CN115093476A

CN115093476A - Antiviral composition and application of lateolabrax japonicus II-type interferon IFN-gamma rel and receptor thereof

Info

Publication number: CN115093476A
Application number: CN202210580030.9A
Authority: CN
Inventors: 闫路路; 邱丽华; 郭杰匀; 赵超; 王鹏飞; 张博
Original assignee: South China Sea Fisheries Research Institute Chinese Academy Fishery Sciences
Current assignee: South China Sea Fisheries Research Institute Chinese Academy Fishery Sciences
Priority date: 2022-05-25
Filing date: 2022-05-25
Publication date: 2022-09-23
Anticipated expiration: 2042-05-25
Also published as: CN115093476B

Abstract

The invention discloses a lateolabrax japonicus II type interferon IFN-gamma rel and an antiviral composition of a receptor thereof and application thereof. Wherein, the nucleotide sequence of the lateolabrax japonicus II type interferon IFN-gamma rel is shown as SEQ ID NO. 1; the nucleotide sequence of the receptor CRFB6 is shown as SEQ ID NO. 3; the nucleotide sequence of the receptor CRFB13 is shown in SEQ ID NO. 5; the nucleotide sequence of the receptor CRFB17 is shown in SEQ ID NO. 7. The antiviral composition comprises weever interferon IFN-gamma rel and weever II-type interferon receptors, wherein the weever II-type interferon receptors are one or the combination of more than two of CRFB6, CRFB13 and CRFB 17. The application is the application of the antiviral composition containing the weever interferon IFN-gamma rel and the receptor thereof in the preparation of aquatic animal antiviral drugs. The antiviral composition can obviously reduce the copy number of the LBUSV virus in spleen, liver and head kidney tissues of the lateolabrax japonicus after infecting the young lateolabrax japonicus, and simultaneously can reduce the copy number of the LBUSV virus in the head kidney cells and arterial ball cell lines of the lateolabrax japonicus after infecting the lateolabrax japonicus, thereby not only enhancing the virus antagonistic capability of the lateolabrax japonicus, but also improving the virus antagonistic capability of other aquatic animals.

Description

Anti-virus composition and application of type II interferon IFN-gamma rel and receptor thereof of lateolabrax japonicus

Technical Field

The invention relates to interferon, a receptor and application thereof, in particular to Lateolabrax japonicus type II interferon IFN-gamma rel and the receptor thereof, and also relates to an antiviral composition containing the Lateolabrax japonicus type II interferon IFN-gamma rel and the receptor thereof and application thereof.

Technical Field

Lateolabraxmacutus (Lateolabraxmacutus), also known as sea bass, belongs to wide-temperature and wide-salinity fish, has good nutritional value and culture value, and is one of important cultured fishes in coastal areas of China. With the vigorous development of marine fish farming, the increase of the farming area and density is accompanied with the occurrence of fish diseases. The outbreak of diseases, particularly virus diseases, in the weever culture process is increased, and the development of the weever culture industry is seriously influenced. The basic research is important to solve the industrial problems, wherein the research on fish virus pathogenesis and lateolabrax japonicus immunity mechanism is concerned.

Interferons (IFNs) are class II α -helical cytokines with antiviral activity, glycoproteins produced by immune cells of the body stimulated by IFN-inducing agents. IFN does not directly play an immune role, but indirectly plays an antiviral role by binding with a target cell surface receptor and mediating the cell to produce a plurality of cytokines including various chemokines, transcription regulators and the like, and is an important component of the immune system of vertebrates. To date, three types of IFNs, i.e., type I, type II and type III, have been reported based on the function of their receptor and signaling pathways in mammals and birds. Among them, type I and type III IFNs are specific innate anti-viral cytokines that differ primarily in tissue distribution and target cell differentiation. In contrast, type II IFN is a key immunomodulatory factor that regulates the body's innate and adaptive immune system during viral and bacterial infections. Currently, only one type of type II IFN is found in mammals, being IFN-gamma (IFN- γ), encoded by a single copy of a gene, and whose genomic structure contains 4 exons and 3 introns. Unlike mammals, type II IFNs in teleost fish contain two members, IFN-gamma and IFN-gamma related factors (IFN-gamma rel). IFN-gamma rel was first discovered adjacent to the IFN-gamma gene when co-linear analysis was performed on the genomes of zebrafish and green globefish. Further analysis revealed that IFN- γ and IFN- γ rel are conserved in gene structure, both are composed of 4 exons and 3 introns, and the first intron is a phase 0 intron. IFN-gamma rel is located upstream of IFN-gamma gene in genome, and has a colinear relationship with IFN-gamma. IFN- γ rel contains an IFN- γ tagging motif, similar to the IFN- γ sequence.

IFN-gamma is specifically identified by IFN-gamma receptor (IFN-gamma Rs) and then combined to form a receptor-ligand complex, and then JAK-STAT signal pathway protein phosphorylation modification is promoted to be activated, and IFN Stimulating Gene (ISGs) expression is induced. In mammals, the type II IFN receptor consists of two ligand binding chains (IFN-. gamma.R 1/IFNGR1) and two signal transduction chains (IFN-. gamma.R 2/IFNGR2), both of which are members of the type II cytokine receptor family, known in fish as the fish Cytokine Receptor Family B (CRFB). Wherein IFN-gamma R1 directly binds to dimerized IFN-gamma, and IFN-gamma R2 assists in signal transduction. In mammals, there is only one IFN- γ R1. In teleost fish the IFN-. gamma.R 1 gene was replicated in two copies according to phylogenetic and colinear analyses, designated CRFB13/IFNGR1-2 and CRFB17/IFNGR1-1, respectively. Fish IFN-. gamma.R 2(CRFB6) has been identified in zebrafish, grass carp, rainbow trout and Acipenser dabryanus. The current model for teleost type II IFN ligand-receptor complexes is still unclear, only species-specific ligand-receptor binding, such as goldfish IFN- γ and IFN- γ rel, can bind CRFB13 and CRFB17, respectively, in vitro, and no activity is detected when the receptors are cross-linked. However, in zebrafish, CRFB17 has a significant effect on the function and signaling of IFN- γ and IFN- γ rel, while IFN- γ also requires CRFB13 to transmit signals. In lateolabrax japonicus, the mode of interaction and function of type II IFN and its receptor is unknown. The research on the II-type interferon immune system of the lateolabrax japonicus is beneficial to improving the prevention and control of viral diseases of the lateolabrax japonicus.

Disclosure of Invention

One of the purposes of the invention is to provide Lateolabrax japonicus type II interferon IFN-gamma rel. Specifically, the nucleotide sequence of Lateolabrax japonicus type II interferon IFN-gamma rel is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2.

The second purpose of the invention is to provide a receptor of Lateolabrax japonicus type II interferon IFN-gamma rel, comprising CRFB6, the nucleotide sequence of which is shown in SEQ ID NO.3, and the amino acid sequence of which is shown in SEQ ID NO. 4; the nucleotide sequence of CRFB13 is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO. 6; the nucleotide sequence of CRFB17 is shown in SEQ ID NO.7, and the amino acid sequence is shown in SEQ ID NO. 8.

It is a further object of the present invention to provide an antiviral composition comprising the lateolabrax japonicus interferon IFN- γ rel and its receptor.

Specifically, the antiviral composition containing the weever interferon IFN-gamma rel and the receptor thereof comprises the weever interferon IFN-gamma rel and a weever II-type interferon receptor, wherein the weever II-type interferon receptor is one or a combination of more than two of CRFB6, CRFB13 and CRFB 17.

Preferably, the antiviral composition comprising weever interferon IFN- γ rel and its receptors is a combination of weever interferon IFN- γ rel with all receptors comprising CRFB 17. All receptor combinations comprising CRFB17 include CRFB17, or a combination of CRFB6 and CRFB17, or a combination of CRFB13 and CRFB17, or a combination of CRFB6, CRFB13 and CRFB 17.

More preferably, the antiviral composition comprising lateolabrax japonicus interferon IFN- γ rel and its receptor comprises lateolabrax japonicus interferon IFN- γ rel, CRFB13 and CRFB 17.

The fourth object of the present invention is to provide the use of an antiviral composition comprising the lateolabrax japonicus interferon IFN- γ rel and its receptor. Specifically, the antiviral composition containing the lateolabrax japonicus interferon IFN-gamma rel and the receptor thereof is applied to the preparation of aquatic animal antiviral drugs; the antiviral composition containing the lateolabrax japonicus interferon IFN-gamma rel and the receptor thereof is applied to the preparation of the medicine for enhancing the antiviral immunity of aquatic animals.

The virus is Largemouth Bass Ulcerative Syndrome Virus (LBUSV).

The invention has the advantages that:

1. the anti-LBUSV virus composition containing the weever interferon IFN-gamma rel and the receptor thereof provided by the invention can obviously reduce the copy number of the LBUSV virus in spleen, liver and head kidney tissues of the weever infected with young weever, and can also reduce the copy number of the LBUSV virus in head kidney cells and an arterial ball cell line of the weever infected with young weever. Has better effect on the induction of downstream antiviral genes (Mx, IRF1 and ISG15), wherein the combination consisting of IFN-gamma rel + CRFB13+ CRFB17 has the best effect on the induction of the downstream antiviral genes (Mx, IRF1 and ISG15) and has the lowest virus copy number on virus infected phoxinus cephalospora muscle cells (FHM).

2. The antiviral composition containing the weever interferon IFN-gamma rel and the receptor thereof provided by the invention not only can enhance the virus antagonistic capability of the weever, but also can improve the virus antagonistic capability of other aquatic animals.

Drawings

Figure 1 is an expression analysis of LmIFN- γ rel in different tissues. Different letters indicate significant differences between groups (P < 0.05).

Figure 2-1 is the spatiotemporal expression of lmfn- γ rel under LBUSV viral infection (.;. P < 0.05;. P < 0.01).

FIG. 2-2 is the spatiotemporal expression of LmIFN-. gamma.rel under LBUSV virus infection of LMK cells and LMAB cell line. Equal volume of PBS was used as control group (. P < 0.05;. P < 0.01).

FIG. 3-1 shows SDS-PAGE analysis and Western immunoblotting of LmIFN-. gamma.rel after disruption of the bacterial cells and protein purification.

M: marker; a, crushing thalli; b, protein purification; c, lane 1: LmIFN-. gamma.rel protein immunoblotting.

Figure 3-2 is an SDS-PAGE analysis and western blot of the purified LmCRFBs protein.

M: marker; a, lane 1: LmCRFB 13; lane 2: LmCRFB 6; lane 3: LmCRFB 17; b, lane 1: LmCRFB 6; lane 2: LmCRFB 13; lane 3: LmCRFB 17.

FIGS. 3-3 are SDS-PAGE analysis and Western immunoblotting of LmIFN-. gamma.rel-GST protein purification.

M: marker; lanes 1-2: LmIFN-gamma rel-GST.

FIG. 4-1 shows the ISGs gene expression changes after in vivo injection of LmIFN-. gamma.rel-His recombinant protein. Panels A, B, C represent liver, spleen and head kidney, respectively. Equal volumes of PBS were injected as control group (. P < 0.05;. P < 0.01).

FIG. 4-2 shows ISGs and STAT1 gene expression after LMK cells and LMAB cell lines of lateolabrax japonicus are incubated by recombinant protein LmIFN-gamma rel-His. The control group was equal volume of PBS (. P < 0.05;. P < 0.01).

Figure 4-3 is the effect of recombinant protein LmIFN-. gamma.rel-His on the proliferation of LBUSV virus. Panels a, B and C represent liver, spleen and cephalic kidney, respectively (P < 0.05;. P < 0.01).

Figure 5-1 is the in vitro interaction of LmIFN-. gamma.rel with LmCRFBS protein.

Pull-down experiments: and LmIFN-gamma rel-GST recombinant proteins on the magnetic beads are respectively combined with LmCRFBS-His and His proteins, after denaturation and elution, protein complexes are dissociated, and Western Blotting is respectively carried out by using His antibodies and GST antibodies to verify whether target proteins exist in an elution mixture.

Lane 1: LmCRFB 13-His; lane 2: LmCRFB 6-His; lane 3: LmCRFB 17-His; lane 4: his-tag.

Figure 5-2 shows the combined transfection of the LmIFN- γ rel eukaryotic expression plasmid with different receptors. IFN expression plasmids were co-transfected with pcDNA3.1 empty vector as control (. P < 0.05;. P < 0.01).

FIG. 5-3 is an antiviral assay for pcDNA3.1-LmIFN-. gamma.rel in FHM cells. IFN expression plasmids were co-transfected with pcDNA3.1 empty vector as control (. P < 0.05;. P < 0.01).

Figure 6 is an amino acid multiplex alignment of LmIFN-. gamma.rel with IFN-. gamma.rel from other species.

Figure 7 is a multiple sequence alignment of LmCRFB6 with CRFB6 amino acids from other species.

Figure 8 is a multiple sequence alignment of LmCRFB13 with CRFB13 amino acids from other species.

Figure 9 is an amino acid multiple sequence alignment of LmCRFB17 with CRFB17 of other species.

Detailed Description

The technical solution of the present invention will be further illustrated and described with reference to the accompanying drawings by the following detailed description.

The cDNA of Lateolabrax japonicus II type interferon IFN-gamma rel and receptor genes CRFB6, CRFB13 and CRFB17 thereof can be prepared by the following method:

according to the EST sequences of II type interferon IFN-gamma rel and cytokine family B (CRFBS) in the constructed weever cDNA library, after the EST sequence of the target gene is verified, PCR primers are designed, and Open Reading Frame (ORF) sequences of the IFN-gamma rel, CRFB6, CRFB13 and CRFB17 genes of the weever are respectively obtained by combining a gene cloning technology. The full length of the OFR of the Lateolabrax japonicus IFN-gamma rel gene is 564bp, 187 amino acids are coded, and the molecular weight of the protein coded by the Lateolabrax japonicus IFN-gamma rel is predicted to be 20.60 KD. The total length of the CRFB6 gene OFR is 864bp, 287 amino acids are coded, and the molecular weight of the coded protein of the weever CRFB6 is predicted to be 32.38 KD. The ORF of the weever CRFB13 gene is 1248bp long, 415 amino acids are coded, and the molecular weight of the protein coded by the weever CRFB13 is predicted to be 46.19 KD. The overall length of OFR of the weever CRFB17 gene is 1209bp, 402 amino acids are coded, and the molecular weight of the encoded protein of the weever CRFB17 is predicted to be 44.70 KD.

The cDNA and amino acid sequences of LmIFN- γ rel (where Lm refers to Lateolabrax japonicus) are as follows. The start and stop codons are boxed, the predicted signal peptide is shown in bold, and the predicted N-glycosylation site is shown as a wavy line.

The cDNA and amino acid sequence of LmCRFB6 are as follows. The start and stop codons are boxed, the single line indicates the predicted signal peptide, the transmembrane region amino acid sequence is boxed, and the prediction Y is circled.

The cDNA and amino acid sequence of LmCRFB13 are as follows. The start and stop codons are boxed, the single line indicates the predicted signal peptide, the transmembrane region amino acid sequence is boxed, and the prediction Y is circled.

The cDNA and amino acid sequence of LmCRFB17 are as follows. The start and stop codons are boxed, the single line indicates the predicted signal peptide, the transmembrane region amino acid sequence is boxed, and the prediction Y is circled.

1. Extraction of tissue total RNA and cDNA template preparation

1.1 extraction of Total RNA

The body mass of the lateolabrax japonicus is 30 +/-5 g, the body length is 10 +/-5 cm, and the lateolabrax japonicus is temporarily cultured in a 500L plastic bucket with the temperature of 27 +/-1 ℃ and the salinity of 2.3 per mill before the experiment. 2/3 of culture water is changed every day, and the lateolabrax japonicus is temporarily cultured for one week for subsequent experiments. Randomly selecting 3 healthy lateolabrax japonicus, anesthetizing for 2min by using 50mg/mL MS222, taking gill, brain, liver, muscle, heart, spleen, head kidney, stomach, skin, intestine, blood cell, eye and fin tissues, immediately placing the tissues into liquid nitrogen for temporary storage, and then extracting the total RNA of each tissue by using Trizol reagent according to the instruction. And (3) detecting the concentration, purity and integrity of the extracted total RNA, and freezing and storing the total RNA in a refrigerator at the temperature of-80 ℃ for later use after the total RNA is detected to be qualified.

1.2cDNA template preparation

Using PrimeScript ^TM II 1st Strand cDNA Synthesis Kit (TaKaRa, Japan) according to the instruction, 1. mu.g of total RNA was reacted at 42 ℃ for 1 hour under the action of reverse transcriptase to synthesize a cDNA template.

2. Cloning of cDNA sequences of Lateolabrax japonicus type II interferon IFN-gamma rel and receptor CRFBs

2.1 validation of ORF sequences

In a weever transcriptome database, splicing sequences of IFN-gamma rel, CRFB6, CRFB13 and CRFB17 are obtained according to gene annotation information, specific primers are designed according to the splicing sequences, the primer sequences are shown in the table below, and the amplification sizes are 564bp, 864bp, 1248bp and 1209bp respectively.

The synthesized cDNA is used as a template, and PCR amplification is carried out by using a specific primer, wherein the reaction system is as follows: mu.L of cDNA template, 1. mu.L of each of 10nmol/L of upstream and downstream primers, 2. mu.L of 10mmol/L dNTP, 2.5. mu.L of 10 XExtaq buffer, and 17. mu.L of ultrapure water, for a total of 25. mu.L. The PCR reaction conditions are as follows: denaturation at 95 deg.C for 3 min; high temperature denaturation at 95 ℃ for 30s, low temperature annealing at 58 ℃ for 30s, and extension at 72 ℃ for 1min for 30s for 35 cycles; extending for 5min at 72 ℃; keeping the temperature at 4 ℃. And after the amplified PCR product is detected to be qualified by 1.5 percent agarose gel electrophoresis, purifying and recovering the PCR product of the target fragment from the gel. Then the purified PCR product is connected to a pMD18-T vector, then transformed into an escherichia coli competent cell DH-5 alpha, a single strain of a positive clone is selected according to the blue-white spot screening, the single strain is shaken for 4h in a cell culture box with the temperature of 37 ℃ and the rpm for amplification culture, plasmid DNA is extracted, and sequencing is carried out by using a universal primer M13.

2.3 bioinformatics analysis of Lateolabrax japonicus IFN-. gamma.rel and the receptor CRFBs

Homology analysis was performed using Blast (https:/Blast. ncbi. nlm. nih. gov/Blast. cgi), and the results showed that the IFN-. gamma.rel gene has high homology with IFN-. gamma.rel genes such as Japanese lateolabrax, mandarin fish, striped rock bream, snakehead, gold-headed sea bream, and spotted grouper, and it was revealed that the gene was an IFN-. gamma.rel gene. The CRFB6 gene has high homology with CRFB6 genes such as east star macule, epinephelus lanceolatus, largehead bass, gram dart perch and mandarin fish, and the CRFB6 gene is revealed. The CRFB13 gene has high homology with CRFB13 such as mandarin fish, whitefly bass, Japanese perch, sebastes dorsalis, chinchilla and eastern star spot, and the like, and the CRFB13 gene is revealed. The CRFB17 gene has high homology with CRFB17 genes of mandarin fish, swordfish, sebastes pellegeli, ophthalmus double-sawfish, water-jetting fish, chinchilla and the like, and the CRFB17 gene is revealed.

The first 21 amino acids (MSPCCGSVCLLVLLGVVLASG) at the N terminal of the LmIFN-gamma rel protein are predicted to be signal peptides by SignalIP. The functional domain predicts that the protein contains two N-glycosylation sites (Asn62 and Ans75), with amino acids in the 10-164 region being the B-Box domain and amino acids in the 40-157 region being the FABD binding domain, consisting of four inverted alpha-helices.

The first 16 amino acids (MLFFVLWFHAAGQVLS) of the N end of the LmCRFB6 protein are predicted to be signal peptides by SignalIP. The ectodomain sequence comprises a 213 amino acid, 23 amino acid transmembrane region sequence, and a 51 amino acid endodomain sequence. Functional domains predict that amino acids in the 1-99 and 114-202 regions of the protein are the superfamily domains of the FN3 protein. The first 25 amino groups (MDPGGGFPPVVLLLSALLLLLRASA) at the N end of the LmCRFB13 protein are predicted to be Signal peptides by Signal. 235 amino acids in the first 27-261 region are used as the intracellular domain sequence, 23 amino acids in the middle 262-284 region are used as the transmembrane region sequence, and 131 amino acids in the later 285-415 region are used as the extracellular domain sequence. Functional domains predict that amino acids in the 132-202 region of the protein are domains of the FN3 protein superfamily. The Signal predicts that the first 19 amino groups (MLLEGAFTALLLLVCGVPA) at the N end of the LmCRFB17 protein are Signal peptides. The first 28-230 region has 203 amino acids as the intracellular domain sequence, the middle 1-253 region has a 23 amino acid transmembrane region sequence, and the second 254-402 region has 149 amino acids as the extracellular domain sequence. Functional domains the amino acids in the 22-102 region of the protein are predicted to be the FN3 protein superfamily domain.

The following is a multiple amino acid sequence alignment of LmIFN-. gamma.rel with IFN-. gamma.rel from other species in FIG. 6.

LmCRFB6 was aligned in multiple amino acid sequences with CRFB6 from other species, as shown in FIG. 7. LmCRFB13 was aligned in multiple amino acid sequences with CRFB13 from other species, as shown in FIG. 8. LmCRFB17 was aligned in amino acid multiple sequences with CRFB17 from other species, as shown in FIG. 9.

qPCR detection of the distribution of Lateolabrax japonicus IFN-gamma rel and receptor CRFBs in different tissues of Lateolabrax japonicus

Respectively taking RNA of gill, brain, liver, muscle, heart, spleen, head and kidney, stomach, skin, intestine, blood cell, eye and fin tissues of the lateolabrax japonicus. Using PrimeScript ^TM The RT Master Mix kit (TaKaRa, Japan) was prepared by adding water to a mixture of 500ng of RNA and reverse transcriptase (5 XPrimeScript RT Master Mix (Perfect read Time) 2. mu.L) according to the instructions. The reaction process is 15min at 37 ℃ and 5s at 85 ℃, and the diluted solution is used as a template after being diluted by 10 times.

Amplifying IFN-gamma rel gene by using primers IFN-gamma rel-qF and IFN-gamma rel-qR and amplifying CRFB6 gene by using CRFB6-qF and CRFB6-qR by using real-time fluorescent quantitative PCR; CRFB13 gene was amplified using primers CRFB13-qF and CRFB13-qR, and CRFB17 gene was amplified using primers CRFB17-qF and CRFB17-qR, the sequences of the primers are shown in the following table. The amplified reference gene RPL19 was used as an internal reference, and the above-mentioned synthesized cDNA was used as a template. The reaction total was 12.5. mu.L, containing 6.25. mu.L of 2 XSSYBRGreenpro Taq Hs premix (Ecoyol), 2. mu.L of cDNA template, 0.5. mu.L of 10. mu. mol/L forward and reverse primers, and 3.25. mu.L deionized water. The qPCR reaction condition is pre-denaturation at 95 ℃ for 30 s; denaturation at 94 ℃ for 5s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for a total of 40 cycles. The dissolution curve analysis was 65-95 ℃ to ensure amplification of each single product. Through 2 ^-ΔΔCt The method analyzes the relative expression level of the IFN-gamma rel and the receptor gene of the lateolabrax japonicus. The results are shown in FIG. 1, and it can be seen that there is expression in all tissues tested. Wherein IFN-gamma rel has the highest expression level in gills, and then stomach and liver; CRFB6 was expressed in the gill with the highest expression, followed by the stomach and head kidney; CRFB13 was expressed in the highest amount in the head kidney, followed by spleen and liver; CRFB17 was expressed in the gill in the highest amount, followed by the stomach and eyes.

Expression analysis of Perch IFN-gamma rel and receptor CRFBmRNA in virus infection by qPCR detection

Changes in expression of LmIFN- γ rel (where Lm refers to lateolabrax japonicus) and LmCRFBs after in vivo and in vitro viral infection were detected by intraperitoneal injection of virus into lateolabrax japonicus and infection of the lateolabrax japonicus head kidney primary cells (LMK, immune tissue cells) and the latebrax japonicus arterial ball cell line (LMAB, non-immune tissue cells) with virus in vitro. In vivo experiments: 30 +/-5 g of healthy Lateolabrax japonicus in body mass is injected with 800 muL of LBUSV (3.0X 08 copies/. mu.L) virus and Poly I: C (1mg/mL) in the abdominal cavity, a control group is injected with the same amount of PBS, and after injection, the head kidney, spleen and liver tissues are taken at the time points of 0h, 6h, 12h, 24h, 48h and 72h and are quickly frozen in liquid nitrogen. In vitro experiments, LMK cells and LMAB cell lines were seeded in 6-well plates, cultured overnight, infected with LBUSV virus, and then collected at 0h, 12h, 24h, and 48h, respectively, and control groups were added with equal amounts of PBS per well, and RNA extraction and reverse transcription were performed as described above. Meanwhile, RPL19 is selected as an internal reference gene, and the internal reference gene primer is shown in the specification. The quantitative system and the reaction procedure were as described above. The results are shown in FIGS. 2-1 and 2-2.

The expression level of LmIFN-gamma rel and receptor (LmCRFB6, LmCRFB13 and LmCRFB17) genes in liver, spleen and head kidney tissues of largemouth bass are obviously up-regulated under the stimulation of LBUSV virus and Poly I: C, but the expression patterns are different. Wherein in the liver, the expression level of LmIFN-gamma rel is obviously up-regulated at 3d after virus infection; LmIFN- γ rel was significantly up-regulated in spleen and head kidney 6h after viral infection; under Poly I: C stimulation, LmIFN-gamma rel was significantly up-regulated in liver, spleen and head kidney tissues. After virus infection of lateolabrax japonicus LMK cells and LMAB cell lines, LmIFN-gamma rel is obviously up-regulated in expression level at 12 h.

The receptors LmCRFB6, LmCRFB13 and LmCRFB17 were significantly up-regulated in liver, spleen and head kidney tissues following viral and Poly I: C stimulation. In LmMK cells, the levels of LmCRFB6, LmCRFB13, and LmCRFB17 gene expression were significantly up-regulated compared to the control group at 12h post-viral infection; in LMAB cell line, at 12h after virus infection, the levels of LmCRFB13 and LmCRFB17 gene expression were significantly up-regulated compared to the control group, with normal levels of LmCRFB 6.

5. Preparation of Lateolabrax japonicus IFN-gamma rel and recombinant proteins of receptors CRFB6, CRFB13 and CRFB17 thereof

Taking cDNA as a template, amplifying all ORFs of IFN-gamma rel and receptor ectodomain thereof by PCR, adding enzyme cutting sites in front of primers, wherein the PCR primers are respectively as follows:

the PCR reaction conditions were 95 ℃ for 3min, 94 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 50s, for 30 cycles. LmIFN-gamma rel, LmCRFB6, LmCRFB13 and LmCRFB17 PCR products are cloned into pET21a vector plasmid to form recombinant plasmids pET21 a-LmIFN-gamma rel, pET21a-LmCRFB6, pET21a-LmCRFB13 and pET21a-LmCRFB 17. Then cloning the LmIFN-gamma rel PCR product into pGEX-4T vector plasmid to form recombinant plasmid pGEX-LmIFN-gamma rel. The recombinant plasmids pET21 a-LmIFN-gamma rel, pET21a-LmCRFB6, pET21a-LmCRFB13, pET21a-LmCRFB17 and pGEX-LmIFN-gamma rel were transformed into E.coli BL21(DE3) strain. Five types of E.coli BL21 cells were expanded in LB medium containing 100. mu.g/mL ampicillin. When the OD600 of the E.coli BL21 cell solution reached between 0.6 and 0.8, isopropyl-. beta. -D-thiogalactopyranoside (IPTG) was added to LB medium at a final concentration of 0.6mol/L, and induced for expression at 37 ℃ and 220rpm for 12 hours. LmIFN-. gamma.rel-His, LmCRFB6-His, LmCRFB13-His and LmCRFB17-His recombinant proteins were purified by Ni-NTA affinity chromatography according to the His-binding Purification Kit instructions (Beijing kang was a century). The purified protein was verified by SDS-PAGE and Western blot to show a thicker band at approximately 27kD, 35kD, 30kD and 27kD, respectively. The sizes of the four proteins are close to the theoretical value of the recombinant protein (figures 3-1 and 3-2), and an improved BCA protein assay kit (TaKaRa) is used for detecting LmIFN-gamma rel-His and LmCRFB6-His, LmCRFB13-His and LmCRFB17-His recombinant protein concentration, the purified recombinant protein is stored in an ultra-low temperature refrigerator at-80 ℃ for standby. According to Beyogold ^TM GST-tag Purification Resin (Biyunyun day) purified LmIFN-. gamma.rel-GST recombinant protein with a band around 46kDa (FIGS. 3-3).

Study of the immune function of LmIFN-. gamma.rel-His protein

5.1 LmIFN-Gamma rel-His protein induces the expression of ISGs

By injecting LmIFN-gamma rel recombinant protein into the abdominal cavity of the lateolabrax japonicus and incubating LMK cells and LMAB cell lines with the recombinant protein in vitro, the expression changes of ISGs after in vivo and in vitro induction are respectively analyzed. In vivo experiments: the experimental lateolabrax japonicus is injected with LmIFN-gamma rel-His recombinant protein (2 mu g/g), and liver, head kidney and spleen tissues of the lateolabrax japonicus are taken at 6h, 12h, 24h, 48h and 72h respectively. Three fish were taken per time group to reduce individual variation. In vivo experiments: to 6-well plates, LmIFN-. gamma.rel was added at a final concentration of 2. mu.g/mL for induction treatment, and an equal volume of PBS was added as a control to the control group, and all experiments were set up in 3 replicates and incubated at 28 ℃. And sampling after 6h, 12h, 24h and 48h of incubation, extracting total RNA of tissues and cells, and detecting ISGs and STAT1 gene expression by qRT-PCR. The results show that: both in vivo and in vitro, LmIFN-. gamma.rel-His recombinant proteins activated the expression of downstream ISGs and STAT1 genes (FIGS. 4-1, 4-2). The primers for the ISGs and STAT1 genes are as follows:

5.2 LmIFN-gamma rel-His recombinant protein anti-LBS UV immune protection effect analysis

And (3) injecting LmIFN-gamma rel-His recombinant protein into the abdominal cavity of the lateolabrax japonicus before attacking the toxicity in the lateolabrax japonicus for 6h to further determine the immune protection effect of the LmIFN-gamma rel-His recombinant protein on the lateolabrax japonicus. LmIFN-gamma rel-His recombinant protein (2 mu g/g) is injected into the abdominal cavity, the control group is injected with PBS with the same amount, 200 mu L LBUSV (3.0 multiplied by 105 copies/mu L) virus is injected into the abdominal cavity after 6h, and the head kidney, the spleen and the liver tissues of the lateolabrax japonicus are taken at 0h, 12h, 1d, 2d, 3d and 5d after challenge respectively and are used for detecting the copy number of the LBUSV. Three fish were taken per time group to reduce individual variation (fig. 4-3).

Primer:

LBUSV F：TGGAACGAGTACACCATGCC

LBUSVR：GACCCTAGCTCCTGCTTGAC

interaction and transcriptional Regulation assay of LmIFN- γ rel with receptors

6.1 LmIFN-. gamma.rel interaction with the receptor

To verify whether LmIFN-. gamma.rel binds to the extracellular domain of LmCRFB6, LmCRFB13, LmCRFB17 in vitro, the present experiment performed Pull-down experiments with LmIFN-. gamma.rel-GST protein and three receptors, LmCRFB6-His, LmCRFB13-His and LmCRFB17-His, respectively. mu.L of LLmIFN-. gamma.rel-GST protein was added to 100. mu.L of equilibrated GST bead. Slowly shaking the mixture on a side shaking table for 1-2h at 4 ℃. 13000g, 1min, centrifuge and discard the supernatant. PBS was washed three times. 100 μ LLmCRFB6-His, LmCRFB13-His and LmCRFB17-His proteins were added to each 2mL centrifuge tube and resuspended by pipetting. His-tag protein served as control. The mixture was shaken slowly overnight at 4 ℃ on a side-shaking table. 13000g, 1min, discard the supernatant. PBS was washed three times. Protein loading buffer was added directly to the Beads, boiled and run on SDS-PAGE gels. The results showed that LmIFN-. gamma.rel-GST was detected in the LmCRFB6-His, LmCRFB13-His and LmCRFB17-His fusion protein groups, but no target protein band was detected in the His group, indicating that the target proteins LmIFN-. gamma.rel-GST and LmCRFB6-His, LmCRFB13-His and LmCRFB17-His were directly bound in vitro in the three receptor extracellular domains (FIG. 5-1).

6.2 use of LmIFN-. gamma.rel preferred receptors

At present, the ligand-receptor relationship in the fish type II IFN system is still unknown, and which receptor complexes preferentially bind IFN- γ rel requires further investigation. The IFN participating receptor downstream signal pathway JAK-STAT pathway is relatively conserved in different fishes, so that the receptor use condition of Lateolabrax japonicus type II IFNd is detected by using a fish FHM cell line. The ORFs of LmIFN-gamma rel, LmCRFB17, LmCRFB13 and LmCRFB6 were cloned into pCDNA3.1-Myc-His (-) vectors, then pcDNA3.1-LmIFN-gamma rel ligands were co-transfected into FHM cells with different receptor combinations, empty vector pCDNA3.1-Myc-His (-) as blank group, LmIFN-gamma rel + empty as control group, and all experiments were set up in 3 replicates. Cells were harvested 48h after transfection. The results show that LmIFN- γ rel in combination with the receptors LmCRFB17, LmCRFB6+ LmCRFB17 and LmCRFB6+ LmCRFB13+ LmCRFB17 simultaneously induces the expression of the ISGs gene in FHM cells (fig. 5-2).

Using cDNA as a template, amplifying all ORFs of IFN-gamma rel and receptors CRFB6, CRFB13 and CRFB17 thereof by PCR, adding enzyme cutting sites in front of primers, wherein the PCR primers are respectively as follows:

the fluorescent quantitative PCR primer related to ISGs gene expression in FHM cells is as follows:

use of 6.3 LmIFN-gamma rel in antiviral combinations with receptors

Based on the above research results, we cotransfect FHM cells with pcDNA3.1-LmIFN-gamma rel eukaryotic expression plasmid and different receptor combinations. FHM cells are inoculated on a 12-well plate, after overnight culture, pcDNA3.1-LmIFN-gamma rel expression plasmids and different receptors are cotransfected for 48h respectively, LBUSV virus is used for infecting for 72h and then virus copy number detection is carried out, empty vector pCDNA3.1-Myc-His (-) + isometric PBS is used as a blank group, LmIFN-gamma rel + idle load + isometric PBS is used as a control group, and 3 parallel experiments are set. The results show that the virus copy number of LBUSV is significantly reduced in cells transfected with LmIFN- γ rel in combination with LmCRFB17, LmCRFB6+ LmCRFB17, LmCRFB13+ LmCRFB17 and LmCRFB6+ LmCRFB13+ LmCRFB17 (fig. 5-3), where the combination of LmIFN- γ rel + LmCRFB17+ LmCRFB13 was most effective in inhibiting virus replication, indicating that LmIFN- γ preferentially signals in combination with LmCRFB17+ LmCRFB 13.

Sequence listing

<110> research institute for south China sea aquatic products

<120> Lateolabrax japonicus type II interferon IFN-gamma rel and antiviral composition and application of receptor thereof

<160> 66

<170> SIPOSequenceListing 1.0

<210> 1

<211> 564

<212> DNA

<213> Lateorax maculotus)

<400> 1

atgtctccgt gctgtggttc agtgtgtctt ctggtcttac tgggagttgt gttggcatct 60

gggggtcctg tccagttcgt ctctgagaac atgaaacaaa cccacgagtc catcgcagat 120

gtgttgaagt tgaagtcggg ccttggtcat aaccctctct tcagttctgt catgaagagc 180

atcaacacct cctgccagag aaaagaagaa atacagctga tgaatgtcac tctggacatc 240

tacatgcgca tcttctccag catcctgcag agcaaccacg acgaggccgg gagcgagcct 300

ctgctggatc acctgtccga ctctgaaaag actcaggtga ggtcggatct gacgaagctc 360

cagaaaaaga tggagaagct gaagagtcac ctgggccaac tgaacaccca caaagaggat 420

gtgctcagca agctgaacaa aatccaggtg gacgaccccc tggttcagag aaaagctctg 480

gctgagtaca aagagatcta ccaggcggct tctgtgattg gcgcccgcag ctgtggacac 540

gcccacttgt cttcctctga atga 564

<210> 2

<211> 187

<212> PRT

<213> Lateorax maculotus)

<400> 2

Met Ser Pro Cys Cys Gly Ser Val Cys Leu Leu Val Leu Leu Gly Val

1 5 10 15

Val Leu Ala Ser Gly Gly Pro Val Gln Phe Val Ser Glu Asn Met Lys

20 25 30

Gln Thr His Glu Ser Ile Ala Asp Val Leu Lys Leu Lys Ser Gly Leu

35 40 45

Gly His Asn Pro Leu Phe Ser Ser Val Met Lys Ser Ile Asn Thr Ser

50 55 60

Cys Gln Arg Lys Glu Glu Ile Gln Leu Met Asn Val Thr Leu Asp Ile

65 70 75 80

Tyr Met Arg Ile Phe Ser Ser Ile Leu Gln Ser Asn His Asp Glu Ala

85 90 95

Gly Ser Glu Pro Leu Leu Asp His Leu Ser Asp Ser Glu Lys Thr Gln

100 105 110

Val Arg Ser Asp Leu Thr Lys Leu Gln Lys Lys Met Glu Lys Leu Lys

115 120 125

Ser His Leu Gly Gln Leu Asn Thr His Lys Glu Asp Val Leu Ser Lys

130 135 140

Leu Asn Lys Ile Gln Val Asp Asp Pro Leu Val Gln Arg Lys Ala Leu

145 150 155 160

Ala Glu Tyr Lys Glu Ile Tyr Gln Ala Ala Ser Val Ile Gly Ala Arg

165 170 175

Ser Cys Gly His Ala His Leu Ser Ser Ser Glu

180 185

<210> 3

<211> 864

<212> DNA/RNA

<213> Lateorax maculotus)

<400> 3

atgcttttct ttgtgttatg gtttcacgct gccggccaag tactctctga ggtgccacca 60

gctccgccgc agaacgtcca tgttaataac tggctactga catggactcc taccatggag 120

gagggagatg tcacccacac agttcagtac cgcagctttg actccagtga ctgggaggat 180

gtaccagcct gcgtccacat atccttaaac acctgtgatg tctcttcaac aaaagctaag 240

ggcgaacatg gctgtgttat gctgcatgtg caagcagaga gacgtgggct gacctcgaga 300

ccagtcaaag cctgtagcag acatggtgac gcctgtactc ctgaactcag tctgactgcg 360

aggcccggct ccctgaccgt agatttgagt aggaaccaca gtctggcttt ggaacatggg 420

gaccatgcaa aacacagggt ttactatggc aaggaaggag agctcctgca gaagtacaaa 480

gatgctgtct cttctgtgac aatcccagag ctggaggagg gccagcgtta ctgtgccaaa 540

gtgcagtata cttacttcaa taaacccatt ggtctggcca gctgtaccca gtgtgaggtc 600

atccctgact caagaaatga cccaaaacaa acagagatta tagtagctgt ggtggttgtc 660

gtagtcctga tcctcctgat accagtgata gcatacatcc tcatcttcca gcgagagaga 720

atcaaacatt ggctgcgacc tccatacgag atcccactca acattttgcc tgaaccattt 780

tctgagcatc gcaatcccat ttacagcagc agccccacca gggaggagtg tgatgtcatt 840

tccttcattt ccccggagaa gtga 864

<210> 4

<211> 287

<212> PRT

<213> Lateorax maculotus)

<400> 4

Met Leu Phe Phe Val Leu Trp Phe His Ala Ala Gly Gln Val Leu Ser

1 5 10 15

Glu Val Pro Pro Ala Pro Pro Gln Asn Val His Val Asn Asn Trp Leu

20 25 30

Leu Thr Trp Thr Pro Thr Met Glu Glu Gly Asp Val Thr His Thr Val

35 40 45

Gln Tyr Arg Ser Phe Asp Ser Ser Asp Trp Glu Asp Val Pro Ala Cys

50 55 60

Val His Ile Ser Leu Asn Thr Cys Asp Val Ser Ser Thr Lys Ala Lys

65 70 75 80

Gly Glu His Gly Cys Val Met Leu His Val Gln Ala Glu Arg Arg Gly

85 90 95

Leu Thr Ser Arg Pro Val Lys Ala Cys Ser Arg His Gly Asp Ala Cys

100 105 110

Thr Pro Glu Leu Ser Leu Thr Ala Arg Pro Gly Ser Leu Thr Val Asp

115 120 125

Leu Ser Arg Asn His Ser Leu Ala Leu Glu His Gly Asp His Ala Lys

130 135 140

His Arg Val Tyr Tyr Gly Lys Glu Gly Glu Leu Leu Gln Lys Tyr Lys

145 150 155 160

Asp Ala Val Ser Ser Val Thr Ile Pro Glu Leu Glu Glu Gly Gln Arg

165 170 175

Tyr Cys Ala Lys Val Gln Tyr Thr Tyr Phe Asn Lys Pro Ile Gly Leu

180 185 190

Ala Ser Cys Thr Gln Cys Glu Val Ile Pro Asp Ser Arg Asn Asp Pro

195 200 205

Lys Gln Thr Glu Ile Ile Val Ala Val Val Val Val Val Val Leu Ile

210 215 220

Leu Leu Ile Pro Val Ile Ala Tyr Ile Leu Ile Phe Gln Arg Glu Arg

225 230 235 240

Ile Lys His Trp Leu Arg Pro Pro Tyr Glu Ile Pro Leu Asn Ile Leu

245 250 255

Pro Glu Pro Phe Ser Glu His Arg Asn Pro Ile Tyr Ser Ser Ser Pro

260 265 270

Thr Arg Glu Glu Cys Asp Val Ile Ser Phe Ile Ser Pro Glu Lys

275 280 285

<210> 5

<211> 1248

<212> DNA/RNA

<213> Lateorax maculotus)

<400> 5

atggatcccg ggggtggatt tcctcctgtc gtcctgcttc tctccgcgct gctgctgctg 60

ctgcgagcct ctgcgggtta cgtggagccg ccgaccagcg taaccctgga ctgcaggaat 120

ctgcacaacg ttctggagtg gagttacaat caactctcaa cgcctgggct aaagttcaaa 180

gttgatataa aatcactttc aagttctcct agtgagattt ggattaactc ttcaacaagt 240

cttcaagctg atttgtcgtc tttctcggat ccaaaaaatg aataccttat ttgtgtaatg 300

gctgtgattg gacaaaatga gtctgcgtgt gtccctcagg ggggattcag ttacagctac 360

ttcaaggatg ctgccacaaa tcggacatgt tttttggact tcccaccagt taacgtcact 420

gccctccagg acgacaatgt gctgttacgc ttcacgcatc cctggttgtt gtaccaccaa 480

caacgacccg acggtccaaa tccgaaacag aagaagaaga atagccgtgg cgcaaagatc 540

agacaagagc tacctatgtt taattacgac gtcgtaatca tcggccagaa ggagcgacac 600

caacgattgg actgtgagga gagtgtgtgt gaggagaagc ttccagtgga tgctgcacag 660

gagaaacact gtgtgaaggt caagggggag ctgctgaaaa tggcagttag aggcacagaa 720

gagtactgcg ccatgtcatc accaatgaag ccatcaccaa gtaaaaaagc aaaccaaaat 780

aacgcctaca tctacattgt tgtcagcgtg ttggtcgtga ttgcagttgc ttttgtcctc 840

ttcatggtgt accaaaagat gaccaaaccc tcaacttctt taccgaactc catgaggttc 900

acggatcgac tgaagcagtg gaccatggga gtggttcaag agcaggtctc aaagccagaa 960

gtggagccta cctcaccaac attgctactg ccagaagaga aagaatccat acttattgtc 1020

tctgcctctg agcccgaact ccgtctgtgt atcggggtgt cggccgagga tgagggtgtg 1080

agtgatgtcg ggccggtagg gaatgatgaa gggccatgtt acatgccagg tagagagttg 1140

gatgaagatg aaacactatg ccccgttgag cacccctctg aatatgagaa acgtcaggtg 1200

ttggttgata tagcaccaga tgaacagact gagggctacc gtggctga 1248

<210> 7

<211> 415

<212> PRT

<213> Lateorax maculotus)

<400> 7

Met Asp Pro Gly Gly Gly Phe Pro Pro Val Val Leu Leu Leu Ser Ala

1 5 10 15

Leu Leu Leu Leu Leu Arg Ala Ser Ala Gly Tyr Val Glu Pro Pro Thr

20 25 30

Ser Val Thr Leu Asp Cys Arg Asn Leu His Asn Val Leu Glu Trp Ser

35 40 45

Tyr Asn Gln Leu Ser Thr Pro Gly Leu Lys Phe Lys Val Asp Ile Lys

50 55 60

Ser Leu Ser Ser Ser Pro Ser Glu Ile Trp Ile Asn Ser Ser Thr Ser

65 70 75 80

Leu Gln Ala Asp Leu Ser Ser Phe Ser Asp Pro Lys Asn Glu Tyr Leu

85 90 95

Ile Cys Val Met Ala Val Ile Gly Gln Asn Glu Ser Ala Cys Val Pro

100 105 110

Gln Gly Gly Phe Ser Tyr Ser Tyr Phe Lys Asp Ala Ala Thr Asn Arg

115 120 125

Thr Cys Phe Leu Asp Phe Pro Pro Val Asn Val Thr Ala Leu Gln Asp

130 135 140

Asp Asn Val Leu Leu Arg Phe Thr His Pro Trp Leu Leu Tyr His Gln

145 150 155 160

Gln Arg Pro Asp Gly Pro Asn Pro Lys Gln Lys Lys Lys Asn Ser Arg

165 170 175

Gly Ala Lys Ile Arg Gln Glu Leu Pro Met Phe Asn Tyr Asp Val Val

180 185 190

Ile Ile Gly Gln Lys Glu Arg His Gln Arg Leu Asp Cys Glu Glu Ser

195 200 205

Val Cys Glu Glu Lys Leu Pro Val Asp Ala Ala Gln Glu Lys His Cys

210 215 220

Val Lys Val Lys Gly Glu Leu Leu Lys Met Ala Val Arg Gly Thr Glu

225 230 235 240

Glu Tyr Cys Ala Met Ser Ser Pro Met Lys Pro Ser Pro Ser Lys Lys

245 250 255

Ala Asn Gln Asn Asn Ala Tyr Ile Tyr Ile Val Val Ser Val Leu Val

260 265 270

Val Ile Ala Val Ala Phe Val Leu Phe Met Val Tyr Gln Lys Met Thr

275 280 285

Lys Pro Ser Thr Ser Leu Pro Asn Ser Met Arg Phe Thr Asp Arg Leu

290 295 300

Lys Gln Trp Thr Met Gly Val Val Gln Glu Gln Val Ser Lys Pro Glu

305 310 315 320

Val Glu Pro Thr Ser Pro Thr Leu Leu Leu Pro Glu Glu Lys Glu Ser

325 330 335

Ile Leu Ile Val Ser Ala Ser Glu Pro Glu Leu Arg Leu Cys Ile Gly

340 345 350

Val Ser Ala Glu Asp Glu Gly Val Ser Asp Val Gly Pro Val Gly Asn

355 360 365

Asp Glu Gly Pro Cys Tyr Met Pro Gly Arg Glu Leu Asp Glu Asp Glu

370 375 380

Thr Leu Cys Pro Val Glu His Pro Ser Glu Tyr Glu Lys Arg Gln Val

385 390 395 400

Leu Val Asp Ile Ala Pro Asp Glu Gln Thr Glu Gly Tyr Arg Gly

405 410 415

<210> 7

<211> 1209

<212> DNA/RNA

<213> Lateorax maculotus)

<400> 7

atgctgctgg aaggtgcgtt cactgccctg ctcctcctgg tctgtggagt tcctgctgtg 60

attgttctgc ctccatcgaa catgaccgtg agctgccaaa atctcaaagt catcgtcagc 120

tggcagtaca gcaaagacca accacaaacc agcttcaggg tagacgtgca aagttctgct 180

gggaattatg tgaatgaaac cacagaccat cagcttgatc tgagccactt cttctgggta 240

tctgaagagc gctacatggc cctccatgag gtgactgtag cagccataca gggaggccac 300

cagtctgaac aaataaagtc taaaacattc gcctttaaca gtttaaagac ggctgatata 360

aaatgtgaat tagatttccc tcctgtacaa ctgaaggtgg attcggaggc cacagtgagt 420

ttcaaaaatc ccttccactt ctacagagaa ctggagcagg ctatcaagcc ggaagaagcc 480

acctttgcat acactgtctc ttcaggtgat aaacattttt attggcagtg cacaaagaaa 540

cagaaaatct gcaaacttga catcacattt cctgagaatg tggagaagtg cgtcacactg 600

aaaggacatt tgtatgatgg gattgaagtc ggcagcatag tgttcagaga gacgggcagg 660

atctgtgcaa atgaatcaac tgacgtccat tcgatagtcc ttataacact gctggtcatc 720

actgtgttag taatcagcgt ggcagcttta accatctggc agaccaaggc ctatatattg 780

aaggaaccca taccaaaccc tctgaagcca cctaaaccgg gaaaaaacaa ctcgaattac 840

tatactgtgc ccaacacagt catcagtcct gttacggtca ccaagccctg caagagccct 900

tcagtcagct ccgaggaggg gagcctctgc gacagctgcg tcagatctga ttcccagaac 960

aacgacaggt tgtactacgg gagaggactt tcagagagca gcaaccagag gctggaagct 1020

gtggggttga tatcagaggg acacgggaca gatgacgact ctgcagacga ctcggagaaa 1080

acagtgtctg tttggatcga tatggaggag gaggagcagt tggaggaggg ggtgtcaccc 1140

tatgactccc cgcagatgct ggacatgggc aacggagaca tggtcaaggg ttacagtcag 1200

atgtcttga 1209

<210> 8

<211> 402

<212> PRT

<213> Lateorax maculotus)

<400> 8

Met Leu Leu Glu Gly Ala Phe Thr Ala Leu Leu Leu Leu Val Cys Gly

1 5 10 15

Val Pro Ala Val Ile Val Leu Pro Pro Ser Asn Met Thr Val Ser Cys

20 25 30

Gln Asn Leu Lys Val Ile Val Ser Trp Gln Tyr Ser Lys Asp Gln Pro

35 40 45

Gln Thr Ser Phe Arg Val Asp Val Gln Ser Ser Ala Gly Asn Tyr Val

50 55 60

Asn Glu Thr Thr Asp His Gln Leu Asp Leu Ser His Phe Phe Trp Val

65 70 75 80

Ser Glu Glu Arg Tyr Met Ala Leu His Glu Val Thr Val Ala Ala Ile

85 90 95

Gln Gly Gly His Gln Ser Glu Gln Ile Lys Ser Lys Thr Phe Ala Phe

100 105 110

Asn Ser Leu Lys Thr Ala Asp Ile Lys Cys Glu Leu Asp Phe Pro Pro

115 120 125

Val Gln Leu Lys Val Asp Ser Glu Ala Thr Val Ser Phe Lys Asn Pro

130 135 140

Phe His Phe Tyr Arg Glu Leu Glu Gln Ala Ile Lys Pro Glu Glu Ala

145 150 155 160

Thr Phe Ala Tyr Thr Val Ser Ser Gly Asp Lys His Phe Tyr Trp Gln

165 170 175

Cys Thr Lys Lys Gln Lys Ile Cys Lys Leu Asp Ile Thr Phe Pro Glu

180 185 190

Asn Val Glu Lys Cys Val Thr Leu Lys Gly His Leu Tyr Asp Gly Ile

195 200 205

Glu Val Gly Ser Ile Val Phe Arg Glu Thr Gly Arg Ile Cys Ala Asn

210 215 220

Glu Ser Thr Asp Val His Ser Ile Val Leu Ile Thr Leu Leu Val Ile

225 230 235 240

Thr Val Leu Val Ile Ser Val Ala Ala Leu Thr Ile Trp Gln Thr Lys

245 250 255

Ala Tyr Ile Leu Lys Glu Pro Ile Pro Asn Pro Leu Lys Pro Pro Lys

260 265 270

Pro Gly Lys Asn Asn Ser Asn Tyr Tyr Thr Val Pro Asn Thr Val Ile

275 280 285

Ser Pro Val Thr Val Thr Lys Pro Cys Lys Ser Pro Ser Val Ser Ser

290 295 300

Glu Glu Gly Ser Leu Cys Asp Ser Cys Val Arg Ser Asp Ser Gln Asn

305 310 315 320

Asn Asp Arg Leu Tyr Tyr Gly Arg Gly Leu Ser Glu Ser Ser Asn Gln

325 330 335

Arg Leu Glu Ala Val Gly Leu Ile Ser Glu Gly His Gly Thr Asp Asp

340 345 350

Asp Ser Ala Asp Asp Ser Glu Lys Thr Val Ser Val Trp Ile Asp Met

355 360 365

Glu Glu Glu Glu Gln Leu Glu Glu Gly Val Ser Pro Tyr Asp Ser Pro

370 375 380

Gln Met Leu Asp Met Gly Asn Gly Asp Met Val Lys Gly Tyr Ser Gln

385 390 395 400

Met Ser

<210> 9

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atgtctccgt gctgtggtt 19

<210> 10

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcattcagag gaagacaagt gg 22

<210> 11

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atgcttttct ttgtgttatg 20

<210> 12

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tcacttctcc ggggaaatga 20

<210> 13

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atggatcccg ggggtggatt tc 22

<210> 14

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tcagccacgg tagccctcag t 21

<210> 15

<211> 17

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

atgctgctgg aaggtgc 17

<210> 16

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tcaagacatc tgactgtaac cc 22

<210> 17

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atgtctccgt gctgtggtt 19

<210> 18

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tggactcgtg ggtttgttt 19

<210> 21

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

atggtgacgc ctgtactcc 19

<210> 20

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aaagccagac tgtggttcct a 21

<210> 21

<211> 18

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ttacgcttca cgcatccc 18

<210> 22

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

cgccacggct attcttctt 19

<210> 23

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tggagttcct gctgtgattg 20

<210> 24

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gaagctggtt tgtggttggt 20

<210> 25

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cgagaccaat gagatcgcca 20

<210> 26

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

aacttctcag gcatacgggc 20

<210> 27

<211> 26

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ccggaattcg gtcctgtcca gttcgt 26

<210> 28

<211> 28

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cccaagcttt tcagaggaag acaagtgg 28

<210> 29

<211> 30

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ccggaattcg aggtgccacc agctccgccg 30

<210> 30

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

cccaagctta atctctgttt gtttt 25

<210> 31

<211> 30

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

cgagctccaa aagatgacca aaccctcaac 30

<210> 32

<211> 36

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

aaggaaaaaa gcggccgcgc cacggtagcc ctcagt 36

<210> 33

<211> 32

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ccggaattcc agaccaaggc ctatatattg aa 32

<210> 34

<211> 28

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

cccaagctta gacatctgac tgtaaccc 28

<210> 35

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

taatacgact cactataggg 20

<210> 36

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

gctagttatt gctcagcgg 19

<210> 37

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

catctccggt ctgaactggg 20

<210> 38

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

cactgtttga acaggcacgc 20

<210> 39

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

gtatcagcag atgcgggaca 20

<210> 40

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

ggccctgaag tttcgtctga 20

<210> 41

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

tgaaacggca aatgaagcgg 20

<210> 42

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

tcgtggagtt tggggaatcg 20

<210> 43

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

tgagcagctg cggaatctac 20

<210> 44

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

taacagggcc agtgcacatt 20

<210> 45

<211> 24

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

tatgtgctca actcttggct ggtc 24

<210> 46

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

ccacgatggg cttgacttct cc 22

<210> 47

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

tggaacgagt acaccatgcc 20

<210> 48

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

gaccctagct cctgcttgac 20

<210> 49

<211> 26

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

ccggaattcg gtcctgtcca gttcgt 26

<210> 50

<211> 28

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

ccgctcgagt tcagaggaag acaagtgg 28

<210> 51

<211> 28

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

ccgctcgaga tgtctccgtg ctgtggtt 28

<210> 52

<211> 27

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

ggggtacctt cagaggaaga caagtgg 27

<210> 53

<211> 28

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

gctctagaat gcttttcttt gtgttatg 28

<210> 54

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

ggggtaccct tctccgggga aatga 25

<210> 55

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 55

ccgctcgaga tggatcccgg gggtg 25

<210> 56

<211> 26

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 56

ggggtaccgc cacggtagcc ctcagt 26

<210> 57

<211> 26

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 57

ccgctcgaga tgctgctgga aggtgc 26

<210> 58

<211> 27

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 58

ggggtaccag acatctgact gtaaccc 27

<210> 59

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 59

atctggtgga taagggaac 19

<210> 60

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 60

catcctctgt taatgtggc 19

<210> 61

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 61

taatgccaca gtcggtgaa 19

<210> 62

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 62

aggtccagtg ttagtgatga gc 22

<210> 63

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 63

gcaaagcgag ggttacgac 19

<210> 64

<211> 23

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 64

ctgccattac taacgatgct gac 23

<210> 65

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 65

cggtatccat gagaccacct 20

<210> 66

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 66

cttctgcatc ctgtcagcaa 20

Claims

1. The lateolabrax japonicus type II interferon IFN-gamma rel is characterized in that the nucleotide sequence is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2.

2. The receptor of Lateolabrax japonicus type II interferon IFN-gamma rel is characterized by comprising CRFB6, CRFB13 and CRFB17, wherein the nucleotide sequence of the CRFB6 is shown as SEQ ID No.3, and the amino acid sequence is shown as SEQ ID No. 4; the nucleotide sequence of the CRFB13 is shown as SEQ ID NO.5, and the amino acid sequence is shown as SEQ ID NO. 6; the CRFB17 has a nucleotide sequence shown in SEQ ID NO.7 and an amino acid sequence shown in SEQ ID NO. 8.

3. The antiviral composition containing the weever interferon IFN-gamma rel and the receptor thereof is characterized by comprising the weever interferon IFN-gamma rel and a weever II-type interferon receptor, wherein the weever II-type interferon receptor is one or the combination of more than two of CRFB6, CRFB13 and CRFB 17.

4. The antiviral composition according to claim 3, wherein the composition comprises the weever interferon IFN- γ rel in combination with a receptor comprising CRFB 17.

5. The antiviral composition according to claim 4, wherein the receptor comprising CRFB17 is a combination of CRFB6 and CRFB17, or a combination of CRFB13 and CRFB17, or a combination of CRFB6, CRFB13 and CRFB 17.

6. The antiviral composition according to claim 4, comprising the weever interferon IFN- γ rel and its receptor, wherein the weever interferon IFN- γ rel, CRFB13 and CRFB17 are comprised.

7. Use of an antiviral composition comprising lateolabrax japonicus interferon IFN- γ rel and its receptor as claimed in any one of claims 4 to 6 in the manufacture of a medicament for antiviral treatment of aquatic animals.

8. The use of claim 7, wherein the virus is largemouth black bass ulcer syndrome virus.

9. The use of an antiviral composition comprising lateolabrax japonicus interferon IFN- γ rel and its receptor as claimed in claim 3 in the manufacture of a medicament for enhancing antiviral immunity in aquatic animals.

10. The use of claim 9, wherein the virus is largemouth black bass ulcer syndrome virus.