CN115074365A - sgRNA targeting GATM gene and application thereof - Google Patents
sgRNA targeting GATM gene and application thereof Download PDFInfo
- Publication number
- CN115074365A CN115074365A CN202210752446.4A CN202210752446A CN115074365A CN 115074365 A CN115074365 A CN 115074365A CN 202210752446 A CN202210752446 A CN 202210752446A CN 115074365 A CN115074365 A CN 115074365A
- Authority
- CN
- China
- Prior art keywords
- gatm
- seq
- artificial sequence
- gene
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y201/00—Transferases transferring one-carbon groups (2.1)
- C12Y201/04—Amidinotransferases (2.1.4)
- C12Y201/04001—Glycine amidinotransferase (2.1.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides sgRNA of a targeted GATM gene and application thereof, wherein a GATM gene activity enhancer is a remote enhancer E1-E6 of the upstream of a targeted human GATM gene promoter, and the complete nucleotide sequences are respectively as follows: the sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 and the reverse complementary sequence thereof. The GATM gene editing tool includes a fusion protein of dCas9 and an inhibitor, the sgRNA described above, and a vector. The invention identifies the specific gene GATM causing pancreatic cancer cell metastasis and the remote enhancer regulating element thereof, and the enhancer of the targeted GATM gene can more specifically inhibit the migration activity of pancreatic cancer cells on the premise of not influencing the GATM gene structure and the protein structure, thereby more accurately achieving the purpose of treating pancreatic cancer metastasis.
Description
Technical Field
The invention belongs to the technical field of medicine, and particularly relates to sgRNA of a targeted GATM gene and application thereof.
Background
The abnormal expression state of genes is considered to be an important factor for driving the development of human malignant tumors. Enhancers are cis-regulatory elements located distal to the transcription initiation site and composed of multiple sites capable of being bound by transcription factors, and can act remotely on the promoter region of regulated genes, thereby activating the expression of distant genes, including genes that control cancer cell differentiation, proliferation, invasion and migration (Diaferia, G.R.et al. Emboj 35, 595-617).
It has been demonstrated that extensive non-mutational epigenetic modified alterations in the pancreatic cancer cell genome lead to activation of a number of enhancers capable of regulating the expression of pancreatic cancer cell invasion and migration genes (McDonald, O.G et al. nat Genet2017, 49: 367-. It has also been demonstrated that targeting specific enhancer regions using epigenetic editing techniques can achieve the goal of regulating the expression of a gene of interest by affecting the transcription initiation complex without altering the structure and sequence of the gene of interest (Ren, B.et al.J. Hematol Oncol 2021, 14: 120; Wang L.et al.adv Sci (Weinh)2021, 8: e 2004673).
Although studies have described enhancer regulatory elements that can drive the onset of metastatic behavior in pancreatic cancer, few have identified metastasis-specific genes that are regulated by remote enhancers, particularly genes that specifically promote the metastasis of pancreatic cancer to the liver. In addition, most of the existing "targeted" drugs for treating cancers are directly directed to target gene coding proteins, and serious side effects are inevitably caused.
Disclosure of Invention
The invention is researched by the following steps:
(1) through Transwell experiments, western blot experiments, animal experiments and clinical specimens, the expression level of the GATM gene is detected to be positively correlated with the metastasis degree of pancreatic cancer, namely the GATM gene high expression can promote the migration of pancreatic cancer cells and the liver metastasis of mouse pancreatic cancer;
(2) pancreatic cancer liver metastasis cell line (Capan-1) and pancreatic cancer primary focus cell line (PANC-1) are respectively from a liver metastasis of a 40-year-old male pancreatic cancer patient and a primary cancer focus of a 56-year-old female pancreatic cancer patient, and a pancreatic cancer cell highly-invasive metastatic strain (PANC-1-IN) is obtained from a PANC-1 parent strain invasion and migration screening experiment; the western blot experiment finds that the expression level of GATM protein of a pancreatic cancer cell highly-invasive metastatic strain is higher than that of a parent strain, and the expression level of GATM protein of a pancreatic cancer liver metastasis cell line is higher than that of a primary focus cell line; by analyzing the GATM expression level of tumor tissues in the pancreatic cancer cohort of the Beijing cooperative Hospital (PUMCH) and the pancreatic cancer cohort of the TCGA public database, the invention explores that the GATM expression level is higher in the pancreatic cancer tissues with lymph node metastasis (N1/2) than in the pancreatic cancer tissues without lymph node metastasis (N0);
(3) the influence on pancreatic cancer cell migration capacity and mouse pancreatic cancer liver metastasis after intervention of GATM gene expression level is explored at an in vitro cell level and an animal in vivo level; the results of Transwell show that the migration capacity of GATM pancreatic cancer cells in the low-expression group is obviously lower than that of the normal control group; a western blot experiment detects that the expression level of E-cadherin in GATM low-expression group pancreatic cancer cells is increased, and the migration capability of the cells is reduced from a molecular level; by utilizing the hyperimmune deficient mice to construct a pancreatic cancer in-situ injection model and a spleen injection model, the invention proves that GATM can inhibit the growth invasion and liver metastasis of pancreatic cancer after low expression in animal bodies.
(4) The Hi-C sequencing, ChIP-seq sequencing, ChIP-qPCR experiment and 3C-qPCR experiment are utilized to discover a remote enhancer region at the upstream of the GATM gene promoter, and demonstrate that the enhancer can interact with the GATM promoter, thereby promoting the transcription and expression level of the GATM gene;
(5) the H3K27ac modification is a marker of an active enhancer, the high modification level of H3K27ac indicates that the enhancer has high activity, and the corresponding target gene is in a transcription activation state; the invention analyzes H3K27ac modification information and DNA interaction information of pancreatic cancer cell whole genome level, and obtains the modification map and interaction map of GATM gene H3K27ac by using WashU tool website, and the result shows that the pancreatic cancer liver metastasis cells have higher level of H3K27ac modification in GATM gene remote enhancer region compared with normal pancreatic duct epithelial cells and pancreatic cancer primary focus cells.
The pancreatic cancer cell highly invasive metastatic strain is described in Yang g.et al.science CHINA Life Sciences2019, 62 (6): 791-806.
The WashU tool website is http:// epigenomegaway.
The above mentioned liver metastatic focus cell line and primary cancer focus cell line are according to Emily l.et al. pancreas 2010, 39 (4): 425-435.
Thus, in a first aspect, the present invention provides an enhancer of GATM gene activity associated with pancreatic cancer metastasis, said enhancer being the remote enhancer E1-E6 targeted upstream of the human GATM gene promoter, whose complete nucleotide sequences are:
1) e1: the sequence shown as SEQ ID NO.1 and the reverse complementary sequence thereof;
2) e2: the sequence shown as SEQ ID NO.2 and the reverse complementary sequence thereof;
3) e3: a sequence shown as SEQ ID NO.3 and a reverse complementary sequence thereof;
4) e4: the sequence shown as SEQ ID NO.4 and the reverse complementary sequence thereof;
5) e5: the sequence shown as SEQ ID NO.5 and the reverse complementary sequence thereof;
6) e6: the sequence shown as SEQ ID NO.6 and the reverse complementary sequence thereof.
Further, each enhancer region selects three target sequences with the highest specificity, and the target sequences are used as binding sites of sgrnas which are described later; the E1 comprises three target sequences of E1-1, E1-2 and E1-3; e2 includes three target sequences of E2-1, E2-2 and E2-3; e3 includes three target sequences of E3-1, E3-2 and E3-3; e4 includes three target sequences of E4-1, E4-2 and E4-3; e5 includes three target sequences of E5-1, E5-2 and E5-3; e6 includes three target sequences of E6-1, E6-2 and E6-3; the sequence is shown in SEQ ID NO. 7-SEQ ID NO.24 in sequence.
In a second aspect, the invention provides a sgRNA targeting the GATM gene activity enhancer, wherein a DNA template nucleotide sequence transcribed and synthesized by the sgRNA is shown in SEQ ID No.25 to SEQ ID No. 60. The sgRNA designed by the invention is the sgRNA of all targeted GATM gene enhancers including g10947, g10948 and g10949, wherein g10947, g10948 and g10949 have higher efficiency of inhibiting the expression of GATM gene, and g10947 and g10949 can almost completely inhibit the expression of GATM protein level; experiments show that g10947 and g10949 obviously inhibit the migration activity of PANC-1-IN pancreatic cancer cells; the sgRNA sequences are shown in Table 2; preferably, the sgRNA is the sgRNA with the numbers g10947, g10948 and g10949, and the nucleotide sequence is shown as SEQ ID NO.43, SEQ ID NO.44, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.59 and SEQ ID NO.60 in sequence.
In a third aspect, the present invention provides a GATM gene expression inhibitor comprising the sgRNA described above.
In a fourth aspect, the present invention provides an application of the sgRNA or the GATM gene expression inhibitor in the preparation of a medicament for treating pancreatic cancer metastasis.
Further, the medicament for treating pancreatic cancer metastasis comprises a pharmaceutically acceptable carrier, including any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextran, glycerol, ethanol, and the like, and combinations thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols, or sodium chloride in the composition. The pharmaceutically acceptable carrier may also contain minor amounts of auxiliary substances which enhance the shelf life or effectiveness of the antibody or antibody portion, such as wetting or emulsifying agents, preservatives or buffers.
In a fifth aspect, the present invention provides a GATM gene editing tool comprising a fusion protein of dCas9 and an inhibitor, the sgRNA described above, and a vector.
Preferably, the inhibitory factor is a recruitable histone methylase.
Further, the amino acid sequence and the nucleotide sequence of the fusion protein of dCas9 and the recruitable histone methylase are shown in SEQ ID No.61 and SEQ ID No.62, respectively.
Further, the vectors include, but are not limited to, pCas-Guide-Puro-CRISPRI vector (ORIGEN # GE100083), lenti-EF1a-dCas9-KRAB-Puro (vast Ling # P2842), phU6-sgRNA (vast Ling # P1715), and U6-sgRNA-SV40-Neomycin (Kjek gene).
In a sixth aspect, the invention provides an application of the gene editing tool in preparing a medicine for treating pancreatic cancer metastasis.
Compared with the prior art, the invention develops a CRISPR technical system of a targeted pancreatic cancer metastasis-specific enhancer aiming at the cis-form regulatory element of the GATM gene, greatly reduces the expression level of the GATM in pancreatic cancer cells on the basis of not damaging the GATM gene sequence and the protein structure, and obviously inhibits the migration activity of the pancreatic cancer cells;
the invention identifies the specific gene GATM causing pancreatic cancer cell metastasis and the remote enhancer regulating element thereof, and the enhancer of the targeted GATM gene can more specifically inhibit the migration activity of pancreatic cancer cells on the premise of not influencing the GATM gene structure and the protein structure, thereby more accurately achieving the purpose of treating pancreatic cancer metastasis.
Drawings
FIG. 1A is a graph showing the expression level (upper left) of GATM protein IN a pancreatic cancer PANC-1 cell highly invasive metastatic strain (PANC-1-IN cells) and the expression level (lower left) of GATM IN a pancreatic cancer liver metastasis cell line Capan-1, which were detected by a western blot experiment IN example 1 of the present invention, while GATM expression levels IN tumor specimens of pancreatic cancer patients at stages N1 and N0 were analyzed by the Beijing collaboration Hospital's pancreatic cancer cohort and TCGA public database pancreatic cancer cohort;
FIG. 1B is a graph showing the change in cell migration ability upon knockdown of GATM expression in a plurality of pancreatic cancer cell lines as measured by the Transwell assay in example 1 of the present invention;
FIG. 1C is a diagram showing the expression level of E-cadherin after detecting the expression of pancreatic cancer cells knocking down GATM by using a western blot experiment in example 1 of the present invention;
FIG. 2A is a model diagram of the method for constructing GATM stable low-expression pancreatic cancer cell strain and establishing pancreatic cancer in-situ injection xenograft tumor by using a high-immune-deficiency mouse in example 1 of the present invention;
FIG. 2B is a graph showing in situ tumor weights of pancreas in mice of a normal control group and mice of a GATM underexpressing group in example 1 of the present invention;
FIG. 2C is a graph showing bioluminescence intensity measured by a mouse imager in vitro in liver tissue of a normal control group mouse and a GATM low expression group mouse in example 1 of the present invention;
FIG. 2D is a graph showing the RT-qPCR assay for detecting the expression levels of epithelial-mesenchymal transition-related genes in the pancreatic in-situ tumors of normal control mice and GATM low expression mice in example 1 of the present invention;
FIG. 3A is a model diagram of GATM-stable low-expression pancreatic cancer cell line constructed in example 1 of the present invention, and spleen-injected xenograft tumor model of pancreatic cancer established using a high-immune-deficient mouse;
FIG. 3B is a graph showing bioluminescence intensity measured by a small animal imager in the pancreatic cancer at the level of the whole body in the normal control group mouse and the GATM low expression group mouse in example 1 of the present invention;
FIG. 3C is a photograph showing a gross observation of isolated liver tissues of a normal control group mouse and a GATM underexpressing group mouse in example 1 of the present invention;
FIG. 4 is a graph showing the level of enrichment of the GATM gene promoter and the remote enhancer region H3K27ac in normal pancreatic ductal epithelial cells (HPNE), pancreatic cancer primary focus cells (PANC-1) and pancreatic cancer liver metastasis cells (Capan-1) detected by the ChIP-seq technique in example 2 of the present invention;
FIG. 5 is a graph showing the expression level (left) of GATM gene IN five pancreatic cancer cell lines (MIA PaCa-2, PANC-1, PANC-1-IN, Capan-1, BxPC-3) using RT-qPCR IN example 2 of the present invention; simultaneously, a ChIP-qPCR experiment is utilized to detect H3K27ac modification levels (right) of different sites of GATM gene promoters and enhancers in five pancreatic cancer cell lines;
FIG. 6 is a graph showing the interaction level between the GATM gene promoter and the remote enhancer at different sites in pancreatic cancer cell lines (same as FIG. 5) of species tested by 3C-qPCR in example 2 of the present invention;
FIG. 7 is a graph showing the effect of different sites of a silent GATM gene remote enhancer on the expression level of a GATM gene IN pancreatic cancer cells (PANC-1-IN) detected by the epigenetic editing technique (CRISPR/dCas9-KRAB) IN example 3 of the present invention;
FIG. 8 is a graph showing the expression levels of GATM proteins after targeted silencing of the enhancer sites E4, E5 and E6 of the GATM gene is detected by using a western blot experiment in example 3 of the present invention;
FIG. 9 is a diagram showing the migration ability of pancreatic cancer cells after targeted silencing of the enhancer sites E4, E5 and E6 of the GATM gene by using the Transwell assay.
Detailed Description
To better illustrate the objects, aspects, advantages and potential benefits of the present invention, the process of the present invention will be described in detail with reference to the accompanying drawings and specific examples. In the following description of the embodiments, materials, reagents, methods, and the like, which are used, unless otherwise specified, are available from commercial sources or public resource platforms.
Example 1
Firstly, Transwell experiments, western blot experiments, animal experiments and clinical specimen detection prove that the expression level of the GATM gene is positively correlated with the metastasis degree of pancreatic cancer, namely the GATM gene with high expression can promote the migration of pancreatic cancer cells and the liver metastasis of mouse pancreatic cancer, and the related data are shown in figure 1, figure 2 and figure 3;
firstly, the experimental demonstration of the Transwell is carried out according to the following steps:
(1) culturing PANC-1-IN, BxPC-3 and CFPAC-1 cells IN a six-well plate, dividing each cell into a control group and a GATM low expression group, and respectively transfecting si-NC and si-GATM small interfering RNA by using a Lipo3000 transfection reagent;
(2) after 24 hours of transfection, changing a normal culture medium, culturing for another 24 hours, digesting and collecting cells by using pancreatin, resuspending the cells by using a serum-free culture medium, and counting;
(3) two groups of cells were inoculated into the upper chamber of a Transwell chamber, and a complete medium containing 10% fetal bovine serum was added to the lower chamber;
(4) placing at 37 ℃ constant temperature CO 2 Incubating, fixing and staining the cell of the chamber after 24 hours by using a 0.1% crystal violet methanol solution, cleaning and drying the chamber after 30 minutes, observing the cancer cells migrating to the bottom surface of the chamber under a common optical microscope, counting the cancer cells and carrying out statistical analysis.
The Lipo3000 transfection reagent described above was Invitrogen # L3000015.
The upper chamber of the Transwell cell described above was Costar # 3422.
When the cells are respectively inoculated IN the upper chamber of the Transwell chamber, the inoculation amount of the PANC-1-IN is 20000 cells/chamber; the inoculation amount of BxPC-3 is 60000 cells/chamber; the inoculum size of CFPAC-1 was 80000 cells/chamber.
And II, carrying out Western blot experiment demonstration according to the following steps:
(1) culturing PANC-1-IN cells IN a six-well plate, dividing the cells into a control group and a GATM low expression group, and respectively transfecting si-NC and si-GATM small interfering RNA by using a Lipo3000 transfection reagent;
(2) changing a normal culture medium after 24 hours of transfection, respectively culturing for 1 day, 2 days, 3 days and 4 days, respectively collecting cells corresponding to different time points by using RIPA cell lysate, and extracting total protein;
(3) determining the protein concentration by a BCA protein quantitative kit, adding a 5 x protein loading buffer solution, performing electrophoretic separation on total protein by using SDS-PAGE gel with a concentration of 10%, and then electrically transferring to an NC membrane;
(4) blocking the NC membrane with 5% skim milk for 1 hour, incubating overnight at 4 ℃ with antibody dilutions;
(5) washing for three times by using a TBST solution, and then incubating for 1 hour at normal temperature by using a secondary antibody diluent marked by HRP;
(6) developing the protein band at the position of 48KDa by using a chemiluminescence developing solution, and detecting GATM expression; and (4) developing a protein band at the position of 135KDa, and detecting the expression of the E-Cadherin.
The Lipo3000 transfection reagent described above was Invitrogen # L3000015.
The above RIPA cell lysate was APPLYGEGENE # C1053.
The BCA protein quantification kit is Saimerfin # UE 284362.
The protein loading buffer was GeneStar #20BB 01.
The antibody diluent is anti-GATM and anti-E-cadherin; the anti-GATM is Proteintech # 12801-1-AP; the anti-E-cadherin was CST # 3195.
The above-mentioned chemiluminescent developer solution was semer fly # VH 311118.
Thirdly, the animal experiment demonstration is carried out according to the following steps:
(1) constructing pancreatic cancer cell strain with GATM stable low expression and corresponding negative control group by using lentivirus, and keeping CO constant temperature at 37 deg.C 2 Culturing and amplifying in an incubator;
(2) digesting and collecting two groups of cells, and injecting pancreas and spleen to NPG mice; the operation process is as follows: anesthetizing a mouse with 2.5% Avertin, cutting a transverse incision of about 0.5cm under the left flank, exposing the pancreas or spleen, injecting cancer cells into the pancreas or spleen with an insulin syringe, and then pressing an injection port with a 75% alcohol cotton swab for 2 minutes to kill the leaked cancer cells; returning pancreas or spleen to original position, suturing peritoneum, muscle and skin layer by layer with 6-0 absorbable suture, sterilizing, and standing in warm environment for reviving;
(3) feeding mice in an SPF-level animal room, injecting 10 mu L/g of D-fluorescein potassium salt into the abdominal cavity of a spleen injection model mouse in the third week of feeding, carrying out IVIS animal in-vivo imaging after 10 minutes, dissecting the mice to separate livers, and observing liver metastasis;
(4) injecting 10 mu L/g D-fluorescein potassium salt into the abdominal cavity of a pancreas in-situ injection model mouse at the fourth feeding period, dissecting the mouse after 7 minutes of injection to separate the liver, and rapidly performing in-vivo imaging of the in-vitro liver; and meanwhile, dissecting and separating the in-situ tumor, weighing the in-situ tumor, extracting total RNA by using a TriZol method, and detecting the expression levels of SNAI1, CDH1 and RHOA genes of the tumor cells by using an RT-qPCR experiment.
The above pancreas injection is injected in an amount of 5X 10 6 Cell/cell; each group had 9 mice.
The injection amount of the spleen injection is 1 × 10 6 Cell/cell; each group had 9 mice.
Fourthly, the detection of the clinical specimen is carried out according to the following steps:
(1) collecting 83 wax masses of the pancreas cancer tissue specimen cut by the operation and making a tissue section with the thickness of 4 nm;
(2) dewaxing the tissue slices by dimethylbenzene and dehydrating the tissue slices by ethanol with different concentrations, and then putting the tissue slices into citric acid antigen repairing liquid to boil for 20min to obtain processed tissue slices;
(3) blocking each treated tissue section by using 10% sheep serum for 30 minutes, and then incubating for 2 hours at normal temperature by using primary anti-GATM diluent to obtain an incubated tissue section;
(4) incubating each incubated tissue section for 30 minutes by using HRP-labeled secondary antibody diluent, then incubating for 20 seconds by using DAB developing solution, and then staining by using hematoxylin to obtain a stained tissue section;
(5) finally, placing the stained tissue slices in ethanol solutions with different concentrations for dehydration, and sealing the slices in neutral resin;
(6) assessing tissue section GATM expression levels;
(7) clinical information of the patients was collected and the GATM expression level was analyzed for correlation with each clinical index.
The pancreatic cancer tissue specimen wax block is collected from a Beijing coordination hospital pathology specimen library.
In the step (2), the mass concentrations of the ethanol solutions with different concentrations are respectively 100%, 85% and 75% in sequence.
In the step (5), the mass concentrations of the ethanol solutions with different concentrations are respectively 75%, 85% and 100% in sequence.
The primary anti-GATM dilution was Sigma # HPA 026077.
The above evaluations were evaluated by two independent pathologists.
Pancreatic cancer cell highly invasive metastatic strain (PANC-1-IN) has been described IN detail IN the previous published studies (Yang G.et al. SCIENCE CHINALife Sciences2019, 62 (6): 791-; by analyzing the GATM expression level in tumor tissues in the pancreatic cancer cohort of the Beijing cooperative Hospital (PUMCH) and the TCGA public database pancreatic cancer cohort, the present invention explored GATM expression levels in pancreatic cancer tissues with lymph node metastasis (N1/2) higher than those in pancreatic cancer tissues without lymph node metastasis (N0) (as shown in FIG. 1A).
Thereafter, the effect on pancreatic cancer cell migration ability and liver metastasis of mouse pancreatic cancer after intervention of GATM gene expression level was explored at the cellular level in vitro and at the in vivo level in animals. The results from Transwell showed that the migration ability of pancreatic cancer cells in GATM-low expressing group was significantly lower than that in normal control group (as shown in FIG. 1B); the western blot experiment detects that the expression level of the E-cadherin in GATM low-expression group pancreatic cancer cells is increased, and the migration capability of the cells is reduced from the molecular level (shown in figure 1C); by constructing an in situ pancreatic cancer injection model and a spleen injection model by using hyperimmune deficient mice, and feeding the mice to the 4 th week and the 3 rd week respectively for in vitro liver tissue and in vivo animal bioluminescence imaging, the growth invasion and liver metastasis of pancreatic cancer can be inhibited after GATM is underexpressed at the in vivo level of the animals (as shown in FIG. 2 and FIG. 3).
Example 2
By using Hi-C sequencing, ChIP-seq sequencing, ChIP-qPCR experiments and 3C-qPCR experiments, a remote enhancer region upstream of the GATM gene promoter was discovered and it was demonstrated that the enhancer can interact with the GATM promoter to promote the transcription and expression level of the GATM gene, and the related data are shown in FIG. 4, FIG. 5, FIG. 6 and Table 1.
Firstly, Hi-C library construction and sequencing are carried out according to the following steps:
(1) cell cross-linking: digestion to collect cells, 1X 10 7 Each cell was fixed for 10 minutes using a formaldehyde solution system with a mass concentration of 1%, the crosslinking was terminated for 5 minutes using glycine solution, and then the cells were washed 3 times using precooled PBS;
(2) cell lysis: resuspending the cell pellet using a Hi-C lysis buffer containing 10mM Tris-HCl, 10mM NaCl, 0.2% NP-40, 1/10 vol of PIC, pH 8.0; then placing on ice for cracking for 15min, and centrifuging to obtain a precipitate;
(3) and (3) restriction enzyme digestion: incubating at 62 deg.C for 5-10 min with 50 μ L of 0.5% SDS, adding 145 μ L of water and 25 μ L of 10% Triton X-10 to quench the SDS, gently mixing to avoid air bubbles, and incubating at 37 deg.C for 15 min; then 25. mu.l of 10 XNEBuffer 2 and 100U of MboI restriction enzyme were added and incubated at 37 ℃ for at least 2h in a thermal mixer;
(4) end labeling: incubating at 62 ℃ for 20min to inactivate the MboI, and then cooling to room temperature; adding 50 mu L Master Mix (formula), blowing, beating, mixing uniformly, and performing rotary incubation at 37 ℃ for 1 hour; the formula of the Master Mix is as follows: 37.5. mu.L of 0.4mM biotin-14-dATP, 1.5. mu.L of 10mM dCTP, 1.5. mu.L of 10mM dGTP, 1.5. mu.L of 10mM dTTP, 8. mu.L of 5U/. mu.L of DNA polymerase I;
(5) the near end is connected: adding 900 mu l of ligation master mix, uniformly mixing, and rotationally incubating at room temperature for 4 hours; the formula of the ligation master mix is as follows: 663. mu.L of water, 120. mu.L of 10 XNEB T4 DNA ligase buffer, 100. mu.L of 10% Triton X-100, 12. mu.L of 10mg/ml BSA, 5. mu.L of 400U/. mu. L T4 DNA ligase;
(6) and (3) decrosslinking: adding 50 μ L protease K and 120 μ L10% SDS, incubating at 55 deg.C for 30min, adding 130 μ L5M NaCl solution, incubating at 68 deg.C for at least 2 hr, and extracting DNA by phenol chloroform method;
(7) fragmenting the extracted DNA, enriching the DNA fragment by Biotin, establishing a library for sequencing and analyzing Hi-C upstream; double-ended 150bp sequencing is carried out by using an Illumina HiSex X Ten sequencing platform, the data volume is 250 Gb/sample, FastQC is used for quality control, Hi-C-Pro is used for removing low-quality reading length, the sequence is aligned to hg19 human genome, a 1M original interaction matrix is constructed, and finally Juicer software or WashU Epigenome Browser is used for visualizing the Hi-C interaction matrix.
The above-described paired-end 150bp sequencing employed PE 150.
II, concrete processes of ChIP-qPCR and ChIP-seq experiments are as follows:
(1) cell cross-linking: digestion to collect cells, 4X 10 6 Each cell was fixed for 10 minutes using a formaldehyde solution system with a mass concentration of 1%, the crosslinking was terminated for 5 minutes using glycine solution, and then the cells were washed 3 times using precooled PBS;
(2) preparation of nuclei and chromatin fragmentation: by using an enzyme hydrolysis ChIP kit, each IP sample is cracked by 1ml Buffer A for 10min, centrifuged at 2000g at 4 ℃ for 5min to precipitate cell nuclei, and then 1ml Buffer B is used for resuspension, then 0.5 mu L Micrococcus nuclearase is added into each IP sample for mixing, and the mixture is incubated at 37 ℃ for 20 min; adding 10 μ L of 0.5M EDTA into each IP sample, placing on ice for 2min to stop digestion, and centrifuging at 16000g at 4 deg.C for 1min to obtain cell nucleus precipitate; add 100. mu.L ChIP Buffer per IP unit and incubate on ice for 10min, use
Breaking nuclear membrane with Plus ultrasonic instrument, using high-grade at 4 deg.C, ultrasonic 15s → intermittent 45s, circulating 40 times, centrifuging 9400g at 4 deg.C for 10min, and collecting supernatant;
(3) chromatin immunoprecipitation: adding 400 μ L ChIP Buffer to each IP sample, adding 10 μ L of the target antibody and 2 μ L of IgG, mixing thoroughly, incubating at 4 ℃ for 4 hours to overnight by rotation, adding 30 μ L of Protein A/G magnetic beads to each IP sample, incubating at 4 ℃ for 2 hours by rotation, washing 3 times with 1mL of low salt Buffer (1 × ChIP Buffer) and 1mL of high salt Buffer (1000 μ L of 1 × ChIP Buffer, 70 μ L of 5M NaCl) on a magnetic rack;
(4) chromatin elution and decrosslinking: placing on a magnetic frame, removing supernatant, adding 150 μ L of 1 XChIP elution buffer solution into each IP sample, performing shaking elution at 65 ℃ for 30 minutes, taking supernatant, adding 6 μ L of 5M NaCl and 2 μ L of Proteinnase K for crosslinking, and incubating at 65 ℃ for at least 2 hours;
(5) DNA purification: adding 750 mu L of DNA Binding Buffer into each DNA sample, centrifuging through a centrifugal column, discarding liquid in a collecting pipe, and adding 750 mu L of DNA Wash Buffer into the centrifugal column for centrifugation; replacing a new collecting pipe, adding 50 mu L of DNA precipitation Buffer into the centrifugal column, and centrifuging for 30s to obtain purified ChIP-DNA;
(6) ChIP-qPCR: carrying out qPCR on 2% input and corresponding ChIP-DNA by using corresponding ChIP primers, and calculating percent input value by using a delta Ct method;
(7) ChIP-seq: use of
The Universal DNA Library Prep Kit for Illumina V3 Kit is used for establishing a Library for ChIP-DNA, an Illumina HiSex X Ten sequencing platform is used for carrying out double-end 50bp sequencing, the data volume is 6 Gb/sample, and FastQC is used for data quality control; aligning sequencing read lengths to hg19 human genomes, annotating the positions of the genomes of all peaks by using Bedtools, finally obtaining bigwig files by using deepTools, and visualizing by using a WashU Epigenome Browser;
the above
The Universal DNA Library Prep Kit for Illumina V3 Kit is Vazyme # ND 607.
The ChIP kit is CST # 9005S.
The above-mentioned 50 bp-end sequencing was PE 50.
The forward primer and the reverse primer of ChIP-qPCR at different positions are shown in Table 1; the sequence is shown in SEQ ID NO. 63-78 in sequence.
TABLE 1
| Primer name | Forward primer (5 '-3') | Reverse primer (5 '-3') |
| GATM_E1-Primer | tccaaatgtgtcccctccac | agcgaaagatgaggctccac |
| GATM_E2-Primer | gcgcaatgttcttccccttg | cttcactgcggaggactgag |
| GATM_E3-Primer | tctatggccggtcttggaga | ctctgccctcctgtctgttg |
| GATM_E4-Primer | tgaatccccgtccctactga | tcactgcaacctccaccttc |
| GATM_E5-Primer | tatggttttgacggctgcga | gctggtgagtgatttcccca |
| GATM_E6-Primer | gatcccagctgctcttctcc | gctcttctctgggctcttgg |
| GATM-P1-Primer | gtagcgccccgaattaggaa | tgcaacagaagccgtcagtg |
| GATM-P2-Primer | cgccccgaattaggaactgtc | cgtgcaacagaagccgtcag |
。
And thirdly, performing 3C-qPCR according to the following steps:
(1) cell cross-linking: digestion to collect cells, 1X 10 7 Each cell was fixed for 10 minutes using a formaldehyde solution system with a mass concentration of 1%, the crosslinking was terminated for 5 minutes using glycine solution, and then the cells were washed 3 times using precooled PBS;
(2) cell lysis: resuspending the cell pellet with 5mL Hi-C lysate, placing on ice for 10min, centrifuging at 4 deg.C for 5min at 400g, and discarding the supernatant; the 10 x formula of the Hi-C lysate is as follows: 100mM Tris-HCl, 100mM NaCl, 2% NP-40, and DEPC water;
(3) and (3) restriction enzyme digestion: 500. mu.L of 1.2 Xrestriction enzyme buffer was added to resuspend the cell pellet; adding 7.5. mu.L of 20% SDS, and incubating at 37 ℃ with shaking for 1 hour; adding 50 mu L of 20% Triton X-100, and incubating for 1h at 37 ℃ with shaking; 400U of HindIII restriction enzyme was added and incubated overnight at 37 ℃; the restriction endonuclease buffer is NEB # R0104L;
(4) the near end is connected: adding 40 mu L of 20% SDS, and incubating for 20 minutes at 65 ℃ with shaking; 6.125ml of 1.15 Xligase buffer (NEB # M2622L) was added; adding 375 ul of 20% Triton X-100, and incubating for 1h at 37 ℃ with gentle shaking; adding 100U of 5 mu LDNA ligase, incubating for 4h at 16 ℃, and then incubating for 30min at room temperature; the DNA ligase is NEB # M2622L;
(5) and (3) performing crosslinking release and DNA purification: adding 30 mu L of 10mg/ml proteinase K, and incubating at 65 ℃ for crosslinking; purifying the DNA by phenol chloroform method (phenol: chloroform: isoamyl alcohol: 25: 24: 1) to obtain 3C-DNA; the protease K is CST # 10012; in phenol chloroform adopted by the phenol chloroform method, the ratio of phenol to chloroform to isoamylol is 25: 24: 1;
(66) 3C-PCR: designing 50bp inner primers of HindIII enzyme cutting sites, diluting 3C-DNA by 50 times, and carrying out qPCR by using SYBR Green PCR reaction reagent (Saimerfin # a 25742); the SYBR Green PCR reaction reagent is semer fly # a 25742.
The positions and primer sequences of the 3C-qPCR primers are shown in Table 2; the sequence is shown in SEQ ID NO. 79-87 in sequence.
TABLE 2
The H3K27ac modification is a marker of an active enhancer, and the high modification level of H3K27ac indicates that the enhancer has high activity and is in a transcriptional activation state relative to a corresponding target gene; the invention analyzes H3K27ac modification information and DNA interaction information of pancreatic cancer cell whole genome level, and obtains the modification map and interaction map of GATM gene H3K27ac by using WashU tool website (http:// epigenomegawatt. while. edu /), the result shows that the GATM gene remote enhancer region has higher level of H3K27ac modification (as shown in figure 4) compared with the pancreatic cancer liver metastasis cell and the pancreatic cancer primary focus cell; DNA sequence information of 6 GATM gene enhancer sites is shown in table 3, and sequences of E1-E6 are shown in SEQ ID NO. 1-6;
TABLE 3
The results of ChIP-qPCR experiments on 6 candidate enhancer sites of GATM gene, which are H3K27ac, show that IN GATM high-expression cell lines (PANC-1-IN, BxPC-3, Capan-1), the enrichment level of H3K27ac of the enhancer sites E5 and E6 is obviously higher than that of GATM low-expression cell lines (MIAPaCa-2 and PANC-1) (as shown IN FIG. 5); meanwhile, the results of the staining-specific conformation capture experiment (3C-qPCR) confirmed that the interaction level of GATM gene candidate enhancers E3, E4, E5 and E6 with the promoter in the GATM high expression cell line was significantly higher than that of the GATM low expression cell line (as shown in FIG. 6).
Example 3
The small guide rna (sgRNA) targeting the remote enhancer of the GATM gene was designed using the CRISPOR tool website (CRISPOR (force.net)) and the epigenetic editing technique (CRISPR/dCas9-KRAB) and the sgrnas with the highest silencing efficiency were identified (10947, 10948, 10949), and the relevant data are shown in figure 7, figure 8 and table 2.
The adopted epigenetic editing technology is based on CRISPR/dCas9-KRAB principle, and the system realizes the transcriptional inhibition of specific genes under the mediation of sgRNA by fusing and expressing dCas9 (inactivated Cas9, dCas9) and inhibitory factors (KRAB, recruitable histone methylase and the like). The amino acid sequence and the nucleotide sequence of the fusion protein of dCas9 and the fusion protein capable of recruiting histone methylase are shown in SEQ ID NO.61 and SEQ ID NO.62 respectively.
The CRISPR/dCas9 plasmids used include, but are not limited to, pCas-Guide-Puro-CRISPR i vector (ORIGEN # GE100083), lenti-EF1a-dCas9-KRAB-Puro (vast Ling # P2842), phU6-sgRNA (vast Ling # P1715) and U6-sgRNA-SV40-Neomycin (Kjeldahl gene).
Experimental results show that, in all sgRNAs, sgRNAs targeting enhancer sites E4, E5 and E6 can significantly silence the expression of the GATM gene (as shown in fig. 7), and that all sgRNAs bind to targeting sequences (as shown in SEQ ID nos. 7 to 24) and DNA template sequences (as shown in SEQ ID nos. 25 to 60) that are transcribed and synthesized into sgRNAs are detailed in table 4;
TABLE 4
Further, a western blot experiment is adopted to detect the silencing efficiency of sgRNAs (respectively corresponding to numbers g10947, g10948 and g10949) of the targeting enhancer sites E4-1, E5-2 and E6-3 on GATM expression, and the result shows that the three sgRNAs have the effect of remarkably silencing GATM expression (as shown in figure 8), and the nucleotide sequences are sequentially shown as SEQ ID No.43, SEQ ID No.44, SEQ ID No.51, SEQ ID No.52, SEQ ID No.59 and SEQ ID No. 60.
The Western blot experiment is carried out according to the following steps:
(1) culturing PANC-1-IN-dCas9-KRAB cells IN a six-well plate, and dividing the cells into a control group and a sgRNA stable expression group;
(2) after culturing for 48 hours, extracting total protein of cells of different groups by using RIPA cell lysate respectively;
(3) determining the protein concentration by a BCA protein quantitative kit, adding a 5 x protein loading buffer solution, performing electrophoretic separation on total protein by using SDS-PAGE gel with a concentration of 10%, and then electrically transferring to an NC membrane;
(4) blocking the NC membrane with 5% skim milk for 1 hour, incubating overnight at 4 ℃ with anti-GATM protein antibody dilutions;
(5) washing for three times by using a TBST solution, and then incubating for 1 hour at normal temperature by using a secondary antibody diluent marked by HRP;
(6) the protein bands at the 48kDa position were visualized using a chemiluminescent visualization solution to detect GATM expression.
The control group was g-con.
The sgRNA stable expression groups are g10947, g10948 and g 10949.
The above RIPA cell lysate was APPLYGEGEN # C1053.
The BCA protein quantification kit is Saimerfin # UE 284362.
The protein loading buffer was GeneStar #20BB 01.
The antibody dilution against GATM protein was Proteitech # 12801-1-AP.
The chemiluminescence developing solution is Saimeifei # VH 311118.
Example 4
The CRISPR/dCas9-KRAB system and the identified sgRNA can obviously inhibit the metastasis of pancreatic cancer cells by using a Transwell experiment, which indicates that the targeting GATM gene activity enhancer has great potential for treating pancreatic cancer metastasis, and the related data are shown in FIG. 9. The Transwell experiment was performed as follows:
(1) PANC-1-IN-dCas9-KRAB cells are inoculated IN a six-well plate and divided into a control group and an sgRNA stable expression group;
(2) after 48 hours of culture, cells were collected using trypsinization, resuspended in serum-free medium, and counted;
(3) four groups of cells were inoculated into the upper chamber of a Transwell chamber, and complete medium containing 10% fetal bovine serum was added to the lower chamber;
(4) placing at 37 ℃ constant temperature CO 2 And (3) incubating, fixing and staining the cell of the chamber after 24 hours by using a 0.1% crystal violet methanol solution, washing the chamber after 30 minutes, drying, observing the cancer cells migrating to the bottom surface of the chamber by using an optical microscope, counting the cancer cells and carrying out statistical analysis.
The control group was g-con.
The stable sgRNA expression groups are g10947, g10948, and g 10949.
The upper chamber of the Transwell chamber was Costar #3422 for a total of 20000 cells/chamber.
Sequence listing
<110> Beijing coordination hospital of Chinese academy of medical sciences
<120> sgRNA targeting GATM gene and use thereof
<160> 87
<170> SIPOSequenceListing 1.0
<210> 1
<211> 663
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttacagtcct aagccaccgc gccaggcccg gatacccttt tagaagggtt ggctttccct 60
caggcctcgg ctatctgcgc tcccctctta gggggttcca cctcctactc cccaaacctc 120
caaactcctc acaagcacct aggggggcca agagcgaccg gggtcggcag gtaaggaaga 180
ccgcggcgag cggcaggggg cgccagcgcc cgcgttcggg cgcttcacgt cagccgcaga 240
atgtcctgca gggggcgccc gggagtcgcg tgcccaacgg ggaaagcgag tcaggtccct 300
cgcgctcccc gccccacgcg cgtgaccaga gcgcgctggc ccggcccacc cggggcggtt 360
gtggtcgcta tatataaggt ggggaggccg ccggcccgtt cggttccggg cgttaccatc 420
gtccgtgcgc accgcccggc gtccaggtga gtctcccatc tgcagagacg cggacgcgcc 480
ggcccgcagt tggcctgcgg agcgcggtgg acggtttggc gcccaccagg cgatcaatac 540
tttggatttt taatttctag atttggcaat tcttcgctga agtcatcatg agctttttcc 600
aactcctgat gaaaaggaag gaagtaagtt ttaaaaacaa ttgaaaatct tgactaaagt 660
ttt 663
<210> 2
<211> 1325
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agtttgagaa tatcctgggc aacatagtaa gatcccatct ctacaaaaaa acaaaaatat 60
aaagtcattt ccatttgtga gctgtgttca gaggcctggg agctgggttg aggcagggag 120
ggatgtgggg agcccagggt gtggaggagg cagcggggct ccctgggccg tgaaggtcgc 180
tgaacaaagg agaccgtcca ggtttggcca ctggtgcttg ctgctgtccc cgaaatgaga 240
tcggagggga ggggcaggtt tggaggagag gtgacaagtc tgagtgccca tgggacatcc 300
agcttgatat ataaaccaga aggtgctgga agccttaggt gtgagtgaga agacacagag 360
atgtggagag gagggctggg ggtgacctgg agaaacaact gttaaggagg gggcagagaa 420
tcaagtggcc aggaagtttg gggacacgtt gggagggcca cctcaggccc gggagtcctg 480
ttgcctcttc tcctgtgctg ttacccagca gggggaccag gggcctggga gaggcgccag 540
cactttacta acagcccagc gccttggggt ttcgtttctg ctgggttctg gctcaccttc 600
ctcttgtggt cagaagaatg cagaatcctg tggtttcccc gctgtgtcgt cacaaggcct 660
gctgccagcc tgccgcactt ttcctcagct ccatcactga acttctttca tttttgcaga 720
tgaaccttgt caccctcctc ataacccagg tttcccctgc ctcctcccca cccccagatc 780
agtcctccca ccctgtaagt gagccaggct cttcccagct gtgccctggg tgggctcaag 840
ggtgtttcct gggcatggta ccacctctcc ctcccattgc ctccctgctc ctgcttccct 900
cccctctggt ctggctgaga aaaaggtcca gagttggcag agcaggtgga aagccggggg 960
ctggctgtcc cagctgctgc acattcaggt tctgggatct gtgggccagg tgcagtgctg 1020
tgctgctaaa tggataacaa caggctctgg gggcaagcag tgcagcatta gctgatttct 1080
atgacacaaa tactcccacc acgggcaatt tcaggctact accaagatgt tactgaaggc 1140
agaatgggaa gaggtgtgca gcagcacctg ccgtacgata gttccaccct acacccaata 1200
gacacgagta gcctcaagcg tatctataac tgcaaaacat actagaagaa ttaggaagtg 1260
atatgttttc agtattcatt gctttttaaa taatttattt tcagccgggc atggtggctc 1320
acgcc 1325
<210> 3
<211> 914
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cagaatgaag acccaaagat atagggaaaa ctgttcattt ttatgcttat gttcaatgaa 60
aagtcgatgt agaaatatga ttggacatgt agaaatatgg acaaaaagga tatggtccta 120
atgctatcag aatagactac atggggaagc tcaccaaggc ctgtctgcag catttccttc 180
tgctgggtgt gggggtggga tccctctgga atgagtgtct taatttcttt atggccagct 240
gttacataga aaggtggggg aaatttaaga gcaatatatt taggttttat ggctggcttt 300
caggaaacgg gattctggct tctatggccg gtcttggaga agaggaattc tagtttctat 360
ggctcacctg gggaagaatc agggtcaaca gacaggaggg cagagaaact ttgcttctgc 420
ggccttcatt tggggtatca ttttttgggc tccagcgtta ccttcacagc aataacaaat 480
aactaggttt tgccaggaac ttggcaactc tgagaggatt aaagcaagac tgctgccaac 540
ttctgttgct tccttatcac ctcaagtcgt ctcagattaa agtctctgat agttgatctc 600
aaggaattac acgtagcaat tgggaagcac atttttattt gcttaagctt ctaaagtcta 660
atgtaatgtc atttgcacaa ataaaaatta acggttggtc aactaagaga gcaaagtata 720
gagtgttttt caagggatga ctgtggcttt caactttaaa acacaaacct gattgaaatg 780
tggtggtgtg aacatggcaa tgggaggtac ttttctgcag gtttaggagg gagagaggcc 840
aaaagcaatg ttgatgctta aatttcaaaa gatttgggtt ttgttgttgt gttcttagca 900
tttccttcaa acat 914
<210> 4
<211> 468
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aataaggaaa tgaagttgag tgcatgtacc taagatagcg gtaggaattt tcaacctaaa 60
gaaggacact gaggcaaaat taacagagag aatttattgg ggccaaggtt gagaactgca 120
gcccgggaca cacttcccag ttgccttgca gagtgctccc gccagggttt gctgcaagca 180
ggtttttaag ggcaaaggga acaaaaggtg gtctgacaaa gttgtttgac aggagtgctc 240
cttggtttat agaaacaaca ctgattaatg attaactgta cattgttgaa ctatagggta 300
tgcacgatgg tgtccagtgt atggcatttt atggctgctt ggcgttagtc tagagcccac 360
atagcaaatg gcttcaagag gtagtcactt agctcaagga tgtgactgct gtcacactct 420
gtcacatttc aatgcctctc tgggcctgat aactaaagca ttcctcag 468
<210> 5
<211> 829
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggagggcaac cccacagcgc cctccggccc agaaaggggc ctgggaggca cttggctcca 60
ctgccctgag ggattgggca acctgggtgt gtccccgctg ttcctggaga gttggctcat 120
tccctccctc ctctccaaaa acaaactcag acgcccatgg tgaggtcagt ttcagttgaa 180
gctgctttgc ataaaaaaaa aaaacaaaaa cacatctcct tcctcttgat gggaatactt 240
acaccaaaaa gctttacgag catatggttt tgacggctgc gaggtcagga gatgggggtt 300
ttcctcttgc tctgcaggac cttggggaaa tcactcacca gctaacgtgt gtcagtgctc 360
accgtgcgcc agccaccttt gaatcctcca cagcccttga ggctttttca gtgaatgccg 420
agaggcaggt gctttgcctg gctgccatgg ccctgtaatc agcagagctg ggatttgcgc 480
ctgggggttc aggatgtagc caagtgttag agcatttccg agatccttcc cagtgcccaa 540
acttcccgct tctctagttc taagtcactg gccatctgac cgtgggagac tatggcttag 600
gctggccaca cttgttctaa tcttggggtc taggatgtcc cagagggctg catcctgcca 660
tgaccatggg taaacagctt cacttgtccc tgaagcttcc tttacaggga gaacagggca 720
caaccccaca gcagacacag cagacgcgtg ggtctcacca ccagcctgtg tttttaaggg 780
catagacctt gtgttctcac ttttgtataa ctgaccccct accccatgc 829
<210> 6
<211> 657
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cgaggatggt gtggtacacc aggaaagccg tagggggatg gaactggcca ggcagactgt 60
ggctggaatg ggagaggctc gagggctgga ctaagtggct gggacttcat ccagccagcc 120
aaggagggtc tggtcatgtt tgtgagccga gaaggtaaac agagcgcacc tgggctggtt 180
tccttctctc aggccttcct ggcggccacg ccttaccgaa aggagtcctg actcagagct 240
gctgtgccgt cccttctcct gtccctgcct ggaagaggcc tatcaggttg accaagcttt 300
gctcccacct gtggatgaga agggcaggtg gccgagagtg ggtgtggagg aggaagactg 360
gatgccaatg atcctgtgag tttcattcat tggaggtgta actttcaggc tcaaactaga 420
ggcaaaagat gaggcagtcc atgggaaaca ggggagcagg cgtagcagag gggctccggc 480
tgacgacagg caggggactt gcttcttctg tttgtttgtt agaaatcatg actctgccat 540
tatctgctgt gacatcttgg gtacttaatc cctcactcga gacctcagtg tcgtcttctg 600
taaactgaat ggagtggtcc aggtgatctt tcaactctgt aattccaagg aagaagg 657
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gacgtgaagc gcccgaacgc ggg 23
<210> 8
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tgacgtgaag cgcccgaacg cgg 23
<210> 9
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cgcgctctgg tcacgcgcgt ggg 23
<210> 10
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gggtggaact atcgtacggc agg 23
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gtccccgaaa tgagatcgga ggg 23
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tgtagggtgg aactatcgta cgg 23
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tgagacgact tgaggtgata agg 23
<210> 14
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
aggaattaca cgtagcaatt ggg 23
<210> 15
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tattgctgtg aaggtaacgc tgg 23
<210> 16
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
catgtaccta agatagcggt agg 23
<210> 17
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gaactatagg gtatgcacga tgg 23
<210> 18
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
cttgcagagt gctcccgcca ggg 23
<210> 19
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
gagcactgac acacgttagc tgg 23
<210> 20
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
agcagacaca gcagacgcgt ggg 23
<210> 21
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
catagtctcc cacggtcaga tgg 23
<210> 22
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
ggcggccacg ccttaccgaa agg 23
<210> 23
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ttcggtaagg cgtggccgcc agg 23
<210> 24
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
ggtacaccag gaaagccgta ggg 23
<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
caccgacgtg aagcgcccga acgc 24
<210> 26
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
aaacgcgttc gggcgcttca cgtc 24
<210> 27
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
caccggacgt gaagcgcccg aacg 24
<210> 28
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
aaaccgttcg ggcgcttcac gtcc 24
<210> 29
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
caccggcgct ctggtcacgc gcgt 24
<210> 30
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
aaacacgcgc gtgaccagag cgcc 24
<210> 31
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
caccgggtgg aactatcgta cggc 24
<210> 32
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
aaacgccgta cgatagttcc accc 24
<210> 33
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
caccgtcccc gaaatgagat cgga 24
<210> 34
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
aaactccgat ctcatttcgg ggac 24
<210> 35
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
caccggtagg gtggaactat cgta 24
<210> 36
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
aaactacgat agttccaccc tacc 24
<210> 37
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
caccggagac gacttgaggt gata 24
<210> 38
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
aaactatcac ctcaagtcgt ctcc 24
<210> 39
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
caccgggaat tacacgtagc aatt 24
<210> 40
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
aaacaattgc tacgtgtaat tccc 24
<210> 41
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
caccgattgc tgtgaaggta acgc 24
<210> 42
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
aaacgcgtta ccttcacagc aatc 24
<210> 43
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
caccgatgta cctaagatag cggt 24
<210> 44
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
aaacaccgct atcttaggta catc 24
<210> 45
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
caccgaacta tagggtatgc acga 24
<210> 46
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
aaactcgtgc ataccctata gttc 24
<210> 47
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
caccgttgca gagtgctccc gcca 24
<210> 48
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
aaactggcgg gagcactctg caac 24
<210> 49
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
caccgagcac tgacacacgt tagc 24
<210> 50
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
aaacgctaac gtgtgtcagt gctc 24
<210> 51
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
caccggcaga cacagcagac gcgt 24
<210> 52
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
aaacacgcgt ctgctgtgtc tgcc 24
<210> 53
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
caccgatagt ctcccacggt caga 24
<210> 54
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
aaactctgac cgtgggagac tatc 24
<210> 55
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
caccggcggc cacgccttac cgaa 24
<210> 56
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
aaacttcggt aaggcgtggc cgcc 24
<210> 57
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
caccgtcggt aaggcgtggc cgcc 24
<210> 58
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
aaacggcggc cacgccttac cgac 24
<210> 59
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
caccggtaca ccaggaaagc cgta 24
<210> 60
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
aaactacggc tttcctggtg tacc 24
<210> 61
<211> 2048
<212> DNA
<213> dCas9-KRAB (Artificial sequence)
<400> 61
gacaagaagt acagcatcgg cctggccatc ggcaccaact ctgtgggctg ggccgtgatc 60
accgacgagt acaaggtgcc cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac 120
agcatcaaga agaacctgat cggagccctg ctgttcgaca gcggcgaaac agccgaggcc 180
acccggctga agagaaccgc cagaagaaga tacaccagac ggaagaaccg gatctgctat 240
ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg acagcttctt ccacagactg 300
gaagagtcct tcctggtgga agaggataag aagcacgagc ggcaccccat cttcggcaac 360
atcgtggacg aggtggccta ccacgagaag taccccacca tctaccacct gagaaagaaa 420
ctggtggaca gcaccgacaa ggccgacctg cggctgatct atctggccct ggcccacatg 480
atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg 540
gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga aaaccccatc 600
aacgccagcg gcgtggacgc caaggccatc ctgtctgcca gactgagcaa gagcagacgg 660
ctggaaaatc tgatcgccca gctgcccggc gagaagaaga atggcctgtt cggcaacctg 720
attgccctga gcctgggcct gacccccaac ttcaagagca acttcgacct ggccgaggat 780
gccaaactgc agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag 840
atcggcgacc agtacgccga cctgtttctg gccgccaaga acctgtccga cgccatcctg 900
ctgagcgaca tcctgagagt gaacaccgag atcaccaagg cccccctgag cgcctctatg 960
atcaagagat acgacgagca ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag 1020
cagctgcctg agaagtacaa agagattttc ttcgaccaga gcaagaacgg ctacgccggc 1080
tacattgacg gcggagccag ccaggaagag ttctacaagt tcatcaagcc catcctggaa 1140
aagatggacg gcaccgagga actgctcgtg aagctgaaca gagaggacct gctgcggaag 1200
cagcggacct tcgacaacgg cagcatcccc caccagatcc acctgggaga gctgcacgcc 1260
attctgcggc ggcaggaaga tttttaccca ttcctgaagg acaaccggga aaagatcgag 1320
aagatcctga ccttccgcat cccctactac gtgggccctc tggccagggg aaacagcaga 1380
ttcgcctgga tgaccagaaa gagcgaggaa accatcaccc cctggaactt cgaggaagtg 1440
gtggacaagg gcgcttccgc ccagagcttc atcgagcgga tgaccaactt cgataagaac 1500
ctgcccaacg agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtat 1560
aacgagctga ccaaagtgaa atacgtgacc gagggaatga gaaagcccgc cttcctgagc 1620
ggcgagcaga aaaaggccat cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg 1680
aagcagctga aagaggacta cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc 1740
ggcgtggaag atcggttcaa cgcctccctg ggcacatacc acgatctgct gaaaattatc 1800
aaggacaagg acttcctgga caatgaggaa aacgaggaca ttctggaaga tatcgtgctg 1860
accctgacac tgtttgagga cagagagatg atcgaggaac ggctgaaaac ctatgcccac 1920
ctgttcgacg acaaagtgat gaagcagctg aagcggcgga gatacaccgg ctggggcagg 1980
ctgagccgga agctgatcaa cggcatccgg gacaagcagt ccggcaagac aatcctggat 2040
ttcctgaa 2048
<210> 62
<211> 65
<212> PRT
<213> dCas9-KRAB (Artificial sequence)
<400> 62
Arg Thr Leu Val Thr Phe Lys Asp Val Phe Val Asp Phe Thr Arg Glu
1 5 10 15
Glu Trp Lys Leu Leu Asp Thr Ala Gln Gln Ile Val Tyr Arg Asn Val
20 25 30
Met Leu Glu Asn Tyr Lys Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr
35 40 45
Lys Pro Asp Val Ile Leu Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu
50 55 60
Val
65
<210> 63
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
<210> 64
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
<210> 65
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
<210> 66
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
<210> 67
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 67
<210> 68
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 68
ctctgccctc ctgtctgttg 20
<210> 69
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 69
<210> 70
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 70
tcactgcaac ctccaccttc 20
<210> 71
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 71
<210> 72
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 72
<210> 73
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 73
<210> 74
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 74
<210> 75
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 75
<210> 76
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 76
<210> 77
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 77
cgccccgaat taggaactgt c 21
<210> 78
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 78
<210> 79
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 79
<210> 80
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 80
<210> 81
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 81
<210> 82
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 82
<210> 83
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 83
tgtgcagacg aggagaggtc 20
<210> 84
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 84
<210> 85
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 85
<210> 86
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 86
<210> 87
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 87
Claims (10)
1. An enhancer of GATM gene activity associated with pancreatic cancer metastasis, characterized by: the enhancer is a remote enhancer E1-E6 targeting the upstream of a human GATM gene promoter, and the complete nucleotide sequences are respectively as follows:
1) e1: the sequence shown as SEQ ID NO.1 and the reverse complementary sequence thereof;
2) e2: the sequence shown as SEQ ID NO.2 and the reverse complementary sequence thereof;
3) e3: a sequence shown as SEQ ID NO.3 and a reverse complementary sequence thereof;
4) e4: the sequence shown as SEQ ID NO.4 and the reverse complementary sequence thereof;
5) e5: the sequence shown as SEQ ID NO.5 and the reverse complementary sequence thereof;
6) e6: the sequence shown as SEQ ID NO.6 and the reverse complementary sequence thereof.
2. The enhancer of pancreatic cancer metastasis-associated GATM gene activity according to claim 1, wherein: selecting three target sequences with the highest specificity from each enhancer region, and taking the target sequences as the binding sites of sgRNAs; the E1 comprises three target sequences of E1-1, E1-2 and E1-3; e2 includes three target sequences of E2-1, E2-2 and E2-3; e3 includes three target sequences of E3-1, E3-2 and E3-3; e4 includes three target sequences of E4-1, E4-2 and E4-3; e5 includes three target sequences of E5-1, E5-2 and E5-3; e6 includes three target sequences of E6-1, E6-2 and E6-3; the sequence is shown in SEQ ID NO. 7-SEQ ID NO.24 in sequence.
3. An sgRNA targeting the GATM gene activity enhancer, characterized in that: the nucleotide sequence of a DNA template transcribed and synthesized by the sgRNA is shown in SEQ ID NO. 25-SEQ ID NO. 60.
4. The sgRNA targeting the GATM gene activity enhancer according to claim 3, wherein: the sgRNA is the sgRNA with the numbers of g10947, g10948 and g10949, and the nucleotide sequence is sequentially shown as SEQ ID NO.43, SEQ ID NO.44, SEQ ID NO.51, SEQ ID NO.59 and SEQ ID NO. 60.
5. An inhibitor of GATM gene expression, characterized by: comprising the sgRNA of claim 3 or 4.
6. Use of the sgRNA of claim 3 or 4 or the GATM gene expression inhibitor of claim 5 in the preparation of a medicament for treating pancreatic cancer metastasis.
7. A GATM gene editing tool, comprising: including dCas9 and inhibitor's fusion protein, above-mentioned sgRNA and vector.
8. The GATM gene editing tool of claim 7, wherein: the inhibitory factor is recruitable histone methylases.
9. The GATM gene editing tool of claim 8, wherein: the amino acid sequence and the nucleotide sequence of the fusion protein of dCas9 and the fusion protein capable of recruiting histone methylase are shown in SEQ ID NO.61 and SEQ ID NO.62 respectively.
10. Use of the gene editing tool of any one of claims 7 to 9 for the manufacture of a medicament for the treatment of pancreatic cancer metastasis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210752446.4A CN115074365B (en) | 2022-06-28 | 2022-06-28 | sgRNA targeting GATM gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210752446.4A CN115074365B (en) | 2022-06-28 | 2022-06-28 | sgRNA targeting GATM gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115074365A true CN115074365A (en) | 2022-09-20 |
| CN115074365B CN115074365B (en) | 2023-02-28 |
Family
ID=83255818
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210752446.4A Active CN115074365B (en) | 2022-06-28 | 2022-06-28 | sgRNA targeting GATM gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115074365B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2500482A1 (en) * | 2002-09-30 | 2004-04-15 | Oncotherapy Science, Inc. | Method for diagnosing pancreatic cancer |
| CN1726395A (en) * | 2002-12-17 | 2006-01-25 | 北京诺赛基因组研究中心有限公司 | Specific markers for pancreatic cancer |
| US20130317083A1 (en) * | 2012-05-04 | 2013-11-28 | Thomas Jefferson University | Non-coding transcripts for determination of cellular states |
| CN110613850A (en) * | 2019-05-24 | 2019-12-27 | 中国医学科学院北京协和医院 | Cyclin-dependent kinase 1 inhibitors and uses thereof |
| CN113801881A (en) * | 2021-08-27 | 2021-12-17 | 浙江大学 | Use of super enhancer gene sequence in promoting human B2M gene expression |
-
2022
- 2022-06-28 CN CN202210752446.4A patent/CN115074365B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2500482A1 (en) * | 2002-09-30 | 2004-04-15 | Oncotherapy Science, Inc. | Method for diagnosing pancreatic cancer |
| CN1726395A (en) * | 2002-12-17 | 2006-01-25 | 北京诺赛基因组研究中心有限公司 | Specific markers for pancreatic cancer |
| US20130317083A1 (en) * | 2012-05-04 | 2013-11-28 | Thomas Jefferson University | Non-coding transcripts for determination of cellular states |
| CN110613850A (en) * | 2019-05-24 | 2019-12-27 | 中国医学科学院北京协和医院 | Cyclin-dependent kinase 1 inhibitors and uses thereof |
| CN113801881A (en) * | 2021-08-27 | 2021-12-17 | 浙江大学 | Use of super enhancer gene sequence in promoting human B2M gene expression |
Non-Patent Citations (1)
| Title |
|---|
| 庄云英等: "CRISPR/Cas9技术及其在胰腺癌研究中的应用进展", 《武警医学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115074365B (en) | 2023-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Aune et al. | Long non-coding RNAs in innate and adaptive immunity | |
| AU2021224760A1 (en) | Capturing genetic targets using a hybridization approach | |
| US8574832B2 (en) | Methods for preparing sequencing libraries | |
| JP2019531741A (en) | Group division and prognosis prediction system based on biological characteristics of gastric cancer | |
| US20210403507A1 (en) | Peptide probe for recognition of g-quadruplex and use thereof in detection of g-quadruplex in cell | |
| CN113889187B (en) | Single-sample allele copy number variation detection method, probe set and kit | |
| CN1331700A (en) | Generation of antibodies using polynucleotide vaccination in avian species | |
| JPH06508262A (en) | Methods for describing the antibody (Ab) and T cell receptor (TcR) repertoire of an individual's immune system | |
| CN109837345A (en) | Detect the primer and method of mouse cell residual DNA | |
| CN109402127A (en) | One group of high affinity nucleic acid aptamers and its application specifically bound with Connective Tissue Growth Factor | |
| CN113350366A (en) | Application of aptamer | |
| CN108531544A (en) | A kind of method of miR-181b target genes screening | |
| Wang et al. | Identification of a novel molecular probe for recognition of human osteosarcoma cell using the cell-SELEX method | |
| CN115074365B (en) | sgRNA targeting GATM gene and application thereof | |
| KR20220053671A (en) | Evaluation method of gene editing therapy based on off-target evaluation | |
| Miguelena Chamorro et al. | Characterization of Canine Peyer’s Patches by Multidimensional Analysis: Insights from Immunofluorescence, Flow Cytometry, and Single-Cell RNA Sequencing | |
| JP2800850B2 (en) | Methods for detecting neoplasia | |
| TW201204393A (en) | Diagnostic agent and therapeutic agent of cancer | |
| RU2180963C2 (en) | Immunomagnetic separation of cells used for identification of genes associated with site-preferable cancer metastasis formation | |
| WO2017114008A1 (en) | Bcr gene and abl gene detection probe, preparation method therefor, and reagent kit | |
| CN112522401A (en) | Application of TOX3 gene overexpression as liver cancer prognosis marker | |
| CN112029833A (en) | Rapid identification method of CTNNB1 gene mutation for tumor organoid culture condition selection | |
| Huang et al. | Discovery of an unconventional lamprey lymphocyte lineage highlights divergent features in vertebrate adaptive immune system evolution | |
| CN114085908B (en) | Gene target combination for evaluating glioblastoma treatment effect and application thereof | |
| CN114438090B (en) | Specific binding Brucella outer membrane protein Omp31 nucleic acid aptamer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |