CN115112892A

CN115112892A - Method, application and kit for determining surgical incision margin of cancer

Info

Publication number: CN115112892A
Application number: CN202210584510.2A
Authority: CN
Inventors: 常智杰; 任芳丽; 王银银; 林玉婷
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2022-05-27
Filing date: 2022-05-27
Publication date: 2022-09-27
Anticipated expiration: 2042-05-27
Also published as: CN115112892B; WO2023227074A1

Abstract

The invention discloses a method, application and kit for determining a cancer surgical margin by using CREPT. The method determines the area of CREPT positive cells by means of immunohistochemical staining of CREPT and the like so as to identify tissues with high in-situ recurrence risk and guide the surgical margin of cancer. The invention finds that the expression level of CREPT is increased along with the process that cancer cells promote canceration of normal cells by secreting tumor exosomes. While CREPT acts as a oncogenic protein, an increase in CREPT indicates that the cell is at a high risk of canceration and/or relapse. Therefore, the invention can realize the identification of the tissue area with high canceration risk through the detection of the CREPT level.

Description

Method, application and kit for determining surgical incision margin of cancer

Technical Field

The invention relates to the technical field of molecular biology, in particular to a method, application and a kit for determining the surgical margin of a cancer tumor by using CREPT (CREPT), a kit for identifying normal tissue cells and tissue cells with gene level precancerous lesion, a kit for indicating tissue cells with high risk of canceration, a kit for indicating tissue cells with inflammation, a kit for indicating strong proliferation capacity, a kit for indicating tissue cells with reduced apoptosis and a kit for judging the recurrence risk of tissues beside cancer.

Background

In the current tumor treatment method, surgical resection is a better means for radical cure and prognosis, but doctors usually rely on experience and intraoperative rapid pathological examination such as immunohistochemistry when determining resection boundaries, and the determination method can only identify the cancer-adjacent tissues with changed pathology, such as atypical hyperplastic tissues, but can not effectively identify the cancer-adjacent tissues with unchanged pathology but changed gene expression profiles before cancer, so that recurrence after tumor resection is very common.

The concept of regional canceration was first proposed by slauguer in 1953, who studied tumor specimens of 783 patients with oral squamous carcinoma and found pathological changes (e.g. excessive hyperplasia and keratosis) in all paracancerous regions, and 11.2% of patients had two or more foci (slauguer et al, 1953). The pathological changes of tissues beside cancer that they find are a classic regional canceration phenomenon.

As regional carcinogenesis has been discovered in various solid tumors, it has been recognized that the division of pathological boundaries in the past is insufficient to differentiate between cells that have undergone preneoplastic changes. The precancerous cells may become cancerous in the process of tumor development, so that a multiple cancer focus situation is caused, the tumor generates drug resistance, and the precancerous cells may grow into new tumors after the primary tumors are excised, so that the tumors are shown to relapse in situ. The surgeon needs to balance the size of the resection area with the risk of tumor recurrence, such as the procedure and scope of breast conservation for breast ductal carcinoma in situ. Therefore, there is also a need to find the molecular boundaries of tumors, and in particular to provide simple and effective biomarkers to distinguish between normal cells and genetic levels of pre-cancerous lesions that have already developed, to guide the surgeon in ablating these cells, which are highly likely to become cancerous, and thereby reducing the recurrence rate of the tumor.

The current research generally focuses on exploring the changes of tissues beside cancer, and in cancers such as pancreatic cancer, prostate cancer and breast cancer, researchers find that the genes of the tissues which seem normal beside cancer actually have changed through means such as sequencing, and the changes are indeed related to the probability of in-situ recurrence. In particular, in breast cancer, not only are changes in the transcriptional profile of the paraneoplastic tissues found, changes in telomere length, but also changes in the methylation level of DNA are found, and these changes are related to the distance from the tumor in situ, and also affect the recurrence of the tumor in situ.

However, no study has been made to address the cause of canceration in the paracancerous normal tissue region. It has been shown that tumor cells secrete soluble factors such as E-cadherin (Patil et al, 2015) that promote the canceration of normal epithelial cells. In addition, studies have suggested that exosomes (a vesicle) secreted by tumor cells may be involved in regional carcinogenesis of paracancerous tissues (amirad et al, 2020), and that tumor cells may induce carcinogenesis of normal epithelial cells by secreting exosomes (Bertolini et al, 2020; Melo et al, 2014; Wu et al, 2019; Yoon et al, 2022). The multifocal and recurrent nature of bladder cancer is considered to be an effect of regional canceration. Researchers found that non-malignant human urothelial cells SV-HUCs, chronically exposed to bladder cancer extracellular vesicles, triggered endoplasmic reticulum stress and promoted up-regulation of IRE 1and NF-kB and down-regulation of the pro-apoptotic protein CHOP, ultimately leading to cell carcinogenesis (Wu et al, 2019). Various studies have suggested that tumor exosomes may be a carcinogen to induce regional canceration of paracancerous normal tissues.

Therefore, the accurate discovery of the regional canceration causes is helpful for finding reliable biomarkers so as to distinguish completely normal cells and cells with gene level canceration, and help surgeons to accurately determine the position of the surgical margin, thereby minimizing the postoperative recurrence of tumor resection and protecting normal tissues and functions of patients to the greatest extent. This will play an important role in the treatment of many tumors, such as breast cancer breast conservation, gastric cancer resection, early ovarian cancer, etc. There is currently no method and tool for more accurately determining the surgical margins of cancer in the clinic.

Disclosure of Invention

The invention aims to solve the technical problem of how to more accurately determine the surgical incision edge when a cancer tumor is resected so as to keep normal tissues as much as possible and simultaneously prevent tumor in-situ recurrence and inevitable multiple surgical wounds caused by unresectable cancerous tissues as much as possible.

In order to solve the above technical problems, the present invention provides in a first aspect a method of determining a surgical margin for cancer, the method comprising:

detecting the expression level of a marker in a paracancerous tissue from a subject, said marker being CREPT (tumor cell cycle-associated and expression enhancing protein) and mutants thereof having an identity of more than 85%, more than 90%, more than 95%, more than 98% or more than 99%;

and comparing the expression level of the marker with the expression level in a control sample from a normal tissue of a surgical subject or a healthy subject,

wherein the tissue requiring excision is determined when the CREPT expression level in the paracancerous tissue is increased by 10% or more, 20% or more, 50% or more, 100% or more, or 200% or more as compared with the expression level in the control sample.

In embodiments of the methods of the invention, the level of CREPT expression is increased in the dysplastic tissue and in the paracancerous tissue in which the gene expression profile is precancerously altered but the pathology has not been altered, as compared to the level of expression in the control sample.

In an embodiment of the method of the invention, the cancer is a solid cancer, such as cervical cancer, breast cancer, ovarian cancer, melanoma, colon cancer.

In an embodiment of the method of the invention, the expression level of the marker is detected by one or more of the following means:

immunohistochemistry, western blotting, or real-time fluorescent quantitative PCR.

The invention provides in a second aspect the use of a marker CREPT in the manufacture of a kit for the determination of surgical margins of cancer, wherein CREPT is used as the biomarker to be detected, for carrying out the above method for the determination of surgical margins of cancer,

the kit comprises:

a molecule that specifically recognizes said CREPT, and

reagents for conducting the CREPT detection of said molecule that specifically recognizes CREPT.

In an embodiment of the use of the invention, the molecule specifically recognizing the marker is an antibody specifically recognizing the marker, or a small molecule compound specifically binding to CREPT.

In an embodiment of the use of the invention, the reagents for performing the CREPT detection by the molecule that specifically recognizes CREPT comprise: a detectable or a chromogenic marker coupled to or directly or indirectly specifically bound to the molecule which specifically recognizes said CREPT.

The present invention provides in a third aspect a kit for determining a surgical margin for cancer, the kit comprising:

a molecule that specifically recognizes said CREPT,

reagents for conducting the CREPT detection of the CREPT-specific molecule.

In an embodiment of the kit of the invention, the molecule specifically recognizing the marker is an antibody specifically recognizing the marker, and a small molecule compound specifically binding to CREPT.

In an embodiment of the kit of the invention, the reagents for performing the detection of CREPT by the molecule specifically recognizing CREPT comprise: a detectable or a chromogenic label conjugated to the above-mentioned molecule that specifically recognizes said CREPT, or directly or indirectly thereafter.

The invention provides an application of a CREPT detection reagent in preparing a kit for determining tumor surgical margins in a fourth aspect,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

The invention provides an application of a CREPT detection reagent in preparing a kit for identifying normal tissue cells and tissue cells which have gene-level precancerous lesions,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

The invention provides in a sixth aspect the use of a reagent for detecting CREPT in the manufacture of a kit for indicating high risk of cancerous tissue cells,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

The invention provides in a seventh aspect the use of an agent for the detection of CREPT in the manufacture of a kit for the indication of tissue cells undergoing inflammation,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

In an eighth aspect, the invention provides the use of a CREPT-detecting reagent in the preparation of a kit for indicating increased proliferative capacity,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

The invention provides in a ninth aspect the use of a reagent for the detection of CREPT in the manufacture of a kit for indicating tissue cells with reduced incidence of apoptosis,

the kit comprises:

reagents for conducting a detection of CREPT in a sample from a subject.

The invention provides an application of a CREPT detection reagent in preparing a kit for judging the high or low risk of recurrence of a tissue beside cancer,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

In some embodiments of the use according to the fourth to tenth aspects of the invention, wherein the CREPT-detecting reagent comprises:

reagents for performing PCR and/or qPCR on CREPT in a sample;

an antibody that specifically recognizes CREPT; or

Small molecule compounds that specifically bind to CREPT.

In some embodiments of the uses according to the fourth to tenth aspects of the invention, the antibody that specifically recognizes CREPT comprises: a monoclonal antibody or a polyclonal antibody.

In some embodiments of the use of the fourth to tenth aspects of the invention wherein when the agent that detects CREPT is an antibody that specifically recognizes CREPT or a small molecule compound that specifically binds to CREPT, the kit further comprises an agent to perform the detection of CREPT by said molecule that specifically recognizes CREPT, comprising: a detectable or a chromogenic label conjugated or directly or indirectly specifically bound to the above-mentioned molecule which specifically recognizes said CREPT.

In some embodiments of the use according to the fourth to tenth aspects of the invention, where the CREPT detection reagent is a reagent for qPCR of CREPT in a sample, it comprises the following primers:

CREPT qPCR primer

Through the method, the application and the kit, the invention can realize more accurate detection on the tissues beside cancer, the gene expression profile of which is changed precancerously but the pathology of which shows normal, identify normal tissue cells and tissue cells which are changed precancerously at the gene level, discover tissue cells with high canceration risk, discover tissue cells with inflammation, discover tissue cells with enhanced proliferation indicating capability and tissue cells with reduced apoptosis, thereby more accurately determining the surgical margin during the removal of the cancer tumor compared with the prior art and reducing the probability of in-situ tumor recurrence while keeping normal tissues as much as possible.

Drawings

Embodiments of the present invention are explained with reference to the following drawings, in which,

FIG. 1 shows the results of immunohistochemical staining of CREPT in breast cancer and paracarcinoma. In a of fig. 1 CREPT was highly expressed in ductal carcinoma of the breast (a), elevated in paracancerous epithelial tissue near the tumor (b, c), and low in distant normal tissue (d). In fig. 1B, CREPT was highly expressed in breast lobular carcinoma (a), elevated in paracancerous epithelial tissue near the tumor (B, c), and low in distant normal tissue (d).

FIG. 2 shows the results of immunohistochemical staining of CREPT in cervical cancer, colon cancer and paracarcinoma. In fig. 2 a CREPT is highly expressed in cervical cancer (a), elevated in paracancerous epithelial tissue near the tumor (b, c), and low in distant normal tissue (d). In fig. 2B CREPT was highly expressed in colon cancer (a), elevated in paracancerous epithelial tissue near the tumor (B, c), and low in distant normal tissue (d).

Fig. 3 shows the particle size distribution detection results of exosomes. Nanoparticle tracking analysis of exosomes (231EXO and 4T1EXO) from MDA-MB-231(231) and 4T1 cells showed that the size distribution of exosomes was between 30-200 nm.

FIG. 4 shows warp/weft of 1X 10 ⁹ Plate clones of MCF10A (A of FIG. 4) or NmuMG (B of FIG. 4) cells at 2 weeks post treatment of individual particles/mL 4T1EXO or 231EXO developed crystal violet staining results. The statistical results are analyzed by t-test, representing the p-value<0.05。

FIG. 5 shows Western blot results of 4T1EXO, 231 EXO-induced NMuMG, CREPT, p-ERK, p-AKT, AKT and Actin in MCF10A cells. In FIG. 5A, Western blot was used to examine the CREPT, p-ERK, p-Akt, Akt levels of MCF10A cells treated with 231EXO for 0, 1, 3, 6, and 9 days, and Actin was used as an internal reference. In B of FIG. 5, Western blot was used to detect the CREPT, p-ERK, p-Akt, Akt levels of NMuMG cells treated with 4T1EXO for 0, 1, 3, 6,9, and 11 days, and Actin was used as an internal reference.

Figure 6 shows that knockout of CREPT affects the proliferation, nude mouse tumorigenesis and apoptosis of nmugg cells after 4T1EXO treatment, wherein,

warp/weft of 1X 10 ⁹ NMuMG-WT/-KO cells after 2 weeks of treatment with individual particles/mL 4T1EXO, CCK-8 in FIG. 6A, detected cell proliferation for 5 days (cell number expressed by OD450 values normalized by OD450 at day 0, significance analysis using T-test, representing p-value<0.001, ns represents no significant difference);

in B of FIG. 6, the plate clones developed crystal violet staining results;

in C of fig. 6, the results of statistical analysis of clone sizes in B of fig. 6 (using two-way anova,. indicates a p-value < 0.05);

in fig. 6D, nude mouse tumorigenesis results: these cells were injected in situ into nude mouse mammary gland fat pads (5 per group) at 1X 10 per spot ⁷ Individual cells, tumor formation was observed after 10 weeks;

in E of fig. 6, the weight statistics of the tumors in D of fig. 6 (p value <0.01 using two-factor analysis of variance);

in FIG. 6F, Western blot detection of NMuMG-WT/-KO cells at 1X 10 ⁹ Protein levels of Caspase3 and cleared Caspase3 per mL of 4T1EXO treated, Actin was used as an internal control protein.

FIG. 7 shows that knockout of CREPT affects clonal formation of MCF10A cells following 231EXO treatment, where

Warp/weft 2X 10 ⁸ particle/mL 231EXO 2 weeks after plate clone formation (crystal violet staining) results for 10A-WT/-KO cells (left), right panel for clone size statistical analysis (using two-way analysis of variance, representing p-value<0.05)。

FIG. 8 shows that CREPT knockdown blocks 4T1EXO, 231 EXO-induced activation of ERK and AKT in NMuMG, MCF10A cells, where,

in A of FIG. 8, Western blot detects CREPT, p-ERK, p-Akt, Akt levels of MCF10A-WT and KO cells treated with 231EXO for 0, 1, 3, 6,9 days, and Actin is used as an internal reference;

in B of FIG. 8, Western blot was used to detect the CREPT, p-ERK, p-Akt, Akt levels of NMuMG-WT and KO cells treated with 4T1EXO for 0, 1, 3, 6,9, and 11 days, and Actin was used as an internal reference.

FIG. 9 shows that CREPT affects the proliferation of normal epithelial cells, where

A, B, C in FIG. 9 is Western blot to identify CREPT over-expressed and knocked-out cell line with Actin as internal reference protein, wherein A in FIG. 9 is CHO cell, B in FIG. 9 is NMuMG cell, C in FIG. 9 is MCF10A cell;

d, E, F in FIG. 9 is a proliferation assay of cell lines overexpressing and knocking-out CREPT, wherein D in FIG. 9 is CHO cell, E in FIG. 9 is NMuMG cell, F in FIG. 9 is MCF10A cell, and cell proliferation is measured using CCK-8, and cell number is represented by OD450 value normalized by OD450 on day 0. The significance analysis used t-tests, with values for p <0.01, p <0.001, and p < 0.0001.

FIG. 10 shows the ability of overexpressing CREPT to promote tumorigenesis in CHO cells, wherein

Tumor formation in nude mice by CREPT-overexpressing CHO cells. CHO cells overexpressing CREPT (CHO-OE, lower, n-8) and its control (CHO-EV, upper, n-8) were injected subcutaneously into the axilla of nude mice at 1X 10 injection points ⁷ Individual cells, tumorigenesis was observed after 5 weeks.

FIG. 11 shows that CREPT knockdown in MCF10A cells blocks 231 EXO-induced upregulation of portions of the genes in the TNF signaling pathway, wherein,

FIG. 11A is a heatmap of the expression levels of TNF signaling pathway-related genes in MCF10A-WT/KO cells without/with 231EXO treatment. Values are shown in green (0) to red (100) after normalization for each set of maxima. FIG. 11B-F are qPCR measurements of mRNA levels of TNFRSF1B, PIK3CD, JUN, TNF, NOD2, and CSF1 in MCF10A-WT/KO cells on day 16 without/with 231EXO treatment. mRNA levels of Actin serve as an internal control.

FIG. 12 shows that CREPT knockdown in NMuMG cells blocks 4T1 EXO-induced upregulation of portions of the genes in the TNF signaling pathway, wherein,

FIG. 12A is a heatmap of the expression levels of TNF signaling pathway related genes in NMuMG-WT/KO cells without/with 4T1EXO treatment. Values are shown in green (0) to red (100) after normalization for each set of maxima. B-C of FIG. 12 are qPCR measurements of mRNA levels of TNFRSF1B and PIK3CD in NMuMG-WT/KO cells at day 16 without/with 4T1EXO treatment. mRNA levels of Actin serve as an internal control.

Detailed Description

The following non-limiting examples are provided to illustrate the technical aspects of the present invention.

[ definition ]:

CREPT, also known as RPRD1B, is a protein that is highly expressed in tumor tissues and is poorly expressed or not expressed in normal tissues, and high expression of CREPT promotes the proliferation of tumor cells. The protein sequence of the protein consists of 326aa (see SEQ ID NO: 1), and the UniProt number is Q9NQG 5.

Regional canceration: malignant changes in cells surrounding tumor tissue are referred to as regional canceration.

Atypical hyperplasia: the pathological concept refers to the abnormal proliferation of epithelial cells, which have a certain degree of heterogeneity but are not sufficient for the diagnosis of cancer. Atypical hyperplasia is classified into mild, moderate and severe atypical hyperplasia according to the degree of cellular heterogeneity.

Tumor exosomes: exosomes are vesicles secreted by tumor cells, and serve as important tools for intercellular communication, so that the behaviors of nutrition supply, angiogenesis, immune escape and the like are influenced.

Cutting edges in the operation: cancer tumor surgery resects the margins of tissue for evaluation of whether the tumor surgery resects malignant or potentially malignant tissue or cells.

TNF: tumor Necrosis Factor (TNF) is a pleiotropic cytokine. It is 34kDa in size and plays an important role in carcinogenesis, cancer progression and metastasis, and immunity.

Cancer: as used herein, the terms "cancer," "malignancy," "neoplasm," "tumor," and "carcinoma" are used interchangeably to refer to a disease, disorder or condition in which cells exhibit or exhibit relatively abnormal, uncontrolled and/or autonomous growth, such that they exhibit or exhibit an abnormally elevated proliferation rate and/or abnormal growth phenotype. In some embodiments, for example, as set forth herein, a cancer may comprise one or more tumors. In some embodiments, for example, as set forth herein, a cancer can be or include a precancerous (e.g., benign), malignant, pre-metastatic, and/or non-metastatic cell. In some embodiments, for example, as set forth herein, the cancer may be or comprise a solid tumor. In some embodiments, for example, as set forth herein, the cancer may be or include a hematological tumor. Generally, examples of different types of cancers known in the art include, for example, colorectal cancers, hematopoietic cancers including leukemias, lymphomas (hodgkins and non-hodgkins), myelomas, and myeloproliferative diseases; sarcomas, melanomas, adenomas, solid tissue cancers, squamous cell cancers of the mouth, throat, larynx and lung cancer, liver cancer, cancers of the urogenital system such as prostate cancer, cervical cancer, bladder cancer, uterine cancer and endometrial cancer, as well as renal cell cancers, bone cancers, pancreatic cancer, skin cancers, cutaneous or intraocular melanomas, cancers of the endocrine system, thyroid cancer, parathyroid cancer, head and neck cancer, breast cancer, gastrointestinal cancer and cancers of the nervous system, benign lesions and the like such as papillomas and the like.

Such cancers are all within the scope of the present invention.

Solid tumors: as used herein, the term "solid tumor" refers to an abnormal tissue mass including cancer cells. In various embodiments, for example, as presented herein, a solid tumor is or includes an abnormal tissue mass that does not contain cysts or fluid regions. In some embodiments, for example, as set forth herein, a solid tumor can be benign; in some embodiments, the solid tumor may be malignant. Examples of solid tumors include carcinomas, lymphomas, and sarcomas. In some embodiments, for example, as presented herein, a solid tumor can be or include an adrenal, biliary, bladder, bone, brain, breast, cervix, colon, endometrium, esophagus, eye, gall bladder, gastrointestinal tract, kidney, larynx, liver, lung, nasal cavity, nasopharynx, oral cavity, ovary, penis, pituitary, prostate, retina, salivary gland, skin, small intestine, stomach, testis, thymus, thyroid, uterus, vagina, and/or vulva tumor.

Such solid tumors are within the scope of the present invention.

Preventing or preventing: the terms "prevent" and "prevention" as used herein in relation to the occurrence of a disease, disorder or condition refer to reducing the risk of the occurrence of the disease, disorder or condition; delaying the onset of a disease, disorder, or condition; delaying the onset of one or more characteristics or symptoms of a disease, disorder, or condition; and/or reducing the frequency and/or severity of one or more features or symptoms of a disease, disorder or condition. Prevention may refer to prevention of a particular subject or to a statistical effect on a population of subjects. Prevention may be considered complete when the onset of the disease, disorder or condition is delayed by a predetermined period of time.

In some embodiments, the present invention can more effectively and accurately achieve prevention of cancer recurrence by identifying and excising regions of increased CREPT expression.

Treatment: as used herein, the term "treating" or "treatment" refers to administering a partial or complete reduction, amelioration, alleviation, inhibition, delay in the onset of, reduction in the severity of and/or reduction in the incidence of one or more symptoms, features and/or causes of a particular disease, disorder or condition, or for the purpose of achieving any such result. In some embodiments, for example, as set forth herein, such treatment may be for subjects who do not exhibit signs of the relevant disease, disorder, or condition and/or subjects who exhibit only early signs of the disease, disorder, or condition. Alternatively or additionally, such treatment may be directed to a subject exhibiting one or more defined signs of the associated disease, disorder, and/or condition. In some embodiments, for example, as set forth herein, a treatment can be directed to a subject that has been diagnosed with a related disease, disorder, and/or condition. In some embodiments, for example, as set forth herein, a treatment may be directed to a subject known to have one or more susceptibility factors statistically correlated with an increased risk of developing an associated disease, disorder, or condition. In various examples, the treatment is for cancer.

In some embodiments, the present invention can achieve more effective and precise treatment of cancer in the first surgery by identifying and excising regions of increased CREPT expression.

Variants: as used herein, the term "variant" refers to an entity that exhibits significant structural identity to a reference entity but differs structurally from the reference entity in the presence, absence, or level of one or more chemical moieties as compared to a gene or protein of the reference entity, e.g., CREPT. In some embodiments, for example, as set forth herein, the CREPT variant is also functionally different from its reference entity, e.g., a CREPT wild-type. In general, whether a particular entity is properly considered a "variant" of a reference entity depends on the degree to which it shares structural identity with the reference entity. A variant may be a molecule that is comparable to, but not identical to, a reference. For example, a variant nucleic acid may differ from a reference nucleic acid at one or more differences in nucleotide sequence. In some embodiments, for example, as set forth herein, a variant nucleic acid exhibits an overall sequence identity of at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99% to a reference nucleic acid. In many embodiments, for example, as set forth herein, a nucleic acid of interest is considered a "variant" of a reference nucleic acid if it has a sequence that is identical to the reference sequence but with a small amount of sequence change at a particular position. In some embodiments, for example, variants have 10, 9, 8, 7, 6, 5, 4,3, 2, or 1 substituted residues as compared to a reference, as set forth herein. In some embodiments, for example, as set forth herein, a variant has no more than 5, 4,3, 2, or 1 residue additions, substitutions, or deletions compared to a reference. In various embodiments, for example, as set forth herein, the number of additions, substitutions, or deletions is less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and typically less than about 5, about 4, about 3, or about 2 residues.

The assays of the invention can be carried out with reference to CREPT wild-type or CREPT variants as defined above.

In the course of functional research on CREPT, the invention discovers that the CREPT expression level of some normal epithelial tissues close to tumor tissues is increased compared with that of the far-end normal epithelial tissues, and the epithelial tissues with the increased CREPT expression level are accompanied by hyperplasia or atypical hyperplasia. The dysplasia of the tissue adjacent to the cancer predicts that the growth of these cells begins to be out of control, i.e. to acquire the characteristics of some tumors. This malignant alteration of cells surrounding tumor tissue is called regional canceration.

CREPT staining was performed on breast cancer sections with paracancerous normal breast tissue, and it was found that the CREPT expression level was elevated in the paracancerous tissue immediately adjacent to the tumor tissue, while CREPT was still under expressed in the more distant normal tissue. Thus, increased CREPT expression levels are thought to be associated with regional canceration.

The invention provides that the expression of the paracancerous CREPT has a distance effect, namely the paracancerous CREPT is related to the distance of an in-situ tumor, the CREPT expression level of a part which is closer to the in-situ tumor is higher, and the CREPT expression level of a part which is farther from the in-situ tumor is lower, so that the CREPT of a paracancerous tissue is proved to be possibly influenced by a certain factor from the in-situ tumor.

In the case of increased CREPT expression in paracancerous tissues, these tissues with increased CREPT expression include atypical hyperplastic (i.e., pathologically distinct from normal tissues) tissues, and tissues in which the gene expression profile is changed precancerously but the pathology is not yet changed (hereinafter referred to as pathological tissues in which the gene expression is changed precancerously). Cancerous regions, while not necessarily morphologically altered, e.g., tissues in which gene expression is precancerously altered, may acquire some but not all of the phenotypic changes required for malignancy, including acceleration of proliferation, reduction in mortality, or increase in immune escape (Curtius et al, 2018).

The invention finds that the atypical hyperplastic tissue and the tissue with the gene expression changed in a precancerous way have canceration potential, so that the cancer is recurrent.

Therefore, the invention provides that potential malignant cells can be identified more accurately by identifying the atypical hyperplastic tissue with increased CREPT expression and the apparently normal tissue with pre-cancerous changes of gene expression with increased CREPT expression, thereby realizing more accurate guidance on the surgical margin of cancer.

As described above, atypical hyperplastic tissues with elevated CREPT expression, as well as apparently normal tissues with precancerous changes in gene expression with elevated CREPT expression, have the potential to become cancerous, thereby causing the recurrence of cancer.

Aiming at the mechanism research of the increase of CREPT expression level in the paracancer normal epithelial tissue, the method not only can provide an effective marker for cells which suffer from regional canceration, but also can reveal the cause of regional canceration. Meanwhile, CREPT as a potential regulatory factor for regional canceration is likely to become an important target for tumor in-situ recurrence, and a new direction is provided for tumor treatment.

Exosomes are vesicles secreted by cells and have received wide attention in recent years as important tools for cell-cell communication. Exosomes also play an important role in the development of tumors. The development of tumors has not been isolated from the interaction of tumor cells with their growth environment. The growth of tumors requires a suitable growth environment. Similarly, tumors may secrete factors or extracellular vesicles such as exosomes that affect the environment in which they grow. Numerous studies report that exosomes play a role in a tumor microenvironment and affect mesenchymal cells, endothelial cells, immune cells and the like in the microenvironment, so that nutrition supply, angiogenesis, immune escape and other behaviors are affected. Then, the paracancerous normal epithelial tissue, which is also in close proximity to the tumor tissue, is necessarily affected by the exosomes secreted by the tumor tissue, and studies on the role of exosomes in the canceration process of normal epithelial cell regions will provide new approaches to tumorigenesis, development, and prevention and treatment.

According to the invention, through research, the tumor increases CREPT expression in the cancer-adjacent tissues through exosomes, and further induces the change of the tumor in the genomics level, and then the pathological change, such as atypical hyperplasia, and finally canceration occurs. Accordingly, the present invention provides the following exemplary embodiments.

[ method of determining surgical margin for cancer ]

The present disclosure includes, inter alia, a method of determining a surgical margin for cancer, the method being performable by: detecting the expression level of a marker in a paracancerous tissue from the subject, said marker being CREPT and variants thereof. In some embodiments of the invention, the expression level of the marker in a paracancerous tissue from the subject is compared to the expression level in a sample for control. In some embodiments of the invention, the tissue that requires resection is determined to be in the paracancerous tissue when the CREPT expression level is increased by more than 10%, more than 20%, more than 50%, more than 100%, more than 200% compared to the expression level in the control sample.

In some embodiments of the invention, the tissue that requires excision is determined to be a tissue that increases CREPT expression level in said paracancerous tissue by more than 2-fold, more than 3-fold, more than 4-fold, more than 5-fold, more than 6-fold, more than 8-fold, as compared to the expression level in a control sample.

In some embodiments of the invention, the subject is a human, preferably a human having cancer, preferably a human treated for cancer, preferably a human having undergone surgical resection of cancer.

In some embodiments of the invention, the CREPT variant is a mutant that has greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% identity to CREPT.

In some embodiments of the invention, the determination of CREPT expression levels in tissues can take the form of assays known to those skilled in the art, such as immunohistochemistry, western blotting, real-time fluorescent quantitative PCR, in situ hybridization (FISH) methods, and the like.

In some embodiments of the invention, the control sample is from a normal tissue of a surgical subject or a healthy subject.

In some embodiments of the invention, the healthy subject is a subject judged to be free of tumors and cancers according to examination and clinical criteria.

In some embodiments of the invention, CREPT expression levels are elevated in paraneoplastic tissue, preferably in paraneoplastic tissue whose dysplasia and/or gene expression profile is precancerously altered but pathology has not been altered, in subjects undergoing surgery compared to expression levels in control samples.

The dysplastic tissue is a tissue in a state between a normal tissue and a cancer tissue, that is, a state which is pathologically different from the normal tissue but is not sufficiently judged as a cancer, and it is generally considered that the dysplastic tissue has an increased possibility of canceration.

Tissues with a gene expression profile that is precancerously altered but with no pathology altered are those that appear to be the same as normal tissues in traditional pathology tests, but whose gene expression has been different from that of normal tissues. In the present invention, it is considered that tissues in which a gene expression profile is changed precancerously but the pathology has not been changed have an increased possibility of canceration compared with normal tissues, but have not progressed to a stage where atypical hyperplastic tissues are pathologically shown.

In some embodiments of the invention, the cancer is a solid cancer, such as a solid tumor as defined herein above. In some embodiments of the invention, the solid cancer is, for example, cervical cancer, breast cancer, ovarian cancer, melanoma, colon cancer.

In some embodiments of the invention, the expression level of CREPT is detected by one or more of the following means: immunohistochemistry, western blotting, real-time fluorescent quantitative PCR, in situ hybridization (FISH), and the like.

In some embodiments of the invention involving detecting the expression level of CREPT, antibodies that specifically recognize CREPT that can be used include:

CREPT antibodies (3E10), as described by Ren F et al (catalysis of a monoclonal antibody against CREPT, a novel protein expressed in molecules. Monoclone antibody Immunodiagn.2014Dec; 33(6):401-8.doi:10.1089/mab.2014.0043.PMID: 25545209; PMCID: PMC 4278082.);

RPRD1B antibody from GeneTex, inc. (North America), Cat No. gtx119969;

RPRD1B Antibody #74693 from Cell Signaling Technology, inc;

Anti-RPRD1B polyclonal antibody from Beijing Sorley technologies, Inc. (K110225P);

RPRD1B monoclonal antibody (OTI1C9) and RPRD1B polyclonal antibody (Product # PA5-98941) from Invitrogen.

In some embodiments of the invention using real-time fluorescent quantitative PCR, primers obtained by designing CREPT using common primer design tools, such as the following primers, can be used:

CREPT qPCR primer

[ application in the preparation of a kit for determining surgical margins for cancer ]

In other embodiments of the invention, there is provided the use of the marker CREPT in the preparation of a kit for determining the surgical margin of cancer, wherein CREPT is used as the detected marker, for carrying out the above-described method of determining the surgical margin of cancer according to the invention,

the kit comprises:

a molecule that specifically recognizes said CREPT, and

In an embodiment of the use of the invention, the molecule specifically recognizing the marker is an antibody specifically recognizing the marker, a small molecule compound specifically binding to CREPT.

The antibodies specifically recognizing CREPT in the invention comprise:

RPRD1B antibody from GeneTex, inc. (North America), Cat No. gtx119969;

RPRD1B Antibody #74693 from Cell Signaling Technology, inc;

Anti-RPRD1B polyclonal antibody from Beijing Solebao technologies, Inc. (K110225P);

In an embodiment of the use of the invention, the reagents for performing the CREPT detection by the molecule that specifically recognizes CREPT comprise: a detectable or a chromogenic label conjugated or directly or indirectly specifically bound to the above-mentioned molecule which specifically recognizes said CREPT.

[ kit for determining surgical incisal margins for cancer ]

In other embodiments of the present invention, there is provided a use of a marker for the preparation of a kit for determining a surgical margin for cancer. The kit comprises: a molecule that specifically recognizes said CREPT, and a reagent to perform a CREPT detection of said molecule that specifically recognizes CREPT.

In an embodiment of the invention, the kit refers to a component of a consumable for qualitative and/or quantitative detection of CREPT expression in para-cancerous tissue. The core of the kit of the invention treats tissue biopsies, surgical resection and intraoperative pathological sections so as to show the presence, absence and/or expression quantity of CREPT.

In some embodiments of the invention, the molecule that specifically recognizes the marker, e.g., CREPT, is an antibody that specifically recognizes the marker, or a small molecule compound that specifically binds to CREPT.

In some embodiments of the invention, the reagents to perform the detection of CREPT by the molecule that specifically recognizes CREPT comprise: a partner that specifically binds to a molecule that specifically recognizes said CREPT, and a label that can bind to said partner and produce a detectable signal.

Additionally, in some embodiments of the invention, the reagents to perform the detection of CREPT by the molecule that specifically recognizes CREPT further comprise: some auxiliary agents such as buffers, protein stabilizers, e.g. polysaccharides, etc. The diagnostic kit may also include other components of the signal producing system, such as reagents to reduce background interference, control reagents, equipment required to complete a test, etc., as desired. In another embodiment, the diagnostic kit comprises a combination of a CREPT antibody and a substance capable of producing a detectable signal.

When the molecule that specifically recognizes CREPT is an antibody that specifically recognizes the marker, the reagents used to perform the detection of CREPT by the antibody include reagents that promote the binding of CREPT to specific antibodies, such as buffers, stabilizers, blocking or visualization reagents, and the like.

For example, in one embodiment, the kit for achieving specific detection of a protein using an antibody further comprises a second antibody, a color-developing agent conjugated to the second antibody, and the like.

When the molecule that specifically recognizes CREPT is a small molecule compound, the reagents used to perform the detection of CREPT by the small molecule compound include reagents that promote the binding of CREPT to the small molecule compound, such as buffers, stabilizers, blocking agents, or color developing agents.

For example, in one embodiment, the small molecule compound can bind to a CREPT protein via covalent or non-covalent means.

For example, in one embodiment, the small molecule compound may be a small molecule compound with a fluorescent or biotin probe.

The method for determining the surgical margin of cancer and the kit for determining the surgical margin of cancer of the present invention can reduce the risk of recurrence in situ at the time of cancer resection surgery.

Recurrence in situ means that the recurrent tumor is at the same site or very close to the primary tumor, with or without distant diffuse metastasis. The cancer relapsed in situ belongs to local tumor, and clinically, according to the disease condition of a patient, the detection method and the kit can accurately identify tissues and cells with the potential of in situ relapse besides adopting local treatment such as operation and radiotherapy or combined treatment such as chemotherapy, so that the tissues can be excised in the first cancer operation, and the possibility of in situ relapse is reduced.

[ use of a reagent for detecting CREPT in the preparation of a kit ]

The invention also relates to the preparation of a kit for performing one or more of the following uses selected from: a kit for determining the surgical margin of tumor, a kit for identifying normal tissue cells and tissue cells which have gene level precancerous lesion, a kit for indicating tissue cells with high risk of canceration, a kit for indicating tissue cells with inflammation, a kit for indicating the enhancement of proliferation capacity, a kit for indicating tissue cells with reduced apoptosis and a kit for judging the high and low risk of recurrence of tissues beside cancer,

the kit comprises:

reagents for conducting a detection of CREPT in a sample from a subject.

In some embodiments of the invention directed to the above uses, wherein the reagents for detecting CREPT comprise:

reagents for performing PCR and/or qPCR on CREPT in a sample;

an antibody that specifically recognizes CREPT; or

A small molecule compound that specifically binds to CREPT.

In some embodiments of the invention directed to the above uses, antibodies that specifically recognize CREPT include:

CREPT antibodies (3E10) as described by Ren F et al (catalysis of a monoclonal antibody against CREPT, a novel protein expressed in tumors, Monoclone antibody Immunodiagn.2014Dec; 33(6):401-8.doi:10.1089/mab.2014.0043.PMID: 25545209; PMCID: PMC 4278082.);

RPRD1B antibody from GeneTex, Inc (North America), Cat No. gtx 119969;

RPRD1B Antibody #74693 from Cell Signaling Technology, inc;

In some embodiments of the invention involving the above uses, where the CREPT-detecting agent is an antibody that specifically recognizes CREPT or a small molecule compound that specifically binds to CREPT, the kit further comprises reagents to perform the CREPT detection with the molecule that specifically recognizes CREPT, comprising: a detectable or a chromogenic label conjugated or directly or indirectly specifically bound to the above-mentioned molecule which specifically recognizes said CREPT.

In some embodiments of the invention involving the above applications, when the CREPT detection reagent is a reagent for qPCR of CREPT in a sample, primers obtained by designing CREPT using common primer design tools, such as the following primers, can be used:

CREPT qPCR primer

All the above-described embodiments of the invention can be combined with each other or technical features in the embodiments can be combined by a person skilled in the art according to common knowledge.

Examples

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results were averaged.

[ test materials ]

1 Experimental animals and cells

7 cell lines are used in total, namely a mouse mammary gland epithelial cell NMuMG, a mouse breast cancer cell 4T1, a hamster ovary epithelial cell CHO, a human mammary gland epithelial cell MCF10A, a human breast cancer cell MDA-MB-231, a human breast cancer cell MCF7 and a human breast cancer tamoxifen drug-resistant cell strain MCF 7/TAM-R.

The animals used in the experiment are BALB/c nude mice purchased from the experimental animal platform of Qinghua university.

2 plasmid

The Myc-CREPT on pcDNA3.1 vector, CRISPR/cas9 mediated CREPT knockout plasmid PX458 (shown below in gRNA sequence) and CREPT knockdown shRNA (shown below in sequence) used were constructed and stored in the laboratory.

Knocking out CREPT: CRISPR-CAS9

Guide RNAs (gRNAs): ATCGTCTCCGTGTGGCACCG (see, SEQ ID No.: 2); CGTGCCGTCGCTCTTCCCGC (see SEQ ID NO. 3)

Knockdown of CREPT/shRNA

TRCN0000148750: CCGGCGGCAGCAGTATATTCTGAAACTCGAGTTTCAGAATATACTGCTGCCGTTTTTTG (see, SEQ ID NO. 4)

TRCN0000149087: CCGGGCACGAAGATTAGGTGCATTTCTCGAGAAATGCACCTAATCTTCGTGCTTTTTTG (see SEQ ID NO. 5)

Knockdown of CREPT: SiRNA

GCAAGAACGAAGUGUUAUTT (see SEQ ID NO. 6)

GUCUGUUACUAGCAGAAUATT (see SEQ ID NO. 7)

3 antibodies

Antibodies against p-ERK1/2(Thr202/Tyr204, #4370), ERK1/2(#4695), p-Akt (Ser473, #4046), Akt (#9272), and Caspase3(#9662) were purchased from Cell Signaling Technology, Inc. anti-Actin (a5316) antibody was from Sigma. CREPT antibody (3E10) was produced by this experiment (Ren et al, 2014). Horseradish peroxidase (HRP) -labeled goat anti-mouse (ZB-2305) and goat anti-rabbit IgG (ZB-2301) were purchased from China fir Jinqiao.

4 reagent

DMEM (C11995500BT), horse serum (26050088), pancreatin (Trypsin-EDTA, 25200056), penicillin/streptomycin (15140122), PBS powder (21600044) for cell culture were purchased from Thermo Fisher. Fetal Bovine Serum (FBS) was purchased from BI corporation. Insulin (CC101), cholera toxin (CC104), Epidermal Growth Factor (EGF) (CC102), hydrocortisone (CC103), and phenol red-free DMEM/F12 medium (CM16405) were purchased from Meechium (Beijing) science and technology, Inc., of China.

In addition, RNA extraction reagents (TRIzol, 15596018), protein molecular weight markers (26617), and chemiluminescent (ECL) substrates (34577) were purchased from Thermo Fisher, and FastKing cDNA first strand synthesis kit (KR116) and quantitative fluorescence detection kit (FP209) were purchased from Tiangen Biotechnology (Beijing) Ltd. Efficient eukaryotic transfection reagents Vigofect and dual-luciferase reporter gene detection kits are purchased from Wegener biotechnology (Beijing) Co. CCK-8 kit (GB707) was purchased from Dojindo, Homopren, Japan. The primers were synthesized by Biotechnology of Boxing Ke, Beijing Rui.

Example 1 immunohistochemical staining indicates elevated expression of CREPT in paracancerous dysplastic tissue and in parts of normal pathologically organized tissues

Immunohistochemical staining experiments were performed in different types of tumor sections with paraneoplastic tissue using CREPT antibody (3E10) (Ren et al, 2014) to detect CREPT expression.

The samples used in the experiment were from ductal breast cancer (a in fig. 1), lobular breast cancer (B in fig. 1), cervical cancer (a in fig. 2) and colon cancer (B in fig. 2).

The immunohistochemical section adopts the steps of section baking, dewaxing and rehydration, section washing, antigen retrieval, sealing, primary antibody combination (the primary antibody of China fir Jinqiao company, the dilution multiple of a CREPT antibody is 50 times), secondary antibody combination (HRP coupling mouse/rabbit universal secondary antibody (Envision) produced by Dako company), DAB dyeing, nucleus staining, dehydration and transparentization, section sealing, and then the section is placed on a section rack to be dried overnight.

Finally, the slices were scanned, and the results are shown in fig. 1a and fig. 1B and fig. 2 a and fig. 2B, and the results were analyzed.

And (4) conclusion:

a phenomenon of elevated CREPT expression levels was found in the paraneoplastic tissue of ductal breast cancer (a of fig. 1). Careful observation of the sections revealed that the CREPT of the tumor tissue appeared positive (a in a of fig. 1); the increase of CREPT expression level occurred in part of cells of a vessel closer to the tumor tissue in the paracarcinoma tissue, and at the same time, the tissue morphology of the vessel was changed-internal consolidation, indicating that the tissue was dysplastic (b in FIG. 1A); slightly distal catheter, which exhibited positive CREPT expression in peripheral round myoepithelial cells but no change in tissue morphology (c in a of fig. 1); while more distant normal tissues are completely free of CREPT expression (d in a of fig. 1). Similarly, in breast lobular carcinoma sections, we found that CREPT was highly expressed in their tumor tissues (a in B of fig. 1). Elevated CREPT expression levels were observed in both the lobule near the tumor tissue (B in fig. 1B) and the lobule slightly distant (c in fig. 1B) paraoncogenesis, and the part of the lobule near the tumor tissue was hyperplastic. While the more distal leaflet CREPT expression level was lower (d in B of fig. 1). Furthermore, the phenomenon is also found in cervical cancer (A in figure 2) and colon cancer (B in figure 2), the CREPT expression level is increased in the paracarcinoma tissues close to the tumor tissues (B and c in A in figure 2 and B and c in B in figure 2), and the CREPT expression level in the far normal tissues is negative (d in A in figure 2 and d in B in figure 2).

Example 2 inhibition of CREPT inhibits the canceration of tumor exosomes on normal epithelial cells

2.1. Extraction and identification of exosomes

The exosomes used were derived from mouse breast cancer cell 4T 1and human breast cancer cell MDA-MB-231 (purchased from ATCC), and exosome extraction was performed by conventional differential ultracentrifugation, i.e., supernatant was prepared, impurities were removed, exosomes were extracted by ultracentrifugation, and then stored: the PBS resuspended exosomes can be stored briefly at 4 ℃, for functional validation experiments within a week, or for long periods at-80 ℃.

Exosome particle size distribution and particle concentration were analyzed using NanoSight LM14(Malvern Panalytical, UK) equipped with a Nanoparticle Tracking Analysis (NTA) system. Data acquisition and analysis were performed using NTA analysis software version 3.1. The analysis result shows that the particle size distribution of the extracted product is between 30 and 200nm and accords with the characteristic of the particle size distribution of exosome (figure 3).

2.2. The process of promoting cell cancerization by tumor exosome is accompanied by the increase of CREPT expression level

2.2.1 the effect of tumor exosome treatment on cell clonogenic was assessed by plate clonogenic experiments.

Using PBS or 1X 10 ⁹ Each pellet/mL of 4T1 cell-derived exosome or MDA-MB-231-derived exosome treated normal mammary epithelial cells, NMuMG or MCF10A, for two weeks, after which the exosomes were withdrawn and the cells were cultured using normal medium. The colony forming experiment was performed using normal mammary epithelial cells treated with control PBS or tumor exosomes, and the ability of the cells to form colonies was judged by the number of cell colonies formed.

The operation steps comprise: 1. cell suspensions were prepared and 500 or 1000 cells were seeded per well in six-well plates. Each group has 3 multiple holes; culturing for 7-14 days, and changing the liquid every three days; after the formation of the clones visible to the naked eye, the medium was removed, washed once with PBS, and the clones were stained by adding 0.1% crystal violet (dissolved in methanol to 0.5% stock solution and diluted with distilled water before use); standing at room temperature for 15min, discarding the staining solution, and washing with distilled water to clean the background; airing; records were scanned and analyzed using ImageJ software.

The experimental results show that the breast tumor exosome can promote the clone formation of normal breast epithelial cells, namely, the cell proliferation capacity is enhanced, and the breast tumor exosome is a phenotype of regional canceration (figure 4).

2.2.2 tumor exosomes promote the increase of the levels of CREPT and canceration markers p-ERK and p-AKT in the canceration process of cells

And detecting the CREPT expression level and the phosphorylation levels of key cancer promotion signal molecules ERK and AKT in the treatment process of tumor exosomes by adopting a classical immunoblotting experiment (Western Blotting, WB). The results were visualized, observed and recorded using a MiniChemi610 imaging system (Sagecreation Service For Life Science).

Experimental results show that during the process of inducing normal epithelial cell canceration by tumor exosome, the expression level of CREPT is obviously increased, and the phosphorylation levels of cancer signal molecules ERK and AKT are also increased (figure 5).

This means that tumor exosomes can promote canceration of normal epithelial cells, and this process is accompanied by an increase in the expression level of CREPT, which is involved in the process of cell canceration. Thus, elevated CREPT expression is an early molecular indicator and therapeutic target for inflammation and canceration of tissues adjacent to cancer.

2.3 inhibition of CREPT inhibits the cancerization of tumor exosomes on normal epithelial cells

Cell proliferation experiments, colony formation experiments and tumor formation experiments prove that the inhibition of CREPT can inhibit canceration of normal cells caused by tumor exosomes (figure 6 and figure 7). After wild type NMuMG cells (NMuMG-WT) are treated by 4T1 exosomes (4T1EXO), the proliferation capacity of the wild type NMuMG cells is obviously improved; after the CREPT knockout NMuMG (NMuMG-KO) is treated by 4T1EXO, the proliferative capacity of the CREPT knockout NMuMG is not obviously changed (A in figure 6), namely the CREPT knockout NMuMG loses the response to the stimulation of an exosome. Similarly, NMuMG-WT was significantly improved in clonogenic capacity after 4T1EXO stimulation, whereas NMuMG-KO was not significantly changed in clonogenic capacity after 4T1EXO stimulation (B, C in FIG. 6). Similarly, in MCF10A cells treated with MDA-MB-231 exosomes (231EXO), knockout of CREPT also inhibited the tumor exosome's promoting effect on clonogenic (FIG. 8). Furthermore, the NMuMG-WT and NMuMG-KO cells treated by 4T1EXO are subjected to a nude mouse tumorigenesis experiment, and the result shows that 4T1EXO can promote the tumorigenesis of NMuMG-WT; NMuMG's tumorigenic capacity decreased following CREPT knockout, as evidenced by decreased tumor volume and mass, while 4T1EXO no longer promoted NMuMG's tumorigenicity (D, E of fig. 6). The three experiments prove that the cancer effect of tumor exosomes on normal epithelial cells can be inhibited by inhibiting CREPT.

In addition, CREPT knock-out also elevated the apoptotic marker clear-Caspase 3 in NMuMG cells after 4T1EXO treatment (F in fig. 6), suggesting that CREPT also has an effect on apoptosis in cells. When tumor exosomes treated normal epithelial cells, clear caspase3 decreased, i.e., apoptosis of the cells was inhibited, which corresponds to decreased apoptosis of cells during regional canceration. While the knockout of CREPT enhanced apoptosis, i.e., also affected the canceration of the cells.

At the same time, the phosphorylation levels of ERK and AKT in cells after CREPT knockout were examined. As a result, it was found that CREPT knockout also inhibited the increase in tumor exosome-stimulated ERK and AKT phosphorylation levels.

The above results indicate that inhibition of CREPT prevents tumor exosome-induced canceration of normal epithelial cells. Similarly, CREPT inhibition could prevent tumor exosome-induced canceration of paracancerous tissues, i.e. CREPT inhibition could inhibit tumor recurrence in situ to some extent (fig. 6,7, 8).

Example 3 cell proliferation assay-CREPT knockdown affects the proliferative capacity of normal epithelial cells; CREPT overexpression promotes tumorigenesis in CHO cells in mice.

Respectively overexpress CREPT with Myc label in CHO cells, NMuMG cells and MCF10A cells, and obtain the product by neomycin screeningStably overexpressed cell lines(CHO-OE, NMuMG-OE and MCF10A-OE, the controls are CHO-EV, NMuMG-EV and MCF10A-EV respectively), and in addition, we also establish CREPT by using CRISPR-Cas9 systemKnockout cell lines(CHO-KO, NMuMG-KO, MCF10A-KO, controls CHO-WT, NMuMG-WT, MCF10A-WT, respectively) (A, B, C in FIG. 9).

This example uses the routine protocol in the art to perform a CCK-8(Cell Count Kit-8) experiment.

Growth curves were plotted in days on the abscissa by the CCK-8 experiment to examine the proliferative capacity of these cells. The results showed that overexpression of CREPT promoted cell proliferation, while knockout of CREPT inhibited cell proliferation (D, E, F in fig. 9). Surprisingly, the tumorigenic capacity of CHO cells was promoted when CREPT was overexpressed in hamster ovary epithelial CHO cells (fig. 10), meaning that overexpression of CREPT promoted malignant transformation of CHO cells. The above results indicate that CREPT not only affects the proliferative capacity of normal cells but also promotes canceration of normal cells.

In cell proliferation experiments, CREPT is found as a cancer promoting protein and a tumor marker, and the increase of the CREPT means that normal cells have great possibility of malignant change (figures 5, 9 and 10). Unpublished data in the laboratory indicate that the early stage of normal cell carcinogenesis is accompanied by an increase in the expression level of CREPT during tumorigenesis. The CREPT over-expression can promote the proliferation and tumorigenicity of normal epithelial cells, and combined with the phenomenon that tissues with increased paracancerous CREPT expression are accompanied by atypical hyperplasia, the fact that the increased CREPT expression level promotes regional canceration of normal tissues, and the regional canceration of normal cells means that the cells are at a very high canceration risk is proved.

Example 4 involvement of CREPT in the inflammatory response regulated by tumor exosome-induced TNF signaling pathway

Changes in the transcriptome of CREPT knockout cells following tumor exosome stimulation were compared to changes in the transcriptome of wild type cells. As a result, 2140 (94.0%) of the 2276 upregulated genes of MCF10A cells were no longer significantly elevated after CREPT knockout, 380 (56.8%) of the 669 upregulated genes of nmugg cells were not upregulated after CREPT knockout, and the inventors believe that these genes that were not upregulated after CREPT knockout were regulated directly or indirectly by CREPT.

Subsequently, the 2140 genes and 380 genes are respectively analyzed by KEGG, and signal channels of CREPT participating in regulation and control in the process of stimulating normal epithelial cell canceration by tumor exosomes are explored. The results indicate that the Pathways affected by both of them are the Pathways related to inflammation such as Cytokine-receptor interaction (Cytokine-Cytokine receptor interaction), TNF signaling pathway (TNF signaling pathway), AGE-RAGE signaling pathway (AGE-RAGE signaling pathway), and the Pathways related to tumorigenesis development such as cancer signaling pathway (pathway in cancer), MAPK signaling pathway (MAPK signaling pathway), PI3K-AKT signaling pathway (PI3K-AKT signaling pathway).

There were 31 genes upregulated in the TNF signaling pathway after stimulation with 231EXO in MCF10A, 28 of which were regulated by CREPT, and we mapped the expression levels of these genes as a heat map (A in FIG. 11). The mRNA levels of TNFRSF1B, PIK3CD, JUN, TNF, NOD2 and CSF1 were tested and it was found that CREPT knock-out did suppress the increase in expression levels of these genes (FIG. 11B-F).

Similarly, there were 19 genes upregulated in the TNF signaling pathway following stimulation of NMuMG cells with 4T1EXO, 8 of which were regulated by CREPT (fig. 12 a). The expression levels of TNFRSF1B and PIK3CD were affected by CREPT knockdown as verified by qPCR (B-C of fig. 12).

TNFR2 is one of two receptors for TNF, expressed on the surface of some tumor cells and some immunosuppressive cells, thereby promoting tumor proliferation and immune escape. TNFR2 promotes tumor development mainly by activating ERK, AKT, NF-kappa B, MLCK, etc., and the signal pathways influenced by CREPT knockout are also MAPK and PI3K-AKT signal pathways, so that the activation of ERK and AKT is also influenced by CREPT knockout.

Through Western blot detection, the phosphorylation levels of ERK and AKT in normal epithelial cells are obviously increased along with the increase of the treatment days of tumor exosomes, and the phosphorylation levels of ERK and AKT are obviously inhibited after CREPT knockout (figure 8). The results show that CREPT is mainly involved in the activation of TNF signaling pathway in the process of inducing inflammatory reaction of normal epithelial cells by tumor exosome.

Thus, tumor exosomes were found to elicit an inflammatory response in normal epithelial cells and promote expression of CREPT. The high expression of CREPT further promotes the activation of the signals (such as ERK and AKT) related to the survival of the downstream of a TNF signal channel, thereby improving the survival ability of cells and breaking the balance of survival and apoptosis. That is, TNF signaling can promote cell proliferation and even carcinogenesis in the presence of CREPT.

Therefore, it is proposed that by inhibiting CREPT, inflammation of the tissue adjacent to cancer can be reduced, thereby preventing cancer recurrence at an earlier stage.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

List of references:

amirad, F., Pytak, P.A., Sadeghiani-Pearl, N., Nguyen, J.P.T., fauble, E.L., Jones, A.C., and Bisoffi, M. (2020), State field localization and exosomes, Association beta. CD9, early growth response 1and failure acid synthesis of int J Oncol 56, 957-.

Bertolini, I.S., Ghosh, J.C., Kossenkov, A.V., Mulugu, S.S., Krishn, S.R., Valira, V.S., Qin, J.P., Plow, E.F., Languino, L.R., and Altieri, D.C. (2020) Small excellar Vesicle Regulation of Mitondrodrial Dynamics repeats a Hypoxic turbine Microenviron.Dev. 55,163-177e166.

Melo, s.a., Sugimoto, h., O' Connell, j.t., Kato, n., Villanueva, a., Vidal, a., Qiu, l., vikin, e., Perelman, l.t., Melo, c.a., et al. (2014) Cancer exosomes per Cell-independent microRNA biogenesis and promoter tissue growth. Cancer Cell 26,707-721.

Nagaishi, t., Watabe, t., Jose, n., Tokai, a., Fujii, t., Matsuoka, k., Nagahori, m., Ohtsuka, k., and Watanabe, M. (2016) (epitolial factory-x 03 BA; b Activation in Influmormatory Bowel Diseases and collagen-Associated Cardigenesis, dictionary 93,40-46.

Onizawa, M.S., Nagaishi, T.T., Kanai, T.S., Nagano, K.S., Nemoto, Y.S., Yoshioka, A.S., Totsuka, T.S., Okamoto, R.S., Nakamura, T.S., et al (2009).

Patil,P.U.,D'Ambrosio,J.,Inge,L.J.,Mason,R.W.,and Rajasekaran,A.K.(2015).Carcinoma cells induce lumen filling and EMT in epithelial cells through soluble E-cadherin-mediated activation of EGFR.J Cell Sci 128,4366-4379.

Quail, D.F., and Joyce, J.A. (2013). Microenvironmental regulation of tumor progression and metastasis, Nat Med 19, 1423-.

Ren, F., Wang, R., Zhang, Y., Liu, C., Wang, Y., Hu, J., Zhang, L., and Chang, Z. (2014.) Characterisation of a monoclonal antibody CREPT, a novel protein expressed in molecules in immunological antigens and immunotherpay 33, 401-.

Slauguer, d.p., Southwick, h.w., and Smejkal, w. (1953.) Field cancerization in oral strastribed square epiphyllium; (iii) clinical indications of multicentric orientation. cancer 6, 963-.

Suzuki, m., nagaisi, t., Yamazaki, m., Onizawa, m., Watabe, t., Sakamaki, y, ichino, s, Totsuka, m., Oshima, s, Okamoto, r., et al, (2014), yosin light chain enzyme expressed vitamin tissue receptor 2signaling in the epithelial cells modulators, plos e 9, e88369.

Wu, C.H., silver, C.R., Messing, E.M., and Lee, Y.F (2019), blade pigment extra cellular drive motor manufacturing by using the underfolded protein response in end plastic diagnostic um of nonpositive cells J Biol Chem 294, 3207-.

Yoon, J.H., Choi, B.J., Nam, S.W., and Park, W.S, (2022) scientific cancers exosomes distribution to the field cancerization of scientific exogenous cells.

Yuan, d. Huang, s., berg, e., Liu, l., Gross, n., Heinzmann, f., ringer han, m., Connor, t.o., Stadler, m., Meister, m., et al (2017) Kupffer Cell-Derived Tnf triggerers chloingiocellular tungesis hardware JNK due to chrono michiondrial Dysfunction and ros. cancer Cell 31,771-789e776.

Sequence listing

<110> Qinghua university

<120> method, use and kit for determining surgical margins of cancer

<130> GAI22CN4685

<160> 17

<170> PatentIn version 3.5

<210> 1

<211> 326

<212> PRT

<213> CREPT protein sequences

<223> human

<400> 1

Met Ser Ser Phe Ser Glu Ser Ala Leu Glu Lys Lys Leu Ser Glu Leu

1 5 10 15

Ser Asn Ser Gln Gln Ser Val Gln Thr Leu Ser Leu Trp Leu Ile His

20 25 30

His Arg Lys His Ala Gly Pro Ile Val Ser Val Trp His Arg Glu Leu

35 40 45

Arg Lys Ala Lys Ser Asn Arg Lys Leu Thr Phe Leu Tyr Leu Ala Asn

50 55 60

Asp Val Ile Gln Asn Ser Lys Arg Lys Gly Pro Glu Phe Thr Arg Glu

65 70 75 80

Phe Glu Ser Val Leu Val Asp Ala Phe Ser His Val Ala Arg Glu Ala

85 90 95

Asp Glu Gly Cys Lys Lys Pro Leu Glu Arg Leu Leu Asn Ile Trp Gln

100 105 110

Glu Arg Ser Val Tyr Gly Gly Glu Phe Ile Gln Gln Leu Lys Leu Ser

115 120 125

Met Glu Asp Ser Lys Ser Pro Pro Pro Lys Ala Thr Glu Glu Lys Lys

130 135 140

Ser Leu Lys Arg Thr Phe Gln Gln Ile Gln Glu Glu Glu Asp Asp Asp

145 150 155 160

Tyr Pro Gly Ser Tyr Ser Pro Gln Asp Pro Ser Ala Gly Pro Leu Leu

165 170 175

Thr Glu Glu Leu Ile Lys Ala Leu Gln Asp Leu Glu Asn Ala Ala Ser

180 185 190

Gly Asp Ala Thr Val Arg Gln Lys Ile Ala Ser Leu Pro Gln Glu Val

195 200 205

Gln Asp Val Ser Leu Leu Glu Lys Ile Thr Asp Lys Glu Ala Ala Glu

210 215 220

Arg Leu Ser Lys Thr Val Asp Glu Ala Cys Leu Leu Leu Ala Glu Tyr

225 230 235 240

Asn Gly Arg Leu Ala Ala Glu Leu Glu Asp Arg Arg Gln Leu Ala Arg

245 250 255

Met Leu Val Glu Tyr Thr Gln Asn Gln Lys Asp Val Leu Ser Glu Lys

260 265 270

Glu Lys Lys Leu Glu Glu Tyr Lys Gln Lys Leu Ala Arg Val Thr Gln

275 280 285

Val Arg Lys Glu Leu Lys Ser His Ile Gln Ser Leu Pro Asp Leu Ser

290 295 300

Leu Leu Pro Asn Val Thr Gly Gly Leu Ala Pro Leu Pro Ser Ala Gly

305 310 315 320

Asp Leu Phe Ser Thr Asp

325

<210> 2

<211> 20

<212> DNA

<213> knockout CREPT: CRISPR-CAS9 Guide RNAs

<400> 2

atcgtctccg tgtggcaccg 20

<210> 3

<211> 20

<212> DNA

<213> knockout CREPT: CRISPR-CAS9 Guide RNAs

<400> 3

cgtgccgtcg ctcttcccgc 20

<210> 4

<211> 59

<212> DNA

<213> knockdown CREPT: shRNA

<400> 4

ccggcggcag cagtatattc tgaaactcga gtttcagaat atactgctgc cgttttttg 59

<210> 5

<211> 59

<212> DNA

<213> knockdown CREPT: shRNA

<400> 5

ccgggcacga agattaggtg catttctcga gaaatgcacc taatcttcgt gcttttttg 59

<210> 6

<211> 20

<212> DNA

<213> knockdown CREPT: SiRNA

<400> 6

gcaagaacga aguguuautt 20

<210> 7

<211> 21

<212> DNA

<213> knockdown CREPT: SiRNA

<400> 7

gucuguuacu agcagaauat t 21

<210> 8

<211> 20

<212> DNA

<213> qPCR primer CREPT _ F1

<400> 8

tgtccctttg gctcatccac 20

<210> 9

<211> 20

<212> DNA

<213> qPCR primer CREPT _ R1

<400> 9

catctgcctc tctggcaaca 20

<210> 10

<211> 20

<212> DNA

<213> qPCR primer CREPT _ F2

<400> 10

ctccgcaaag ccaaatcaaa 20

<210> 11

<211> 20

<212> DNA

<213> qPCR primer CREPT _ R2

<400> 11

cgccatacac acttcgttct 20

<210> 12

<211> 21

<212> DNA

<213> qPCR primer CREPT _ F3

<400> 12

gctccgcaaa gccaaatcaa a 21

<210> 13

<211> 20

<212> DNA

<213> qPCR primer CREPT _ R3

<400> 13

gccgccatac acacttcgtt 20

<210> 14

<211> 22

<212> DNA

<213> qPCR primer CREPT _ F4

<400> 14

tgaatctgtc cttgtggatg ct 22

<210> 15

<211> 19

<212> DNA

<213> qPCR primer CREPT _ R4

<400> 15

tgtatgaact cgccgccat 19

<210> 16

<211> 19

<212> DNA

<213> qPCR primer CREPT _ F5

<400> 16

ggacccatcg tctccgtgt 19

<210> 17

<211> 19

<212> DNA

<213> qPCR primer CREPT _ R5

<400> 17

gccgccatac acacttcgt 19

Claims

1. A method of determining a surgical margin for cancer, the method comprising:

detecting the expression level of a marker in a paracancerous tissue from a subject, said marker being CREPT (tumor cell cycle-associated and expression enhancing protein) and mutants thereof having an identity of greater than 85%, greater than 90%, greater than 95%, greater than 8% or greater than 99%;

wherein the tissue that requires excision is determined when the expression level of CREPT in said paracancerous tissue is increased by 10% or more, 20% or more, 50% or more, 100% or more, or 200% or more as compared to the expression level in the control sample.

2. The method of claim 1, wherein the level of CREPT expression is elevated in the dysplastic tissue and in the paracancerous tissue in which the gene expression profile is precancerously altered but the pathology has not been altered, as compared to the level of expression in a control sample.

3. The method of claim 1, wherein the cancer is a solid cancer, such as cervical cancer, breast cancer, ovarian cancer, melanoma, colon cancer.

4. The method of claim 1, wherein the expression level of the marker is detected by one or more of:

5. Use of the marker CREPT for the preparation of a kit for determining the surgical margin of cancer for use in the method according to any one of claims 1 to 4,

the kit comprises:

a molecule that specifically recognizes said CREPT, and

reagents for conducting the CREPT detection of the CREPT-specific molecule.

6. The use of claim 5 wherein the molecule that specifically recognizes CREPT is an antibody that specifically recognizes CREPT, a small molecule compound that specifically binds to CREPT.

7. The use of claim 5, wherein said reagents to carry out the detection of CREPT by said molecule that specifically recognizes CREPT comprise: a detectable or a chromogenic label conjugated to the above-mentioned molecule specifically recognizing said CREPT or directly or indirectly specifically binding thereto.

8. A kit for determining a surgical margin for cancer, the kit comprising:

a molecule that specifically recognizes said CREPT,

9. The kit of claim 8 wherein the molecule that specifically recognizes CREPT is an antibody that specifically recognizes CREPT, a small molecule compound that specifically binds to CREPT.

10. The kit of claim 8 wherein said reagents to carry out the detection of CREPT by said molecule that specifically recognizes CREPT comprise: a detectable or a chromogenic label conjugated to the above-mentioned molecule specifically recognizing said CREPT or directly or indirectly specifically binding thereto.

11. An application of a CREPT detection reagent in preparing a kit for determining tumor surgical margins,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

12. An application of a CREPT detection reagent in preparing a kit for identifying normal tissue cells and tissue cells which have gene-level precancerous lesions,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

13. The application of a reagent for detecting CREPT in the preparation of a kit for indicating tissue cells with high risk of canceration,

the kit comprises:

reagents for conducting a detection of CREPT in a sample from a subject.

14. Use of a CREPT-detecting agent in the preparation of a kit for indicating the presence of inflammatory tissue cells,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

15. The application of a CREPT detection reagent in the preparation of a kit for indicating the enhancement of the proliferation capacity,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

16. Use of a reagent for detecting CREPT in the preparation of a kit for indicating tissue cells having reduced incidence of apoptosis,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

17. An application of a CREPT detection reagent in preparing a kit for judging the high or low risk of recurrence of paracancerous tissues,

the kit comprises:

reagents to carry out the detection of CREPT in a sample from a subject.

18. The use of any one of claims 11 to 17, wherein the CREPT-detecting reagent comprises:

reagents for performing PCR and/or qPCR on CREPT in a sample;

an antibody that specifically recognizes CREPT; or

A small molecule compound that specifically binds to CREPT.

19. The use of claim 18, wherein the antibodies that specifically recognize CREPT comprise:

a monoclonal antibody or a polyclonal antibody.

20. The use of claim 18 wherein when the CREPT-detecting agent is an antibody that specifically recognizes CREPT or a small molecule compound that specifically binds to CREPT, the kit further comprises reagents to perform the CREPT detection by said molecule that specifically recognizes CREPT comprising: a detectable or a chromogenic label conjugated or directly or indirectly specifically bound to the above-mentioned molecule which specifically recognizes said CREPT.

21. The use of claim 18, wherein when the reagents for detecting CREPT are reagents for performing qPCR on CREPT in a sample, they comprise primer pairs for performing qPCR.