CN115073603A

CN115073603A - Improved c-Met neutralizing antibody and preparation method and application thereof

Info

Publication number: CN115073603A
Application number: CN202210681591.8A
Authority: CN
Inventors: 蒋明; 郭佳; 尹衍新; 于丽华; 付敏; 毛玉婷
Original assignee: SUZHOU RESEARCH INSTITUTE OF TONGJI UNIVERSITY
Current assignee: SUZHOU RESEARCH INSTITUTE OF TONGJI UNIVERSITY
Priority date: 2022-06-15
Filing date: 2022-06-15
Publication date: 2022-09-20

Abstract

The invention discloses an improved c-Met neutralizing antibody, and a preparation method and application thereof. Belongs to the technical field of biological pharmacy. According to the invention, through a random mutation library of the antibody and a cell display technology, the structure and activity of the agonistic c-Met antibody with the neutralizing activity are optimized, the antibody with high affinity and low agonistic activity is obtained, the neutralizing and internalizing activity of a parent antibody is maintained, and the drug forming property of the c-Met antibody is improved. The obtained mutant antibody 2G5 has good purification effect, IC50 of 41.53ng/ml and strong binding capacity with the extracellular region of c-Met. The blocking ELISA experiment results showed that the mutant antibody 2G5 has significant neutralizing activity, and in a549 cells, the antibody elicits significant internalization effect. The mutant antibody 2G5 failed to activate the c-Met signaling pathway in a549 cells and failed to cause HUVEC cell proliferation and a549 cell migration. A mutant antibody having higher drug potency was obtained.

Description

Improved c-Met neutralizing antibody and preparation method and application thereof

Technical Field

The invention relates to the technical field of biological pharmacy, in particular to an improved c-Met neutralizing antibody and a preparation method and application thereof.

Background

Human mesenchymal epithelial transformation factor (c-Met) is a tyrosine kinase receptor on the cell surface, and Hepatocyte Growth Factor (HGF) is its natural ligand, which induces dimerization and intracellular tyrosine phosphorylation. C-Met is used as a marker and is widely existed in various tumor tissues, and an HGF/C-Met signal channel is also involved in various pathological processes such as proliferation, survival, invasion, angiogenesis and the like of tumors and cancers. In recent years, tumor-targeted therapeutic approaches based on c-Met antibodies have been extensively studied, and strategies include: 1) adopting a naked antibody or a genetic engineering antibody as a neutralizing antibody to antagonize an HGF/c-Met channel; 2) an Antibody Drug Coupling (ADC) strategy is adopted to develop high-specificity and high-toxicity cytotoxin; 3) c-Met high expression tumor cells are killed by the recruitment of lymphocytes by the bispecific antibody. At present, ADC medicine ABBV-399 of Alberville company progresses quickly and has a good anti-tumor effect on non-small cell lung cancer, and an antibody ABT-700 in the ADC medicine is a neutralizing antibody taking c-Met as a target spot and has good combination and internalization characteristics.

c-Met has a complex structure and an activation mechanism, and the difference of epitopes can bring the difference of antibody functions in the development process of c-Met antibodies. The bivalent structure of the antibody may directly cause c-Met dimerization through HGF-independent pathways, activating downstream tumor-promoting signaling pathways. Not only can such agonistic antibodies not be directly used for the development of antagonistic drugs, but also there is a potential secondary tumorigenic risk in ADC drugs.

Although the problem of agonistic activity can be solved by constructing a single-chain or single-arm antibody by genetic engineering means, there are still technical problems such as reduction of half-life and difficulty in purification.

Therefore, how to provide an improved c-Met neutralizing antibody is a problem to be solved urgently by those skilled in the art.

Disclosure of Invention

In view of the above, the invention provides an improved c-Met neutralizing antibody, and a preparation method and application thereof.

The invention is based on an agonist c-Met antibody 3E1D7 with neutralization activity, and selects a mutant antibody with high affinity and low activation activity and retaining the neutralization and internalization capacity from a heavy chain complement determining region 3 (CDR 3) random mutant antibody library by random mutation and cell display technology. The activation activity of the c-Met antibody 3E1D7 is optimized mainly, random mutation is carried out on amino acids in CDR3, and the activation activity is hopefully reduced or eliminated through repeated beating of side chain groups of the amino acids, and the activation activity such as neutralization and endocytosis is kept as much as possible. After the screening of the binding capacity by using the antigen fusion protein, the mutant antibody 2G5 was successfully obtained. The agonistic activity of the mutant antibody is obviously reduced through c-Met phosphorylation, tumor cell migration and endothelial cell proliferation experiments, and the mutant antibody has obvious inhibition effect on HGF binding through a neutralization experiment, and more importantly, the mutant antibody still maintains the endocytic activity of a parent antibody. It was shown that c-Met mutant antibody 2G5 was more potent than the parent antibody, whether as a neutralizing antibody or ADC prodrug.

In order to achieve the purpose, the invention adopts the following technical scheme:

the preservation information is as follows: culture name (taxonomic nomenclature): human embryonic kidney cell 293T-2G5, accession number: CCTCC NO, C2021157, preservation address: (Wuhan university, China) China center for type culture Collection), as received (storage date): 24/6/2021.

An improved c-Met neutralizing antibody, wherein the amino acid sequence of the heavy chain CDR3 is replaced by the sequence shown in SEQ ID NO.2 based on the amino acid sequence of the antibody 3E1D 7.

The invention also provides a gene for improving the c-Met neutralizing antibody, and the nucleotide sequence of the amino acid of the coded heavy chain CDR3 is shown in SEQ ID NO. 3.

The present invention also provides a recombinant vector comprising the gene of claim 2.

The invention also provides a recombinant cell capable of secreting the antibody or the recombinant vector.

Preferably: the preservation number is CCTCC NO: C2021157.

The invention also provides application of the improved c-Met neutralizing antibody in preparation of antitumor drugs.

Preferably: the tumor is non-small cell lung cancer.

Compared with the prior art, the invention optimizes the structure and activity of the agonistic c-Met antibody with neutralizing activity by the random mutation library of the antibody and the cell display technology to obtain the antibody with high affinity and low agonistic activity, maintains the neutralizing and internalizing activity of the parent antibody and improves the drug forming property of the c-Met antibody. The obtained mutant antibody 2G5 has good purification effect and IC ₅₀ 41.53ng/ml, and has strong binding capacity with the extracellular region of c-Met. The blocking ELISA experiment results showed that the mutant antibody 2G5 has significant neutralizing activity, and in a549 cells, the antibody elicits significant internalization effect. The mutant antibody 2G5 failed to activate the c-Met signaling pathway in a549 cells and failed to cause HUVEC cell proliferation and a549 cell migration. A mutant antibody having higher drug potency was obtained.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a schematic diagram of the basic structure of p CMV-2G5-H lentivirus expression vector provided by the invention.

FIG. 2 is a diagram showing the results of SDS-PAGE non-denaturing and denaturing electrophoresis provided by the present invention, wherein the left side shows the results of non-denaturing electrophoresis, and the right side shows the results of denaturing electrophoresis.

FIG. 3 is a diagram showing the detection of the recognition and binding ability of the c-Met antibody to the target c-Met provided by the present invention.

FIG. 4 is a targeting assay of anti-human c-MET antibodies provided by the invention.

FIG. 5 is a graph showing the effect of internalization of human non-small cell lung cancer cells (A549) by anti-human c-MET antibodies provided by the present invention.

FIG. 6 is a diagram showing the effect of anti-human c-MET mutant antibody on the c-MET signaling pathway of human NSCLC (A549) cells provided by the present invention.

FIG. 7 is a graph showing the effect of anti-human c-MET antibodies provided in the present invention on Human Umbilical Vein Endothelial Cell (HUVEC) proliferation.

FIG. 8 is a graph showing the effect of anti-human c-MET mutant antibodies on the migration of human non-small cell lung cancer cells (A549) according to the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The embodiment of the invention discloses an improved c-Met neutralizing antibody, and a preparation method and application thereof.

The lentivirus expression plasmid pRRL-CMV and a packaging plasmid thereof are purchased from invitrogen company (the cargo numbers K497500 and K531520), pCMV-ch3E1D7-L and pCMV-ch3E1D7-H (refer to Zhang Longzhen, Guo Jia, Guo Hua, and the like). the construction of the recombinant anti-c-Met chimeric antibody and the rapid expression thereof by using lentivirus, the university of the fertilizer industry, 2017,40(6): 835-; competent E.coli DH5 α was purchased from Beijing Quanjin Biotechnology Ltd; restriction endonucleases and high fidelity DNA polymerases were purchased from NEB corporation; agarose affinity medium ProteinA was purchased from the national research center for Biochemical engineering technology. 293T cells and A549 cells were purchased from Shanghai cell biology institute of Chinese academy of sciences, and HUVEC cells were purchased from Allcellels. High-glucose DMEM medium was purchased from Gibco, HUVEC basal medium was purchased from Allcells, and fetal bovine serum was purchased from Gibco. Commercial recombinant human C-Met protein, recombinant human HGF protein and human HGF antibody were purchased from R & D. Met antibody, p-Met antibody, beta-actin antibody, HRP-labeled anti-rabbit secondary antibody, HRP-labeled streptavidin secondary antibody, and HRP-labeled anti-mouse secondary antibody were purchased from CST. The pHAbAb Amine Reactive Dye kit was purchased from Promega corporation. The TMB color developing solution is purchased from Beijing Tiangen Biotech limited. Cell proliferation assay kits (CCK8) were purchased from Dojindo. NC membrane, ECL chemiluminescent reagent was purchased from Pierce, USA.

Example 1

Construction of 2G5 full-molecular expression vector

3E1D7 is a targeted human c-MET chimeric antibody (see Zhang Longzhen, Guo Jia, Shiwa, etc. the construction of the recombinant anti-c-Met chimeric antibody and the rapid expression thereof by using lentivirus, school report of Hefei university, 2017,40(6):835-839), and has neutralization activity and agonistic activity. Random mutant antibody libraries of the 3E1D7 heavy chain CDR3 were constructed by cell surface display technology (see Guojia, Jiang Yun, Tengfei, et al. construction of random mutant mammalian cell surface display libraries of the mesenchymal epithelial transformation factor (c-Met) chimeric antibody heavy chain CDR 3. journal of cell and molecular immunology, 2019,35(5): 557-. On this basis, the amino acid sequence of the heavy chain CDR3 of the parent antibody 3E1D7 is as follows: RSGYHGTSYWYFD, as shown in SEQ ID NO. 1.

The amino acid sequence of the heavy chain CDR3 of the antibody 2G5 and 2G5 with excellent performance is preliminarily screened to have 4 amino acid mutations, and the sequence is as follows: RTGYHVISSWDFD, as shown in SEQ ID NO.2 (the amino acids in the remaining region are identical to those of the parent antibody). The nucleotide sequence (CGTACTGGTTATCATGTTATTTCTTCTTGGGATTTTGAT) encoding the heavy chain CDR3 amino acids is shown in SEQ ID NO. 3.

Expression purification

To further compare the biological functional differences of 2G5 and the parental antibody 3E1D7, lentiviral secretion expression vectors for the heavy and light chains of human murine 2G5, respectively, were constructed. Firstly, a heavy chain lentiviral expression vector of 2G5 is constructed, a DAN fragment is synthesized according to a heavy chain variable region sequence of an antibody 2G5 and a constant region sequence of human IgG1, the structure is shown in figure 1, and the synthesized DNA fragment is used as a template to design an upstream primer and a downstream primer for PCR (an upstream primer sequence is 5'-TCACAGGATCTAGTTCCGGA-3' as SEQ ID NO.4, a downstream primer sequence is 5'-TCACTATTTACCCGGAGACAGGG-3' as SEQ ID NO.5, a 50 microliter PCR system is as follows, the template is 1 muL, each of the upstream primer and the downstream primer is 1 muL, a high fidelity enzyme is 1 muL, a 2 x reaction buffer is 25 muL, and water is 22 muL. under PCR machine conditions of 98 ℃, 3min, denaturation at 98 ℃ for 15s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles, and extension at 72 ℃ for 10 min). And connecting the PCR product to a lentivirus expression vector pCMV to form pCMV-2G5-H (the pCMV is purchased from Invitrogen company, the connection and transformation processes are carried out according to the instructions, when in use, only a proper amount of the vector and the corresponding PCR product are mixed, and the connection step is finished after standing for 5 minutes, and the subsequent transformation can be carried out). Since the Light chain (Light chain, L) sequence of 2G5 was identical to the Light chain of the parent antibody 3E1D7 without any changes, pCMV-ch3E1D7-L constructed in this laboratory could be used instead for subsequent transfections. The human embryonic kidney cell 293T-2G5 (preservation number: CCTCCNO: C2021157) is obtained by co-transfecting a HEK293T cell (inoculating a HEK293T cell in a logarithmic growth phase, and transfecting the two plasmids according to a ratio of 1:1 by a calcium phosphate method when the cell grows to 50% -60% confluence) with pCMV-2G5-H (see figure 1) and p CMV-ch3E1D7-L, and the secretory 2G5 antibody can be obtained by purifying through ProteinA (see figure 2). The parent antibody 3E1D7 protein is preserved in the laboratory (the parent antibody 3E1D7 refers to Zhang Longzhen, Guo Jia, Guo Hua, etc.. the construction of the recombinant anti-c-Met chimeric antibody and the rapid expression thereof by using lentivirus [ J ]. Proc. Natl. Federation of industry, 2017,40(6): 835-839).

A band of about 150KDa can be seen from the result of SDS-PAGE non-denaturing electrophoresis, which indicates that the disulfide bond in the non-denaturing electrophoresis antibody is not broken and is in a dimer form. Two bands can be seen by SDS-PAGE denaturing electrophoresis, the molecular weights are respectively 50kDa and 25kDa, and respectively correspond to the antibody heavy chain and the antibody light chain after the disulfide bond is broken. The results are consistent with expected effects, and electrophoresis results have no obvious impurity band, which indicates that the antibody purification effect is good.

Example 2

Detection of binding Activity of secreted mutant antibody 2G5

The parent antibody 3E1D7 and the secretory 2G5 were compared for affinity in vitro for the antigen using an enzyme-linked immunosorbent assay (ELISA).

Coating solution (CBS) (0.05M Carbonate-Bicarbonate, pH 9.6) diluted antigen (c-MET extracellular region) to 2. mu.g/ml, 100. mu.l/well, incubated overnight at 4 ℃. The next day, the antigen-coated microplate wash (PBS + 0.05% Tween 20) was washed twice, followed by addition of 200. mu.l/well blocking solution (PBS + 1% BSA) and incubation at 37 ℃ for 2 hours. Washing with the washing solution for three times, adding the c-MET antibody to be detected into a 96-well enzyme label plate, and incubating for 2 hours at room temperature. Washing with washing solution for three times, adding enzyme-labeled secondary antibody (Goat anti-Mouse IgG (H + L) (HRP)100 μ L/well to 96-well enzyme-labeled plate, incubating at room temperature for 1 hr, washing with washing solution for three times, allowing TMB developing solution to act for 10min, adding stop solution (2M H) ₂ SO ₄ ) The plate was read using a microplate reader (Bio-Rad, iMark) at a wavelength of 450 nm.

The results are shown in FIG. 3, the mutant antibody 2G5 can be specifically bound with the c-MET extracellular domain fusion protein, the signal is enhanced along with the increase of the concentration of 2G5, under the system condition, the IC50 of the mutant antibody 2G5 and the parent antibody 3E1D7 are 41.53ng/ml and 39.32ng/ml respectively, and the fact that the mutant antibody 2G5 is strong in binding capacity with the c-MET extracellular domain fusion protein and basically consistent with the parent antibody is proved.

Example 3

Detection of neutralizing activity of secretory mutant antibody 2G5

The neutralizing activity of the parent antibody 3E1D7 and the secretory 2G5 was tested using a competitive ELISA binding assay with the c-MET natural ligand HGF.

The blocking ELISA was coated and blocked as in indirect ELISA (example 2), and the blocked ELISA plate was washed three times with a washing solution, and then incubated at room temperature for 1.5 hours with the addition of the c-MET antibody to be detected to the 96-well ELISA plate. The wash solution was washed three times, HGF was added to a final concentration of 15ng/ml at 100. mu.l/well, and incubated at 37 ℃ for 2 hours. The washing solution was washed three times, 100. mu.l/well of HGF antibody was added, and the mixture was incubated at room temperature for 1 hour. Washing liquid is washed for three times, streptavidin-HRP enzyme-labeled secondary antibody 100 mu l/hole is added, and incubation is carried out for 0.5 hour at room temperature. The washing solution was washed three times. After the TMB color development liquid acts for 10min, stop solution (2M H) is added ₂ SO ₄ ) The plate was read using a microplate reader (Bio-Rad, iMark) at a wavelength of 450 nm.

The results of competitive binding of HGF to mutant antibody 2G5 are shown in fig. 4, which shows that mutant antibody 2G5 can effectively inhibit binding of HGF to c-MET antigen, indicating that mutant antibody 2G5 has a blocking effect on c-MET/HGF binding.

Example 4

Internalizing effect of secreted mutant antibody 2G5

The internalization effect of 2G5 was detected by flow cytometry, and the antibodies were coupled with fluorescent signals according to the pHAbamine Reactive Dye kit from Promega. After digestion of human non-small cell lung cancer cells (a549) in logarithmic growth phase, plating was counted. The c-MET antibody coupled with a fluorescent signal is added into an A549 cell culture plate the next day, cells are digested after being incubated for 24h, the cells are washed for 2 times by using precooled D-PBS and 5% FBS and are stored on ice, and the mutant antibody 2G5 and the parent antibody 3E1D7 can obviously induce the internalization effect of the A549 cells. The FACS results are shown in fig. 5, and show that over 95% of the antibody molecules internalize into the cells after 24h of antibody incubation.

Example 5

Secreted mutant antibody 2G5 affects the c-MET signaling pathway in human non-small cell lung cancer cells (A549).

After the agonist antibody is combined with the c-MET, the agonist antibody can cause dimerization and tyrosine phosphorylation of the c-MET, and further activate a downstream signal path of the c-MET, so that the proliferation of vascular endothelial cells is promoted, and the migration of tumor cells is promoted. To verify the agonistic activity of the mutant antibody 2G5, human non-small cell lung cancer cell (a549) c-Met signaling pathway experiments were performed on the mutant antibody 2G5 and the parent antibody 3E1D 7.

Human non-small cell lung cancer cells (A549) in logarithmic growth phase were digested, counted, and ranked as 3X10 ⁵ Density of wells plated 35mm cell culture dishes. The high-glucose DMEM basic culture medium is replaced the next day, and starvation is carried out for 24 hours. Adding different c-MET antibodies with the concentration of 1 mu g/ml, stimulating different time points, adding RIPA lysate, performing ice lysis for 10 minutes, adding a loading buffer solution, performing WB detection, and respectively detecting the content of total c-MET protein, phosphorylated c-MET protein and beta-actin protein.

The results are shown in fig. 6, and show that the parent antibody 3E1D7 shows significant c-MET agonistic activity, significantly activates the c-MET signaling pathway of a549 cells at a concentration of 1 μ G/ml, the activation effect is more significant as the stimulation time is prolonged, and the mutant antibody 2G5 does not show agonistic activity for activating the c-MET signaling pathway.

Example 6

Detection of agonist Activity of secreted mutant antibody 2G5

Effect of 2G5 on proliferation of Human Umbilical Vein Endothelial Cells (HUVEC).

To further verify the agonistic activity of the mutant antibody 2G5, Human Umbilical Vein Endothelial Cell (HUVEC) proliferation assay experiments were performed on the mutant antibody 2G5 and the parental antibody 3E1D 7.

Human Umbilical Vein Endothelial Cell (HUVEC)1x10 ⁵ Cells/ml, 50. mu.l/well were added to 96-well cell culture plates in HUVEC basal medium + 1% fetal bovine serum. After 24h of cell culture, 50 mul/well of anti-human c-MET antibody to be tested is added, and the cells are cultured in a cell culture box at 37 ℃ for 3 days. And (3) detecting the cell proliferation condition by using a cell proliferation detection kit according to a kit instruction method. Plates were read at 450nm using a microplate reader (Bio-Rad, iMark).

The results are shown in fig. 7, the parent antibody 3E1D7 showed significant c-MET agonistic activity, significantly promoting HUVEC cell proliferation at a concentration of 200ng/ml, which effect was more significant with increasing antibody concentration, while the mutant antibody 2G5 did not show the effect of promoting HUVEC cell proliferation.

Example 7

Effect of 2G5 on migration of human non-Small cell Lung cancer cells (A549)

To further verify the agonistic activity of the mutant antibody 2G5, a human non-small cell lung cancer cell (a549) migration assay was performed on the mutant antibody 2G5 and the parent antibody 3E1D 7.

Human non-small cell lung carcinoma cell (A549) 2X 10 ⁵ Each cell/ml, 500. mu.l/well, was added to the upper chamber of the transwell chamber, and 750. mu.l of medium containing different concentrations of the antibody to be tested was added to the lower chamber, the medium being high-glucose DMEM basal medium. After 16h of cell culture, crystal violet staining was performed and the cells were counted under the lens under the chamber.

The results are shown in figure 8, the parent antibody 3E1D7 shows remarkable c-MET agonistic activity, under the condition of 500ng/ml concentration, the migration effect of A549 cells is remarkably promoted, while the mutant antibody 2G5 does not show the migration promoting activity, and the 2G5 is proved to be in line with the expectation, on the basis of retaining the binding activity and the internalization characteristic, the c-MET agonistic activity of the mutant antibody is remarkably reduced, and a more suitable alternative molecule is provided for drug development.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Suzhou institute of Tongji university

<120> improved c-Met neutralizing antibody, and preparation method and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 13

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Arg Ser Gly Tyr His Gly Thr Ser Tyr Trp Tyr Phe Asp

1 5 10

<210> 2

<211> 13

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Arg Thr Gly Tyr His Val Ile Ser Ser Trp Asp Phe Asp

1 5 10

<210> 3

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgtactggtt atcatgttat ttcttcttgg gattttgat 39

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcacaggatc tagttccgga 20

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcactattta cccggagaca ggg 23

Claims

1. An improved c-Met neutralizing antibody, characterized in that the amino acid sequence of the heavy chain CDR3 is replaced by the sequence shown in SEQ ID No.2, based on the amino acid sequence of antibody 3E1D 7.

2. The gene for improving the neutralizing antibody against c-Met as set forth in claim 1, wherein the nucleotide sequence coding for the amino acid CDR3 of the heavy chain is represented by SEQ ID No. 3.

3. A recombinant vector comprising the gene of claim 2.

4. A recombinant cell capable of secreting the antibody of claim 1 or 2 or comprising the recombinant vector of claim 3.

5. The recombinant cell of claim 4 having a accession number of CCTCC NO: C2021157.

6. The use of a modified c-Met neutralizing antibody as claimed in claim 1 in the preparation of an anti-tumor medicament.

7. The use of claim 6, wherein the tumor is non-small cell lung cancer.