CN115105522B - Application of compound NADH in preparation of medicines for treating acoustic neuropathy - Google Patents

Abstract

The application discloses application of a compound NADH in preparing a medicament for treating acoustic neuropathy. According to the research, the small molecular compound NADH can effectively improve the functions of AIFM1 mutant cells, and NADH can promote AIF dimer formation and reduce apoptosis caused by mutation. The small molecule compound NADH can be used for preparing medicines for treating auditory neuropathy, in particular to treat auditory neuropathy related to AIFM1 mutation.

Description

Application of compound NADH in preparation of medicines for treating acoustic neuropathy

Technical Field

The application relates to the technical field of biological medicine, in particular to application of a compound NADH in preparation of a medicament for treating acoustic neuropathy.

Background

Auditory neuropathy (Auditory neuropathy, AN) is a disease of dysaural functions, also known as auditory neuropathy lineage disorder (Auditory neuropathy spectrum disorder, ANSD). The clinical characteristics of the hearing loss are as follows: the Outer Hair Cell (OHC) functions normally without affecting the reception of sound waves, but the acoustic nerve function is abnormal, which is manifested by abnormal or complete disappearance of the auditory brainstem response (Auditory brainstem response, ABR), with a degree of hearing impairment or even hearing loss, accompanied by speech dysfunction and reduced resolving power. Typically, the etiology is mainly focused on partial or total functional impairment of the hearing micro-loop including Inner Hair Cells (IHC), spiral ganglions (Spiral ganglion neuron, SGN), and the signal is not normally transmitted to the cochlea through the synapse, resulting in hearing impairment. Patients suffering from the disease exhibit serious social disorders and impaired speech understanding, affecting the physical health and quality of life of the patient. Currently, the population suffering from acoustic neuropathy accounts for about 0.5% -15% of hearing impaired patients worldwide, with about 10% of hearing impaired children being acoustic neuropathy.

Auditory neuropathy is associated with a variety of factors including inheritance, immunity, poisoning, infection, metabolism, etc., with a significant proportion of the genetic factors. It is counted that about 40% of cases have a genetic basis. The genetic patterns of auditory nerves are divided into five major classes, autosomal dominant inheritance, autosomal recessive inheritance, mitochondrial inheritance, X-linked dominant inheritance and X-linked recessive inheritance. To date, scientists and doctors have discovered a number of causative genes that can lead to the development of either hereditary or non-symptomatic acoustic neuropathy (Table 1). Among these mutations, pathogenic mutations of OPA1 can lead to SGN dysfunction, but IHC and OHC function normally; pathogenic mutation of PJVK can cause impaired nerve and inner ear hair cell function in the hearing signal input process, and also affects cochlear signal amplification; pathogenic mutations in DIAPH3 can affect the hair bundle structure of IHC, resulting in impaired IHC function; the remaining pathogenic genes cannot be localized in the hair cells or ganglia alone, probably similar to PJVK, affecting the function of the entire hearing micro-loop.

TABLE 1 auditory neuropathy causative genes

In 2015, wang et al found 11 mutations associated with the onset of acoustic neuropathy. These mutations are all located in a gene designated AIFM1 (p.T260A, p.L344F, p.G360R, p.V498M, p.1591M, p.R422W, p.R422Q, p.R430C, p.R451Q, p.A472V, p.P475L) (L.Zong, et al, mutations in apoptosis-inducing factor cause X-linked recessive auditory neuropathy spectrum disorder, J Med Genet 52 (8) (2015) 523-531.). As can be seen, the Apoptisis-reduction factor (AIF) encoded by the AIFM1 gene has a very close relationship with the occurrence of acoustic neuropathy. AIF is a flavoprotein localized to the mitochondrial membrane space and was initially found as the first apoptosis factor responsible for Caspase-independent apoptosis. AIF exhibits a versatile biological activity: firstly, under the stimulation of apoptosis induction signals, participating in the regulation of a programmed cell death pathway independent of caspases; secondly, as an important oxidoreductase, a dimer form (CTC) is used as a sensor of nad+ (H) to participate in electron transfer of mitochondrial oxidative respiratory chain; thirdly, direct interaction with CHCHD4 is involved in the assembly of the mitochondrial complex.

At present, clinical intervention on acoustic neuropathy is mainly performed by Hearing Aids (HA) and Cochlea (CI). In recent years, some studies have sequentially proposed a scheme for treating auditory neuropathy with drugs. There are studies showing that the oral glycine intake of 20 grams per day improves auditory evoked potential in type 2 diabetics suffering from auditory neuropathy. In addition, trigonelline has neuroprotective, sedative, memory improving, antibacterial, and antiviral effects, and has been shown to alleviate diabetic auditory neuropathy. In 2014, research shows that the glucocorticoid is taken as a main ingredient, and the medicine for nourishing nerves and improving circulation is taken as an auxiliary ingredient, so that 11 ANSD patients are treated, and a better curative effect is achieved, and the effective rate reaches 59.09%. NAD can prevent manganese-induced axonal degeneration, avoiding or delaying hearing loss caused by excessive manganese exposure. In 2019, the study demonstrated the beneficial role of taurine in cochlear stem cell transplantation and elucidated the relationship with the Shh pathway. Taurine treatment also promotes proliferation, differentiation and neurite outgrowth of spiral ganglion progenitor cells in vitro. Recent studies have shown that rutin significantly improves auditory neuropathy. The threshold, wave latency, wave morphology, number of neurons in the spiral ganglion, and SOD and MDA activity were all improved after treatment. Researchers have further explored methods of treatment of acoustic neuropathy that target mitochondrial function, such as: antioxidant coenzyme Q associated with oxidative phosphorylation, resveratrol associated with mitochondrial metabolism, nad+, and apoptosis inhibitors, calpain inhibitors, etc. associated with apoptosis. However, drug therapy for auditory neuropathy is still in the fumbling stage and requires the search for more effective drug candidates and a large number of clinical trials.

NADH is one of the major electron donors of the mitochondrial electron transport chain and plays an important role in metabolic activity and mitochondrial function. NADH is also a key coenzyme for the redox reaction necessary for energy homeostasis. It has been shown that NADH has a direct antioxidant effect. Mitochondrial NADH inhibits the opening of mitochondrial permeability transition pores, thereby inhibiting apoptosis. And another study also demonstrated that NADH can significantly reduce poly (ADP-ribose) polymerase-1 induced astrocyte death. NADH has been widely reported in recent years as a potential treatment for neurodegenerative diseases. For example, NADH improves PD by increasing plasma L-dopa bioavailability. NADH can also improve cognitive function, with potential for the treatment of AD. There are also data showing that NADH can counteract cognitive deficits occurring during brain aging in aged rats. Additional supplementation with CoQ10 and NADH is effective in ameliorating Chronic Fatigue Syndrome (CFS). One study collected lymphocytes from healthy elderly subjects and studied the effect of NADH cell redox status. The results indicate that NADH is able to reduce oxidative stress. Studies have shown that oral NADH 5mg tablets per day are generally considered safe.

Disclosure of Invention

According to the application, through researching pathogenesis of AIFM1 mutation-related auditory neuropathy, the AIFM1 mutation (c.1265G > A/p.R422Q, c.778A > G/p.T260A, c.1264C > T/p.R422W and c.1352G > A/p.R451Q) is taken as a model, and the neurons differentiated from AIFM1 mutation (c.1265G > A/p.R422Q) iPSCs are given to the NADH small molecule compound for incubation (200 mu mol/L-500 mu mol/L), so that the functions of mutant cells can be effectively improved. Through AIF dimer crosslinking and flow cytometry experiments, it is proved that NADH can promote AIF dimer formation and reduce apoptosis caused by mutation. The application considers NADH to be a potential therapeutic drug for AIFM1 mutation-related acoustic neuropathy.

The application firstly provides application of a compound NADH in preparing a medicament for treating acoustic neuropathy.

Preferably, the acoustic neuropathy is caused by AIFM1 gene mutation. More preferably, the AIFM1 gene mutation inhibits AIF dimer formation.

Preferably, the NADH is used in an amount of 200. Mu. Mol/L to 500. Mu. Mol/L.

The application also provides a medicine for treating acoustic neuropathy, and the active ingredient of the medicine is compound NADH.

Preferably, the medicament is an oral formulation. More preferably, the medicament is an oral tablet. More preferably, the daily oral dose of compound NADH is not more than 5mg. Studies have shown that oral NADH 5mg tablets per day are generally considered safe.

According to the research, the small molecular compound NADH can effectively improve the functions of AIFM1 mutant cells, and NADH can promote AIF dimer formation and reduce apoptosis caused by mutation. The small molecule compound NADH can be used for preparing medicines for treating auditory neuropathy, in particular to treat auditory neuropathy related to AIFM1 mutation.

Drawings

FIG. 1 shows Western blot analysis of AIF dimer formation in p.R422Q stable cell lines before and after drug NADH treatment and quantitative AIF dimer analysis. A: the immunoblotting results were performed for the untreated wild-type cells, the AIF p.R422Q mutant cells, and the NADH-treated groups. B: AIF dimer quantitative analysis results.

FIG. 2 shows Western blot analysis of AIF dimer formation in p.T260A, p.R422W and p.R451Q stable cell lines before and after drug NADH treatment and quantitative AIF dimer analysis. A: wild-type cells untreated, AIF mutant cells untreated and NADH treated groups immunoblotted results. B: AIF dimer quantitative analysis results.

FIG. 3 shows the results of quantitative analysis of AIF p.R422Q mutant cell flow assay for apoptosis detection and flow assay. A: untreated wild-type cells, AIF p.r422q mutant cells untreated and NADH treated group flow results; b: quantitative analysis results of the flow chart.

FIG. 4 shows the results of quantitative analysis of AIF p.T260A, p.R422W and p.R451Q mutant cell flow charts for apoptosis detection. A: wild-type cells were untreated; b: mutant cell untreated and NADH treated streamlines; c: quantitative analysis results of the flow chart.

Fig. 5 is a flow chart for iPSCs reprogramming and neuronal differentiation. PMNCs: peripheral blood mononuclear cells; iPSCs: inducing pluripotent stem cells; h3000: a monocyte culture medium; mTesR: a pluripotent stem cell culture medium; neurobasal: neural basal medium; b27: b27 cell culture additive; glutaMAX: glutamine; NEAA: non-essential amino acids; BDNF: brain-derived neurotrophic factors; GDNF: glial cell-derived neurotrophic factor; AA: l-ascorbic acid; MEF: mouse fibroblasts; MG: inducing a matrix gel special for pluripotent stem cells; geltrex: matrigel special for neural stem cells: laminin: mouse laminin.

FIG. 6 is a western blot analysis of AIF dimer formation in neurons differentiated from iPSCs in patients before and after drug NADH treatment. A: immunoblotting results of the neuronal untreated and NADH treated groups of normal human iPSCs differentiated; b: immunoblotting results of the neuronal untreated and NADH treated groups of patients differentiated from iPSCs.

FIG. 7 shows the results of AIF dimer quantitative analysis. The proportion of AIF dimer in mutant cells by NADH treatment was 79.6.+ -. 39.9% and the proportion of untreated AIF dimer was 42.7.+ -. 7.6%. n=3, P < 0.05, P < 0.01, P < 0.001. Values are presented as mean±sd.

FIG. 8 is a flow chart for detecting apoptosis. The upper lateral Neuron-Con is a Neuron untreated and NADH treated flow result of normal human iPSCs differentiation; the lower lateral Neuron-AN is a patient iPSCs differentiated Neuron untreated and NADH treated serial flow result.

FIG. 9 is a quantitative analysis result of the flow chart. The results showed that the untreated group of neurons differentiated from patient iPSCs had an apoptosis rate of 51.8±1.4% and that the NADH treated group had an apoptosis rate reduced to 36.4±2.8%. n=3, P < 0.05, P < 0.01, P < 0.001. Values are presented as mean±sd.

Detailed Description

Example 1

Stable transfer cell line construction and drug treatment.

AIFM1 gene knockout 293T cell lines were constructed using CRISPR/Cas9 technology, sgRNA was designed as follows, sgRNA-F: CACCGCCTCGGGCTTCGGACGCACA; sgRNA-R: AAACTGTGCGTCCGAAGCCCGAGGC. The two primers have base complementary pairing regions, and the cohesive tail ends of enzyme cutting sites are additionally added during design, so that the two primers are annealed to synthesize double chains, namely the sequence of the sgRNA, and then connected with a plasmid.

Lentiviral packaging plasmids pCDH-AIF-WT and pCDH-AIF-mut were constructed and the primer designs were as shown in Table 2.

TABLE 2 primers

AIF-WT (wild-type) and AIF-mut (four point mutations, p.R422Q, p.T260A, p.R422W or p.R451Q) stable transgenic cell lines were then constructed by lentiviral infection on the basis of AIF knockout cell lines, mutations possibly affecting AIF protein dimer formation and subsequently causing apoptosis. Genomic DNA level identification shows that the AIF-mut stably transformed cell line successfully carries point mutation, and protein level identification shows that both AIF-WT and AIF-mut express AIF protein, and the expression quantity has no obvious difference. Based on the above results, AIF-WT and AIF-mut each selected a monoclonal cell line for subsequent drug treatment and functional experiments.

AIF-WT and AIF-mut stably transfected cells were subjected to digestion and counted, plated in 12-well plates at 30w per well, after 24 hours of cell attachment, the supernatant medium was discarded, 1ml of fresh medium (DMEM+10% FBS) was added to the control group, and 1ml of fresh medium containing 200. Mu. Mol/L NADH (Yesen Co., cat. No. 60301ES03) was added to the dosing group. Dimer formation and apoptosis detection were performed after a further 24h incubation. The supernatant was discarded, the cells were collected by pipetting and centrifuged, the cell pellet was washed twice with PBS, 100. Mu.l of PBS was resuspended and dimer cross-linked by adding 4mM/L DSS cross-linker, and after 30min incubation at room temperature, the reaction was stopped at 20mM/L Tris-HCl room temperature for 15 min. Conventional protein extraction and western blotting were subsequently performed. Apoptosis was detected using the apoptosis detection kit (Yeasen, cat. No. 40302ES60) and was run on-stream.

Sequencing results showed that we successfully constructed stable transgenic cell lines for AIF-WT and AIF-mut. Functional assays were performed 24 hours after incubation of AIF-WT and AIF-mut cells with NADH (200. Mu. Mol/L).

Western blotting results are shown in FIG. 1, wherein A in FIG. 1 is the immunoblotting results of the untreated wild-type cells, AIF p.R422Q mutant cells and NADH treated groups; b is the quantitative analysis result of AIF dimer. The results show that NADH promotes AIF dimer formation in AIF p.R422Q mutant cells. The AIF dimer was 96.1.+ -. 25.9% by NADH treatment and the untreated AIF dimer was 63.0.+ -. 20.9%. n=3, P < 0.05, P < 0.01, P < 0.001. Values are presented as mean±sd.

FIG. 2 shows Western blot analysis of AIF dimer formation in p.T260A, p.R422W and p.R451Q stable cell lines before and after drug NADH treatment. Panel A shows the results of immunoblots of the untreated wild-type cells, the AIF mutant cells, and the NADH treated groups. Panel B shows the results of quantitative analysis of AIF dimer. The results show that NADH promotes AIF dimer formation in both AIF p.T260A, p.R422W and p.R451Q mutant cells. The AIF dimer ratios were increased from 34.5.+ -. 3.3%, 39.5.+ -. 8.1%, 49.7.+ -. 3% to 59.1.+ -. 10.5%, 54.8.+ -. 6%, 60.5.+ -. 10% by NADH treatment, respectively. n=3, P < 0.05, P < 0.01, P < 0.001. Values are presented as mean±sd.

FIG. 3 shows the quantitative analysis results of AIF p.R422Q mutant cell flow chart for apoptosis detection and flow chart. Panel A shows the results of the flow-through of wild-type cell untreated, AIF p.R422Q mutant cell untreated and NADH treated groups; in the figure, B is the quantitative analysis result of the flow chart. The results showed that the apoptosis rate of the untreated group in AIF p.R422Q mutant cells was 13.7+ -1.0% and the apoptosis rate of NADH treated group was reduced to 9.1+ -1.4%. n=3, P < 0.05, P < 0.01, P < 0.001. Values are presented as mean±sd.

FIG. 4 shows the quantitative analysis results of AIF p.T260A, p.R422W and p.R451Q mutant cell flow assays for apoptosis patterns. In the figure, a is the untreated wild-type cells; panel B shows the results of mutant cell untreated and NADH treated flowlines; in the figure, C is the quantitative analysis result of the flow chart. The results showed that the apoptosis rate of the untreated group in the mutant cells was 13.7.+ -. 3.5%, 17.9.+ -. 4.2%, 17.1.+ -. 5.5%, respectively; the apoptosis rate of NADH treatment group is reduced to 10.0+ -3.7%, 13.6+ -3.5%, 12.0+ -2.7%, respectively. n=3, P < 0.05, P < 0.01, P < 0.001. Values are presented as mean±sd.

These results indicate that NADH, a coenzyme for AIF, can promote AIF dimerization in AIF mutant cells, thereby reducing apoptosis.

Example 2

Patient (c.1265G > A/p.R422Q) iPSCs were reprogrammed. Ethical approval: through approval by the ethical committee of the general medical hospitals of the Chinese people, the ethical approval number is as follows: and renieratene No. S2017-024-01.

Peripheral blood mononuclear cells of the patient were drawn and isolated by density gradient centrifugation, blood: lymphocyte separation (GE company, cat. No. 17-1440-03) was approximately 1:1 (volume ratio), centrifuged at 20℃and 400g for 30min, and 4 layers were seen after centrifugation: plasma-monocytes-isolates-erythrocytes, the pipette aspirates the plasma layer, aspirates the mononuclear cell layer to a new centrifuge tube.

A3 plasmid system was used: pCXLE-hOCT3/4 (1. Mu.g) (Addgene, cat. No. # 27076), pCXLE-hSK (1. Mu.g) (Addgene, cat. No. # 27078), pCXLE-hUL (1. Mu.g) (Addgene, cat. No. # 27080) were transferred to peripheral blood mononuclear cells (electrotransfer program: X unit, EO-115) using a 4D nuclear transfection kit (LONZN, cat. No. V4XP-3024). mu.L of the nuclear transfection solution was mixed with 18. Mu.L of support to give 100. Mu.L of solution, and 1. Mu.g of each plasmid was added. After about 10 days of culture, cell clones in the form of iPSCs were observed, and clones were picked up for further culture and totipotency identification and subsequent differentiation. The totipotency identification shows that the reprogrammed iPSCs highly express the totipotency marker gene: nonog, sox2,4-Oct, rex-1. Subsequent differentiation may be performed.

Example 3

Two-step differentiation of iPSCs-neural stem cells-auditory neurons.

The iPSCs obtained in example 2 were differentiated, the differentiation procedure being as shown in fig. 5, and induced continuously for 6 days using neural stem induction medium (Gibico company, cat.no. a 1647801), with fluid changes every two days. The neural stem cells of the generation P0 are obtained on the 7 th day, and the culture is continued for 5 to 7 days, so that obvious neural stem cell morphology appears, and the neural stem cells are the first generation of the neural stem cells and are marked as P1. And in the subsequent culture, when the confluence reaches 80% -90%, the neural stem cells can be subjected to passage and frozen storage. The neural stem cells within 10 generations can perform subsequent auditory neuron differentiation: the neuron differentiation medium was continuously cultured for 14 days, and the medium was changed every 2 to 3 days. The differentiation medium composition included neural basal medium (Gibico, cat. No. 21103049), B-27 (50×) (Gibico, cat. No. A3582801), glutamine (GlutaMAX) (100×) (Gibico, cat. No. 35050061), nonessential amino acids (NEAA) (100×) (Gibico, cat. No. 11140050), brain-derived neurotrophic factor (BDNF) (R & D, cat. No. 248-BDB) at 20ng/ml, glial cell-derived neurotrophic factor (GDNF) (R & D, cat. No. 212-GD) and L-Ascorbic Acid (AA) (Sigma) (Aldrich, cat. No. 50-81-7) at 200. Mu.M.

Immunofluorescence results showed that we differentiated neural stem cells, highly expressing neural stem marker genes (Sox 1, sox2, PAX6, nestin); the differentiated auditory neurons highly express auditory neuron marker genes (NeuN, TUJ1, TRKB, BRN 3A) and can be used for subsequent drug treatment and functional research.

Example 4

The patient iPSCs obtained in example 3 were treated with NADH for differentiated acoustic neurons.

After 14 days of continuous differentiation, the supernatant medium was discarded, 1ml of fresh medium (neural differentiation medium) was added to the control group, and 1ml of fresh medium containing 500. Mu. Mol/L NADH was added to the dosing group. After a further 48h incubation, dimer formation and apoptosis detection were performed. The procedure for the detection was as in example 1.

By NADH treatment of auditory neurons differentiated from patient (AIF p.R422Q) iPSCs, we obtained results consistent with AIF p.R422Q stably transformed cell lines. Western blot showed that the proportion of AIF dimer by NADH treatment was 79.6±39.9%, significantly higher than that in the untreated patient iPSCs differentiated auditory neurons (42.7±7.6%) (fig. 6, fig. 7).

The results of flow cytometry analysis further showed that after NADH treatment, the apoptosis level of the patient iPSCs differentiated auditory neurons was significantly reduced from 51.8±1.4% to 36.4±2.8% in the untreated group, whereas in normal human iPSCs differentiated neurons, there was no significant difference in apoptosis before and after NADH treatment (fig. 8, fig. 9).

These results indicate that NADH also improves cell function in neurons differentiated from patient iPSCs, promoting AIF dimerization in cells, and thus reducing apoptosis.

Sequence listing

<110> university of Zhejiang

THE SIXTH MEDICAL CENTER OF PLA GENERAL Hospital

Application of <120> compound NADH in preparing medicament for treating acoustic neuropathy

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

caccgcctcg ggcttcggac gcaca 25

<210> 2

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

aaactgtgcg tccgaagccc gaggc 25

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ggggtaccga aggaggaggt cccgaatag 29

<210> 4

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ccttaagtgc agtgggtttg ccaattcc 28

<210> 5

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ggggtaccga aggaggaggt cccgaatag 29

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

cttgtagctc tgcatttacc tggaag 26

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ggtaaatgca gagctacaag ca 22

<210> 8

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ccttaagtgc agtgggtttg ccaattcc 28

<210> 9

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ggggtaccga aggaggaggt cccgaatag 29

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gtacctcctg ctgcaatcaa gc 22

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

gcttgattgc agcaggaggt ac 22

<210> 12

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

accttaagtg cagtgggttt gccaattcc 29

<210> 13

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

ggggtaccga aggaggaggt cccgaatag 29

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

tctgcattta cccagaagcc ac 22

<210> 15

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

gtggcttctg ggtaaatgca ga 22

<210> 16

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

ccttaagtgc agtgggtttg ccaattcc 28

<210> 17

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

ggggtaccga aggaggaggt cccgaatag 29

<210> 18

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

atggtgctct acctgcctcc tt 22

<210> 19

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

aaggaggcag gtagagcacc at 22

<210> 20

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

ccttaagtgc agtgggtttg ccaattcc 28

<210> 21

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

tagaagattc tagagctagc gaattcatgt tccggtgtgg aggcctg 47

<210> 22

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

agcgatcgca gatccttcgc ggccgctgca gtgggtttgc caattcc 47

Claims (2)

1. The application of the compound NADH in preparing medicaments for treating acoustic neuropathy,

the auditory neuropathy is caused by mutations in the AIFM1 gene, which inhibit AIF dimer formation.

2. The use according to claim 1, wherein NADH is used in an amount of 200. Mu. Mol/L to 500. Mu. Mol/L.