22 (CATTTGAATAATTATTTCCGCAAATTGCTGAAATA) and R2 (CTAGCTCCCCGGGATCCGAGGTACTGGTCGCCAACCTGGCGTTTCTCA) 1-10-1 -an ribC-2 fragment;
(7) with P 1-10-1 RibADEH fragment and P 1-10-1 The rib C-2 fragment was used as template, using primers F1 (TCGCTAAGGATGATTTCTGTGGTACTGGTCGCCAACCTGGCGTTTCTCA) and R2 (CTAGCTCCCCGGGATCCGAGGTACTGGTCGCCAACCTGGCGTTTCTCA) overlap PCR fusion to obtain P 1-10-1 -ribADEH-ribC-P 1-10-1 Fragments.
(2) P Using seamless cloning techniques 1-10-1 -ribADEH-ribC-P 1-10-1 The fragments were subjected to in-fusion with the linearized pYYDT plasmid fragment and the fusion system was transformed into E.coli wM3064 competent cells.
(3) Colony PCR verification is carried out, and E.coli WM3064/pYYDT-P-ribADEH-ribC-P strain with correct connection is obtained by further sequencing.
(4) The plasmid pYDT-P-ribADEH-ribC-P was transferred into Shewanella by conjugation, as detailed below:
(1) the strain E.coli WM3064/pYYDT-P-ribADEH-ribC-P was transferred to LB liquid medium of the corresponding resistance and activated overnight.
(2) Shewanella was transferred to a non-resistant LB liquid medium and activated overnight.
(3) E.coli WM3064/pYYDT-P-ribADEH-ribC-P strain and Shewanella were re-inoculated, respectively, the following day and cultured to mid-log phase, respectively.
(4) After the two bacterial solutions are uniformly mixed according to the proportion of 1:1, the bacterial solution is collected by centrifugation, and the supernatant is completely removed.
(5) The pellet was resuspended by addition of LB liquid medium and then placed in an incubator for 2h incubation.
(6) After the mixed bacterial liquid after incubation is gently flushed and mixed by a pipettor, the mixed bacterial liquid is coated on an antibiotic screening plate and is placed in an incubator for overnight culture.
(7) After single bacterial colonies with proper quantity and size are grown, single bacterial colonies are picked in an ultra-clean bench, colony PCR verification is carried out, and engineering bacteria Sone (pYDT-P-ribADEH-ribC-P) is obtained after further sequencing.
Example 3: construction of engineering bacterium Sone (pYDT-P-ribADEH-ribC-P) three-electrode system chemical device (FIG. 5)
(1) Preparing a carbon felt with the length of 3cm multiplied by 4cm and a carbon felt with the length of 3cm multiplied by 3cm and an Ag/AgCl correction electrode as a counter electrode, a working electrode and a reference electrode respectively; preparing 20mM sodium bicarbonate solution as electron acceptor; preparing saturated KCl agar as a salt bridge; sterilized 50mL centrifuge tubes and medium without electron donor were prepared.
(2) Heating in a 100mL agar microwave oven, rapidly adding 30g KCl, stirring, sucking saturated KCl agar with a rubber head dropper before solidification, adding saturated KCl solution at the upper part of the dropper after solidification, and connecting with a reference electrode;
(3) Washing the carbon felt with ultrapure water, soaking the carbon felt in acetone, performing ultrasonic treatment for 30min, repeating the steps for two times, and soaking for 24h; soaking the raw materials in 1mol/L HCl for 30min, repeating the steps for two times, and then soaking the raw materials for 24h; finally, ultra-pure water is used for ultrasonic treatment for 30min, the process is repeated for two times, after soaking for 24h, the product is cleaned by ultra-pure water, and the product is placed in an oven for drying.
(4) And introducing the prepared carbon felt electrode into a 100mL blue cap bottle reactor by using a titanium wire, wherein the working electrode is fully covered by the counter electrode so as to ensure that the working electrode is fully utilized and unique variability.
(5) Culturing engineering bacteria Sone (pYDT-P-ribADEH-ribC-P) to be transferred to mid-log phase, centrifuging at 5000 Xg for 5min to collect bacterial cells, washing and resuspension by using a culture medium without adding electron donor, adding 50mL of bacterial liquid into a 50mL serum bottle culture medium without electron donor, and completing construction of the three-electrode system electrochemical device of the engineering bacteria.
Example 4: engineering bacteria sensing presence or absence of metal Ni 2+ Detection and signal output of post-ion electrochemical device
(1) In the three-electrode system, green is connected with a working electrode, red is connected with a counter electrode, and white is a reference electrode.
(2) Parameter setting: sample Interval (sec) is 60s; sampling Time is 1e+007; quiet Time (sec) is 1000s; scales during Run is 1; the Sensitivity (A/V) is 1e-003.
(3) The device is respectively provided with metal-free Ni 2+ Ion and 0.1. Mu. Mol/L metallic Ni 2+ After the electrochemical device was started, the i-t curve was recorded.
As shown in FIG. 6, ni is free of metal 2+ The highest current density recorded by the electrochemical device was about 13. Mu.A/cm when the ions were present 2 And 0.1. Mu. Mol/L metallic Ni 2+ After ion response, the highest current density reaches approximately 30. Mu.A/cm 2 Indicating that the metal detection element responds to submarine metal Ni 2+ After ions, the extracellular electron transfer efficiency is successfully improved by enhancing the transcription expression of the flavin synthesis genes, and the electrochemical signal is enhanced by an electrochemical device.
The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> Qingdao university of agriculture
<120> a submarine metal detection element, electrochemical detection sensor constructed by the same and application thereof
<141> 2022-06-08
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 717
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60
gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120
aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180
gtcactactt tcgcgtatgg tcttcaatgc tttgcgagat acccagatca tatgaaacag 240
catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaaagaac tatatttttc 300
aaagatgacg ggaactacaa gacacgtgct gaagtcaagt ttgaaggtga tacccttgtt 360
aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct tggacacaaa 420
ttggaataca actataactc acacaatgta tacatcatgg cagacaaaca aaagaatgga 480
atcaaagtta acttcaaaat tagacacaac attgaagatg gaagcgttca actagcagac 540
cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600
ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660
cttgagtttg taacagctgc tgggattacc catggtatgg atgaattgta caaataa 717
<210> 2
<211> 300
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
tggtcgccaa cccggcgttt ctcagtggca agggcagctg gcaagcaccc tggcggggaa 60
atcgccatca ggatgccagc gccgggctgg ccttgcagcg cggcgaagtc agtgaacaga 120
cggcttggca acgcctgacc gaagtggccg gaaccggcat cagcagcatg agcgtgttca 180
tgcgcgggca gttctgggaa cagggcagcg atggccaggg ctttgctcgc cagtcgggag 240
cgttgctcgc cggccccccc agcccaggcg cccgcctgtt gaatgtgtgg ttgtaaaccc 300
<210> 3
<211> 300
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tggtcgccaa cctggcgttt ctcagtggca aggccagctg gcaagcaccc tggcgcggaa 60
atcgccatca ggatgccagc gcagggctgg ccttgcagcg cggcgaagtc agtgaacaga 120
cggcttggca acgcctgacc gaagtggccg gaaccagcat cagcagcatg agcgtgttca 180
tgcgtgggca gttctgggaa cagggcagcg atggccaggg ctttgctcgc cagtcgggag 240
cgttgctcgc cggccccccc agcccaggcg cgcgcctgtt gaatgtgtgg ttgtataccc 300
<210> 4
<211> 3452
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
atggaagagt attatatgaa gctggcctta gatcttgcga agcagggcga aggacagacc 60
gaatccaatc cgctcgtcgg cgctgttgtc gtaaaggacg gacaaattgt cggaatgggc 120
gcccatttaa aatatggtga agctcatgca gaagttcatg ccatccatat ggctggagca 180
catgcagagg gtgccgacat ttacgttaca ctcgaaccgt gcagccatta cggaaaaaca 240
ccgccatgtg cagaattgat tatcaactct ggtatcaaaa gagtgttcgt ggcgatgaga 300
gatcctaatc cgcttgtggc tggaagaggg atcagcatga tgaaagaagc tggcattgag 360
gtaagggaag gcatcctggc agaccaggcg gagaggctga atgaaaaatt tctgcacttt 420
atgaggacag gccttccgta cgtcacgcta aaagcggctg ccagccttga cggcaagata 480
gctaccagca cgggtgacag caaatggatc acgtcagagg ctgcaagaca ggatgctcag 540
caatacagga aaacacacca aagcatttta gtcggagttg gcacagtgaa agccgacaat 600
ccgagcttaa cctgcagact gccgaatgta acaaaacagc cggttcgggt catacttgat 660
accgtactct cgattcctga ggacgctaaa gtgatttgcg atcaaatagc gccgacatgg 720
atttttacga cggcacgcgc agacgaggaa aagaaaaaac ggctttcagc tttcggagtg 780
aacatattta cacttgaaac cgagcgcatt caaattcctg atgttttgaa gatcctagcg 840
gaagaaggca tcatgtcggt gtatgtggaa ggcggttcag ctgttcacgg aagctttgtc 900
aaagaaggct gttttcaaga aatcatcttc tattttgccc ctaaactaat cggaggaacg 960
catgctccca gcttaatctc cggtgaaggt tttcaatcaa tgaaagatgt ccccttatta 1020
caattcactg atataaccca aatcggccgt gatatcaaac tgacggcaaa accgacaaag 1080
gaataggatg gtgaccatgt ttacaggaat tatcgaagaa acaggcacaa tcgaatccat 1140
gaaaaaagca gggcatgcaa tggccttaac tattaaatgc tcaaagattt tagaggatgt 1200
tcatcttggc gacagcattg cagtgaacgg catttgtctg actgtcactg attttacaaa 1260
aaatcaattc acagtggatg ttatgcctga aacagtcaaa gctacgtcac tgaatgattt 1320
aacaaaagga agcaaagtaa atctggaaag agcgatggcg gcaaacggcc gtttcggagg 1380
ccatttcgtc tcaggccatg tcgacggaac tgcggaaatc acacgaattg aagagaaaag 1440
caacgcagtt tactatgatt taaaaatgga cccgtcatta acaaaaacat tggttttaaa 1500
gggatcaatt actgtggatg gcgtgagctt aaccatattc ggcctgacag aagacacagt 1560
gacgatctcc ttaataccgc atacgatcag cgaaacgatc ttttcagaaa aaacgatcgg 1620
ctctaaagtg aatatcgaat gcgatatgat cggaaaatat atgtatcgat ttttgcataa 1680
agccaatgaa aataagaccc aacaaaccat tacaaaagcc ttcttaagcg aaaacggctt 1740
ttagagagga agatttgcat gtttcatccg atagaagaag cactggacgc tttaaaaaaa 1800
ggcgaagtca tcatcgttgt agatgatgaa gacagagaaa atgaaggaga ctttgtggct 1860
cttgccgagc atgcaacgcc ggaagtcatt aactttatgg cgacacatgg gagaggactg 1920
atctgcacgc cgctcagtga ggaaatcgca gacaggcttg atcttcaccc tatggttgag 1980
cataatacag actctcacca cactgcattt accgtaagca tagaccatcg tgaaacgaag 2040
acaggtatca gcgctcaaga aagatctttt accgttcaag cattgctgga cagcaaatcc 2100
gtgccatctg attttcagcg tccggggcac atttttccac tgattgcgaa aaaaggaggt 2160
gtcctgaaaa gagcgggcca tacagaagct gctgttgatc ttgctgaagc ttgcggatct 2220
ccaggagccg gcgtcatttg tgaaattatg aatgaagacg gaacgatggc gagagtgcct 2280
gagctcattg aaattgcgaa aaagcatcaa ttaaaaatga tcaccattaa ggatttgatt 2340
caataccgtt acaatctgac aacacttgtc gagcgtgaag ttgacattac gctgcctact 2400
gattttggga catttaaggt ttatggatac acaaatgagg tagatggaaa agagcatgtc 2460
gcatttgtga tgggagatgt gccgttcgga gaagaaccgg tattggtccg ggtgcattca 2520
gaatgtctca caggtgacgt gtttggctct catcgctgtg attgcggacc gcagctgcac 2580
gccgcgctga accaaattgc cgcagaaggc cgtggagtgc tcctgtactt gcgccaagaa 2640
ggacgaggca tcggtttaat caataaatta aaagcttata agcttcagga acaaggctat 2700
gacaccgtag aagccaatga ggcgcttgga ttcttgccgg atcttcgcaa ctatggcatc 2760
ggagcacaaa ttttacgcga cctcggtgtc cggaatatga agcttttgac gaataatccg 2820
cgaaaaatcg caggccttga aggctacgga ctcagtattt cagaaagagt gccgcttcaa 2880
atggaggcga aagaacacaa taaaaaatat ttgcaaacca aaatgaacaa gctaggtcat 2940
ttacttcatt tctaatcaca aatatcacaa aaaaggatgg gaatcatatg aatatcatac 3000
aaggaaattt agttggtaca ggtcttaaaa tcggaatcgt agtaggaaga tttaatgatt 3060
ttattacgag caagctgctg agcggagcag aagatgcgct gctcagacat ggcgtagaca 3120
caaatgacat tgatgtggct tgggttccag gcgcatttga aataccgttt gctgcgaaaa 3180
aaatggcgga aacaaaaaaa tatgatgcta ttatcacatt gggcactgtc atcagaggcg 3240
caacgacaca ttacgattat gtctgcaatg aagctgcaaa aggcatcgcg caagcagcaa 3300
acactactgg tgtacctgtc atctttggaa ttgtaacaac tgaaaacatc gaacaggcta 3360
tcgagcgtgc cggcacaaaa gcgggcaaca aaggtgtaga ttgtgctgtt tctgccattg 3420
aaatggcaaa tttaaaccgc tcatttgaat aa 3452
<210> 5
<211> 951
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gtgaagacga tacatattac acatcctcat catttaataa aagaggagca ggcaaaatca 60
gtgatggcgt taggttattt tgacggcgtt catctcgggc atcaaaaggt aatcggcaca 120
gcgaagcaaa tagccgaaga aaaaggtctg acattagctg tgatgacctt tcatccccat 180
ccttctcacg tgttgggcag agataaggaa ccaaaggatc tgattacgcc tcttgaagac 240
aaaataaacc aaattgaaca attaggcaca gaagttctgt atgtcgttaa atttaatgaa 300
gtgtttgctt ctctttctcc taagcagttt atagaccagt atattatcgg ccttaatgtg 360
cagcacgcag tggcaggctt tgactttacg tacggcaaat acggcaaggg aacaatgaag 420
accatgccgg atgatttaga cggaaaagct gggtgcacaa tggtagaaaa attaacggag 480
caggataaaa aaatcagttc ttcgtatatc cgtaccgcgc ttcaaaacgg agatgttgaa 540
ttggcgaatg tcttgcttgg acaaccttat tttattaaag gaattgtcat tcatggtgat 600
aaaagagggc ggaccatcgg gtttccgaca gcgaatgtcg gtttaaataa cagctatatc 660
gttccgccca caggtgtata tgccgtaaaa gcggaagtga acggcgaagt ttacaatggc 720
gtttgcaata ttggctataa gccaacgttt tatgaaaagc gccctgaaca gccttccatc 780
gaggtcaatc tgtttgattt caatcaagag gtatatggag ccgctataaa aatcgaatgg 840
tacaaacgga ttcggagcga gcggaaattc aatggcatca aagaattaac tgagcaaatt 900
gagaaagata agcaggaagc catccgttat ttcagcaatt tgcggaaata a 951
<210> 6
<211> 49
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
tcgctaagga tgatttctgt ggtactggtc gccaacctgg cgtttctca 49
<210> 7
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
actcttccat gggtatacaa ccacacattc aaca 34
<210> 8
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
atcgtcttca cgggtataca accacacatt caaca 35
<210> 9
<211> 48
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
ctagctcccc gggatccgag gtactggtcg ccaacctggc gtttctca 48
<210> 10
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
gttgtatacc catggaagag tattatatga agctg 35
<210> 11
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
tgcggaaata attattcaaa tgagcggttt aaat 34
<210> 12
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
catttgaata attatttccg caaattgctg aaata 35
<210> 13
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
gttgtatacc cgtgaagacg atacatatta cacat 35
Claims (8)
1. A submarine metal detection element, characterized in that the submarine metal detection element comprises induction metal Ni 2+ A promoter element for ions; the nucleotide sequence of the promoter element is shown as SEQ ID NO.2 or SEQ ID NO. 3.
2. An electrochemical detection sensor comprising the submarine metal detection element according to claim 1, wherein the electrochemical detection sensor comprises both the submarine metal detection element and a riboflavin synthesis core gene cluster fragment.
3. The electrochemical detection sensor according to claim 2, wherein the riboflavin synthesis core gene cluster fragment is a nucleotide sequence as shown in SEQ ID NO.4ribADEHThe gene fragment and the nucleotide sequence are shown as SEQ ID NO.5ribCA gene fragment.
4. Use of a submarine metal detector element according to claim 1 for the preparation of an expression cassette, kit or formulation for detecting submarine metal ions, wherein the submarine metal ions are Ni 2+ 。
5. The use according to claim 4, wherein the concentration of the submarine metal ions is detected to be not less than 0.1 μmol/L.
6. The submarine metal detection element of claim 1 or the electrochemical detection sensor of claim 2 for use in the production of a solid bodyDetection of submarine metal Ni 2+ Use in an ionic electrochemical device.
7. The use according to claim 6, wherein the electrochemical device is formed by carbon felt, ag/AgCl calibration electrodes together with engineering bacteria containing submarine metal detection elements or electrochemical detection sensors.
8. The use according to claim 6, wherein the electrochemical device detects metallic Ni released by submarines 2 + When ions are generated, the electrochemical signal output of the ions is obviously improved; when the submarine leaves, the electrochemical signal output of the electrochemical device can be restored to a stable state.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210643359.5A CN115125256B (en) | 2022-06-08 | 2022-06-08 | Submarine metal detection element, electrochemical detection sensor constructed by same and application of electrochemical detection sensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210643359.5A CN115125256B (en) | 2022-06-08 | 2022-06-08 | Submarine metal detection element, electrochemical detection sensor constructed by same and application of electrochemical detection sensor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115125256A CN115125256A (en) | 2022-09-30 |
| CN115125256B true CN115125256B (en) | 2023-08-08 |
Family
ID=83378131
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210643359.5A Active CN115125256B (en) | 2022-06-08 | 2022-06-08 | Submarine metal detection element, electrochemical detection sensor constructed by same and application of electrochemical detection sensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115125256B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ITRM20080103A1 (en) * | 2008-02-28 | 2009-08-29 | Paola Ferrante | INDUCIBLE GENE EXPRESSION SYSTEM IN CHLAMYDOMONAS |
| EP2798056A1 (en) * | 2011-12-30 | 2014-11-05 | Algenol Biofuels Inc. | Genetically enhanced cyanobacteria for the production of a first chemical compound harbouring zn2+, co2+ or ni2+ -inducible promoters |
| WO2017077114A1 (en) * | 2015-11-06 | 2017-05-11 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | Modified magnetotactic bacteria expressing a metallophore specific for cobalt and/or nickel |
-
2022
- 2022-06-08 CN CN202210643359.5A patent/CN115125256B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| Nickel-inducible lysis system in Synechocystis sp. PCC 6803;Liu Xinyao等;《Proc Natl Acad Sci U S A . 》;第106卷(第51期);第21550-4页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115125256A (en) | 2022-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ueki et al. | Geobacter strains expressing poorly conductive pili reveal constraints on direct interspecies electron transfer mechanisms | |
| Kubota | CARD-FISH for environmental microorganisms: technical advancement and future applications | |
| Czechowska et al. | Use of flow cytometric methods for single-cell analysis in environmental microbiology | |
| Lee et al. | Vibrio natriegens, a new genomic powerhouse | |
| Li et al. | Rediverting electron flux with an engineered CRISPR-ddAsCpf1 system to enhance the pollutant degradation capacity of Shewanella oneidensis | |
| CN102260699B (en) | Unmarked gene knock-out method of extremely acidophilic thiobacillus ferrooxidans | |
| CN107037103B (en) | A kind of electrochemica biological sensor and preparation method thereof detecting salmonella typhimurium | |
| CN113686934A (en) | CRISPR/Cas12a-RCA electrochemical sensor detection system and application thereof | |
| US20110281362A1 (en) | Electrotransformation of Gram-Positive, Anaerobic, Thermophilic Bacteria | |
| CN115125256B (en) | Submarine metal detection element, electrochemical detection sensor constructed by same and application of electrochemical detection sensor | |
| Turco et al. | Synthetic biology toolbox, including a single-plasmid CRISPR-Cas9 system to biologically engineer the electrogenic, metal-resistant bacterium Cupriavidus metallidurans CH34 | |
| CN112725339A (en) | Novel promoter element for improving sensitivity of explosive molecule detection and screening method and application thereof | |
| CN115161319B (en) | Promoter element responding to submarine metal Ni2+ ions, electrochemical signal output sensor prepared from promoter element and application of promoter element | |
| CN107102047B (en) | A kind of biosensor detecting salmonella typhimurium | |
| CN113583931B (en) | Citrobacter williamsii ansB gene knockout mutant strain and application thereof | |
| CN115160416A (en) | AraC mutant for inducing submarine metal ion Cd (II), constructed submerged microorganism detection sensor and application thereof | |
| CN115141787B (en) | Submarine microbial sensor and preparation method and application thereof | |
| CN115125264B (en) | Potential microorganism detection sensor containing electric signal reporting element and preparation method and application thereof | |
| JP7402453B2 (en) | Methods of isolating or identifying cells and cell populations | |
| CN114410757A (en) | Method for detecting and absolutely quantifying live non-culturable state cells of vibrio cholerae by using digital PCR (polymerase chain reaction) | |
| Wang et al. | Construction of expression shuttle vectors for the Haloarchaeon natrinema sp. J7 based on its chromosomal origins of replication | |
| CN112391400B (en) | Agrobacterium-mediated genetic transformation method suitable for morinda officinalis endophytic fungus A761 | |
| KR101270657B1 (en) | Pigment-based whole-cell biosensor system for cadmium detection using genetically engineered Deinococcus radiodurans and manufacturing method thereof | |
| Fessler | E-noc fo tceffE: airetcab evitcaortcel j-epsretni fo elor, sdimsalp evitagu c fo yrevocsid dna, noitacinummoc sei nsnegortceleoxe we | |
| CN104263661B (en) | Schizochytrium limacinum without antibiotic marker and genetic transformation method of schizochytrium limacinum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |