CN115060912B

CN115060912B - Reagent combination, kit, detection system and detection method for detecting target antibody

Info

Publication number: CN115060912B
Application number: CN202210718338.5A
Authority: CN
Inventors: 曹丹; 成舜
Original assignee: Nanjing Puguang Biotechnology Co ltd
Current assignee: Nanjing Puguang Biotechnology Co ltd
Priority date: 2022-06-23
Filing date: 2022-06-23
Publication date: 2024-02-02
Anticipated expiration: 2042-06-23
Also published as: WO2023246124A1; CN115060912A

Abstract

The application provides a reagent combination, a kit, a detection system and a detection method for detecting a target antibody. In the application, when the solution to be detected contains the target antibody, an antibody-antigen complex is formed by adopting the first protein antigen, the second protein antigen and the target antibody, a neck ring structure is generated through complementary pairing of the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA, so that the donor fluorescent group is enabled to excite the acceptor fluorescent group to emit fluorescence based on fluorescence resonance energy transfer, and the content of the target antibody is calculated according to the fluorescence intensity. The detection method is simple, low in background interference, high in sensitivity and small in measurement error.

Description

Reagent combination, kit, detection system and detection method for detecting target antibody

Technical Field

The application belongs to the technical field of chemiluminescence detection, and particularly relates to a reagent combination, a reagent kit, a detection system and a detection method for detecting a target antibody.

Background

The health condition of a person has a certain relationship with blood components. If a person is in a pathological condition or is infected, specific antibody molecules are secreted into the blood, so that it can be judged whether the components of the blood are in a normal state by recognizing whether the specific antibody molecules are present in the blood. The detection of the presence or absence of antibodies of interest in blood can be detected using chemiluminescent immunoassay (Chemiluminescence immunoassay, CLIA). The method links the luminous group with the specific antigen of the target antibody to prepare the detection reagent. When the target antibody is not present in the blood sample, the specific antigen cannot be specifically bound with the target antibody in the blood, and at this time, the luminescent group generally has no luminescent activity and does not generate stronger fluorescence intensity. When the target antibody exists in the solution to be detected, the target antibody can specifically bind with the antigen in the detection reagent to form an antigen-antibody complex, and at the moment, the luminous group emits stronger fluorescence under the action of the luminous substrate. Chemiluminescent detection instrumentation may be used to obtain fluorescence intensity. The value of the fluorescence intensity has a correspondence with the content of the target antibody in the blood, and therefore, the concentration of the target antibody in the blood can be calculated from the value of the fluorescence intensity.

However, the above method employs a single fluorescent group to emit fluorescence, and calculates the content of the target antibody based on the fluorescence intensity of the single fluorescent group. Since a single fluorescent group emits background fluorescence in the absence of the target antibody, even if a control reagent is present, the background fluorescence will also affect the true value of the fluorescence intensity, thereby causing a large error in the measurement of the content of the target antibody.

Disclosure of Invention

The invention provides a reagent combination, a reagent kit, a detection system and a detection method for detecting a target antibody, which can solve the technical problem that background fluorescence emitted by a single fluorescent group of the existing chemiluminescence detection method interferes with the real content of the target antibody. Some embodiments mentioned herein may be from the same embodiment or from different embodiments.

In order to solve the above technical problems, some embodiments of the present application provide a reagent combination for detecting an antibody of interest. The reagent combination at least comprises: a first reagent, a second reagent, a third reagent, and a fourth reagent.

Wherein the first reagent is formed by coupling a first single-stranded DNA and a first protein antigen. The first single-stranded DNA comprises a first DNA sequence and a second DNA sequence. The first DNA sequence and the second DNA sequence are not directly adjacent, but are separated by 2 or 5 nucleotides. The target antibody is capable of specifically binding to a first epitope of a first protein antigen. In this application, when describing single-stranded DNA, the manner of ligation is from 5 'to 3' from left to right.

The second reagent is formed by coupling a second protein antigen, a second single-stranded DNA and a receptor fluorescent group in sequence. The second single-stranded DNA has a third DNA sequence and a fourth DNA sequence. The third DNA sequence is directly linked to the fourth DNA sequence without intervening nucleotides. The third DNA sequence is complementary to the second DNA sequence. The target antibody is capable of specifically binding to a second epitope of a second protein antigen. The first protein antigen (also called first scaffold protein) and the second protein antigen (also called second scaffold protein) are the same protein, and each protein antigen molecule can be specifically identified and combined by only one antigen epitope through complementarity determining regions (Complementarity determining region, CDRs) of the target antibody. The first epitope and the second epitope are the same epitope, so that the first protein antigen and the second protein antigen can be combined by the target antibody at the same time, and a stable antibody-antigen complex can be formed at the moment.

The third reagent is formed by coupling a donor fluorophore and a third single-stranded DNA. The third single-stranded DNA contains a fifth DNA sequence and a sixth DNA sequence. The fifth DNA sequence and the sixth DNA sequence are directly linked without intervening nucleotides. The fifth DNA sequence is complementary to the fourth DNA sequence and the sixth DNA sequence is complementary to the first DNA sequence. By the complementary pairing between the above single-stranded DNA molecules, the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA can be assembled into a neck ring structure (Stem-loop structure). The neck part is in an inverted T shape, and the mutually matched areas are in a double-helix structure. The donor fluorescent group emits first fluorescence in the absence of an antioxidant, which excites the acceptor fluorescent group to emit second fluorescence based on a fluorescence resonance energy transfer effect under the condition that the first single-stranded DNA, the second single-stranded DNA, and the third single-stranded DNA are paired with each other as excitation light, so that the content of the target antibody is obtained according to the intensity of the second fluorescence. If the intensity of the second fluorescence is not obtained, the content of the target antibody is 0, indicating that the target antibody is not present at this time. A functional relation between the intensity of the second fluorescence and the content of the target antibody may be obtained in advance, so that a one-to-one numerical relation is established therebetween, and thus, the measurement of the content of the target antibody may be converted into the measurement of the value of the fluorescence intensity.

The fourth agent includes an antioxidant. The antioxidant is capable of inhibiting oxidation of the donor fluorophore to emit a first fluorescence. The donor fluorophore in each embodiment of the present application emits light by oxidation, and does not emit fluorescence by irradiation with excitation light, and therefore, it is necessary to prevent the donor fluorophore from being oxidized by an oxidizing substance in the solution to be measured to generate background fluorescence before the first reagent, the second reagent, and the third reagent form a stable structure. Background fluorescence belongs to one of noise, and can influence the true value of fluorescence measurement, thereby influencing the accuracy of the measurement result of the content of the target antibody. The antioxidant and the oxidizing agent cannot be simultaneously present in the sample to be tested, so as to prevent the oxidative luminescence of the oxidizing agent on the donor fluorescent group from being neutralized by the antioxidant. Therefore, it is necessary to remove the antioxidant before adding the oxidant.

In some embodiments of the present application, a fluorescence resonance energy transfer effect occurs between the donor fluorophore and the acceptor fluorophore. The first single-stranded DNA, the second single-stranded DNA, and the third single-stranded DNA are complementarily paired in the presence of the target antibody to form a neck ring structure such that the distance between the donor fluorescent group and the acceptor fluorescent group is smaller than the limit distance at which fluorescence resonance energy transfer can occur, for example, in the range of 70 to 99 angstroms, or in the range of 7nm to 10 nm.

In some embodiments of the present application, the donor fluorophore may be an acridinium ester and the acceptor fluorophore may be a quantum dot.

In some embodiments of the present application, the maximum emission wavelength of the donor fluorophore is 430nm.

The maximum absorption wavelength of the acceptor fluorophore may be in the range of 420nm to 520nm, such as 470nm. The maximum emission wavelength of the acceptor fluorophore may be in the range of 595nm to 615nm, such as may be 605nm. In some embodiments of the present application, the quantum dot is a core-shell quantum dot, the core layer material of which is selected from one or more of CdSe, cdS, cdTe, cdSeTe, cdZnS, znTe, cdSeS, pbS and PbTe, and the shell layer material of which is selected from one or more of ZnS, znSe, znSeS, pbS and PbSeS.

In some embodiments of the present application, the quantum dots may have particle sizes ranging from 3nm to 5nm, and may also have particle sizes ranging from 4.1nm to 4.2nm.

In some embodiments of the present application, the sugar ring at the 3' end of the first single-stranded DNA is covalently linked to the amino group of the first protein antigen through a first coupling agent. The sugar ring at the 5' -end of the first single-stranded DNA is not modified. Alternatively, the sugar ring at the 3' end of the first single-stranded DNA is modified with an NH2C7 modification group, the NH2C7 modification group being covalently linked to the amino group of the first protein antigen via a first coupling agent. Alternatively, the first coupling agent is a bis-succinimidyl suberate sodium salt.

In some embodiments of the present application, the 3' end of the second single stranded DNA is linked to an acceptor fluorophore. Optionally, the sugar ring at the 3' -end of the second single-stranded DNA is modified with a thiol group, the surface of the acceptor fluorophore is modified with an amino group, and the thiol group is covalently linked with the amino group on the surface of the acceptor fluorophore via a third coupling agent. Alternatively, the third coupling agent is 4- (N-maleimidomethyl) cyclohexane-1-carboxylic acid succinimidyl ester.

In some embodiments of the present application, the sugar ring at the 5' end of the second single stranded DNA is covalently linked to the amino group of the second protein antigen through a second coupling agent. Optionally, the sugar ring at the 5' end of the second single-stranded DNA is modified with an NH2C6 modifying group, the NH2C6 modifying group being covalently linked to the amino group of the second protein antigen via a second coupling agent. Alternatively, the second coupling agent is a sodium salt of disuccinimidyl suberate.

In some embodiments of the present application, the 5' end of the third single stranded DNA is covalently linked to the donor fluorophore. Optionally, the sugar ring at the 5' end of the third single stranded DNA is modified with an NH2C6 modifying group, the NH2C6 modifying group being covalently linked to the donor fluorophore.

In some embodiments of the present application, the first DNA sequence is located upstream of the second DNA sequence in the order from the 5 'end to the 3' end in the first single stranded DNA. In the second single-stranded DNA, the third DNA sequence is located upstream of the fourth DNA sequence in the order from the 5 'end to the 3' end. In the third single-stranded DNA, the fifth DNA sequence is located upstream of the sixth DNA sequence in the order from the 5 'end to the 3' end.

In some embodiments of the present application, the first single-stranded DNA has 55 nucleotides, the first DNA sequence covers the 3 rd to 10 th base site of the first single-stranded DNA from the 5 'end, and the second DNA sequence covers the 13 th to 19 th base site of the first single-stranded DNA from the 5' end. The second single-stranded DNA has 53 nucleotides, the third DNA sequence covers 37 to 43 base sites of the second single-stranded DNA from the 5 'end, and the fourth DNA sequence covers 44 to 51 base sites of the second single-stranded DNA from the 5' end. The third single-stranded DNA has 22 nucleotides, the fifth DNA sequence covers the 3 rd to 10 th base sites of the third single-stranded DNA from the 5 'end, and the sixth DNA sequence covers the 11 th to 18 th base sites of the third single-stranded DNA from the 5' end. The complementary pairing of the six DNA sequences enables the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA to be hybridized in pairs to form a neck ring structure, and the shape of the neck is inverted T-shaped.

In some embodiments of the present application, the first DNA sequence is GCTGAGTT from 5 'end to 3' end and the sixth DNA sequence is AACTCAGC from 5 'end to 3' end. The second DNA sequence is CAACGAC from 5 'end to 3' end, and the third DNA sequence is GTCGTTG from 5 'end to 3' end. The fourth DNA sequence is GCTGAGAT from the 5 'end to the 3' end, and the fifth DNA sequence is ATCTCAGC from the 5 'end to the 3' end. The two DNA sequences within the same single-stranded DNA are not paired with each other, but with the DNA sequence of the other single-stranded DNA.

In some embodiments of the present application, the full length sequence of first single strand DNA (A first single stranded DNA) is set forth in SEQ ID No:1, the full length sequence of the second single strand DNA (A second single stranded DNA) is set forth in SEQ ID No:2, the full length sequence of the third single strand DNA (A third single stranded DNA) is shown in SEQ ID No: 3.

In some embodiments of the present application, G in the first single-stranded DNA, the second single-stranded DNA, and/or the third single-stranded DNA may be _iso G is substituted, C can be _iso C is replaced. _iso G and _iso c is a non-natural base pair to replace the natural bases G and C, respectively. The non-natural base pairs are adopted for pairing, so that the first single-stranded DNA, the second single-stranded DNA and/or the third single-stranded DNA can be effectively prevented from being mismatched with natural nucleic acid in a solution to be detected, the situation that the mismatch influences the formation of a neck ring structure is avoided, and further measurement errors caused by the mismatch are avoided.

Wherein, _iso the structural formula of G is:

_iso the structural formula of C is:

_iso g and G _iso The bonding mode of C is as follows:

representing ribose.

In some embodiments of the present application, G in the first DNA sequence and the sixth DNA sequence is _iso G is substituted by C _iso C is replaced. The first DNA sequence is from 5 'end to 3' end _iso G _iso CT _iso GA _iso GTT, AA in the sixth DNA sequence from 5 'end to 3' end _iso CT _iso CA _iso G _iso C。

In some embodiments of the present application, G in the second DNA sequence and the third DNA sequence is _iso G is substituted by C _iso C is replaced. The second DNA sequence is from 5 'end to 3' end _iso CAA _iso C _iso GA _iso C, the third DNA sequence is from 5 'end to 3' end _iso GT _iso C _iso GTT _iso G。

In some embodiments of the present application, G in the fourth DNA sequence and the fifth DNA sequence is _iso G is substituted by C _iso C is replaced. The fourth DNA sequence is from 5 'end to 3' end _iso G _iso CT _iso GA _iso GAT, AT from 5 'to 3' of the fifth DNA sequence _iso CT _iso CA _iso G _iso C。

In some embodiments of the present application, G in the full-length sequence of the first single-stranded DNA is _iso G is substituted by C _iso C, then the full-length sequence is:

A _iso C _iso G _iso CT _iso GA _iso GTTAT _iso CAA _iso C _iso GA _iso CTTTTTTTAT _iso CA _iso CAT _iso CA _iso G _iso G _iso CT _iso CTA _iso G _iso C _iso GTAT _iso G _iso CTATT _iso G。

in some embodiments of the present application, G in the full-length sequence of the second single-stranded DNA is _iso G is substituted by C _iso C, then the full-length sequence is:

TA _iso C _iso GT _iso C _iso CA _iso GAA _iso CTTTA _iso C _iso CAAA _iso C _iso CA _iso CA _iso C _iso C _iso CTTTTTTT _iso GT _iso C _iso GTT _iso G _iso G _iso CT _iso GA _iso GATT _iso C。

in some embodiments of the present application, G in the full-length sequence of the third single-stranded DNA is _iso G is substituted by C _iso C, then the full-length sequence is:

_iso C _iso GAT _iso CT _iso CA _iso G _iso CAA _iso CT _iso CA _iso G _iso CA _iso G _iso C _iso G。

in some embodiments of the present application, the fourth agent further comprises a carrier molecule, the surface of which binds the antioxidant. Because the donor fluorophore emits light in an oxidative rather than an stimulated manner, the donor fluorophore may fluoresce in the presence of an oxidizing species. The function of the antioxidant is mainly to prevent oxidation of the donor fluorophore by these substances with oxidizing ability, thus generating background fluorescence that may affect the measurement results. These substances having oxidizing ability may be derived from a solution to be measured, a blood sample, or the like. The antioxidant is selected from one or more of cannabidiol, vitamin C, vitamin E, tea polyphenols, and glutathione. In some embodiments of the present application, the oxidizing agent comprises an alkaline solution of hydrogen peroxide. Oxidizing agents may also be referred to as chemiluminescent substrates for the donor fluorophore, as these substrates are inherently oxidizing and may be used as oxidizing agents.

In some embodiments of the present application, the carrier molecule may be graphene oxide. A part of carboxyl groups on the graphene oxide is combined with hydroxyl groups on the antioxidant through an oxidation sulfoxide condensing agent, and a part of carboxyl groups on the graphene oxide is combined with amino groups on the antioxidant through 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride, so that the antioxidant is attached to the graphene oxide. Because the antioxidant and the oxidizing agent cannot be added to the test solution at the same time, or else the oxidizing agent cannot oxidize the donor fluorophore to emit light, the antioxidant needs to be removed from the test solution prior to the addition of the oxidizing agent. The antioxidant is combined on the graphene oxide carrier, so that the antioxidant is removed more favorably.

In various embodiments of the present application, fluorescence resonance energy transfer between two fluorophores is employed to generate a second fluorescence for measurement, the donor fluorophore is an oxidative luminescence, the acceptor fluorophore is a photoexcitation luminescence, and the first fluorescence emitted by the donor fluorophore can excite the acceptor fluorophore to emit the second fluorescence based on fluorescence resonance energy transfer, and only the second fluorescence needs to be collected to obtain the content of the target antibody. The detection method eliminates the influence of the background fluorescence of the donor fluorescent group on the measurement result, and improves the sensitivity and accuracy of detection. In addition, the two fluorescent groups of each embodiment of the application can emit fluorescent signals without arranging an additional excitation light source, so that the complexity of a detection system is reduced, and movable detection can be realized. Furthermore, the donor fluorescent groups in the embodiments of the application emit light in a flash manner, so that the detection time is short, and the detection result can be obtained quickly.

Some embodiments of the present application also provide a method for detecting a target antibody, comprising the steps of:

(1) Providing a first reagent, a second reagent, a third reagent and a fourth reagent; and adding the first reagent, the second reagent, the third reagent and the fourth reagent into the solution to be tested, and mixing to form a sample to be tested.

In some embodiments, in step (1), the first reagent is coupled to a first protein antigen and the first single-stranded DNA comprises a first DNA sequence and a second DNA sequence, and the first antigen of the first protein antigen is capable of specifically binding to the antibody of interest. The second reagent is formed by coupling a second protein antigen, a second single-stranded DNA and a receptor fluorescent group in sequence, wherein the second single-stranded DNA has a third DNA sequence and a fourth DNA sequence, and the third DNA sequence is complementary with the second DNA sequence. The second antigen of the second protein antigen is capable of specifically binding to the antibody of interest. The third reagent is formed by coupling a donor fluorophore and a third single-stranded DNA. The third single-stranded DNA contains a fifth DNA sequence complementary to the fourth DNA sequence and a sixth DNA sequence complementary to the first DNA sequence. Under the condition that the solution to be detected contains the target antibody, the first protein antigen, the target antibody and the second protein antigen form an antibody antigen complex, the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA form a neck ring structure, and the donor fluorescent group and the acceptor fluorescent group are positioned on the same side of the neck ring structure, so that fluorescence resonance energy transfer can occur between the two fluorescent molecules, and therefore the acceptor fluorescent group is excited to emit second fluorescence.

(2) Removing a fourth reagent for inhibiting the oxidation of the donor fluorescent group to emit fluorescence from the sample to be measured, adding an oxidizing agent for oxidizing the donor fluorescent group to emit the first fluorescence and collecting the second fluorescence according to the maximum emission wavelength of the acceptor fluorescent group, i.e., excluding fluorescence of other wavelengths than the maximum emission wavelength.

(3) Under the condition that the second fluorescence is not collected, judging that the solution to be detected does not contain the target antibody; and under the condition that the intensity of the second fluorescence is collected, obtaining the content of the target antibody in the solution to be detected according to the intensity of the second fluorescence based on a functional relation between the fluorescence intensity and the antibody content. The functional relationship is a one-to-one correspondence of the fluorescence intensity values and the antibody content values.

When the intensity of the second fluorescence is collected, in order to avoid interference of the first fluorescence on the second fluorescence, a filter can be used to filter out fluorescence generated after the donor fluorescent group is oxidized, only the second fluorescence is allowed to permeate through the filter, so that the second fluorescence emitted by the acceptor fluorescent group is collected, and the content of the target antibody is obtained according to the intensity of the second fluorescence.

The test solution may be derived from a blood sample. The blood components are complex and contain various oxidizing substances, and if the donor fluorescent groups are oxidized by the oxidizing substances, background fluorescence is generated, so that the accuracy of the measurement result is affected, therefore, in order to reduce the influence of the background fluorescence on the measurement result, the application does not adopt the first fluorescence emitted by the donor fluorescent groups as a detection fluorescent signal, but adopts the second fluorescence emitted by the acceptor fluorescent groups as a detection fluorescent signal.

In some embodiments of the present application, the working concentration of the first reagent in the sample to be tested may be 1nM to 20nM. The working concentration of the second agent may be 1nM to 20nM. The working concentration of the third reagent may be 0.05nM to 0.2nM. The working concentration of the fourth reagent may be 15 μg/ml to 25 μg/ml.

In some embodiments of the present application, the test solution is derived from a blood sample such as a whole blood sample, a serum sample, or a plasma sample.

In some embodiments of the present application, the time of mixing may be from 5 minutes to 10 minutes.

In some embodiments of the present application, the temperature of the mixing may be 36 degrees to 37 degrees.

In some embodiments of the present application, the volume of the oxidizing agent may be 200 μl, the oxidizing agent is an alkaline hydrogen peroxide solution, and the pH is 8.0. The alkaline hydrogen peroxide solution was prepared by dissolving hydrogen peroxide in TBS buffer, wherein the final concentration of hydrogen peroxide was 0.1M and the final concentration of TBS was 10mM.

In some embodiments of the present application, the antibody of interest comprises a hepatitis b surface antibody, a hepatitis c surface antibody, or a cytomegalovirus IgG.

In some embodiments of the present application, in the mixed sample to be tested, two protein antigens in the first reagent and the second reagent and the target antibody in the sample to be tested form an antibody-antigen complex, and the antibody-antigen complex pulls in the distance between the complementary sequences of the three single-stranded DNA, pairwise complementary pairs and realizes assembly between the DNA, thereby forming a neck ring structure.

Some embodiments of the present application also provide a target antibody detection kit comprising: first test tube, second test tube, third test tube, fourth test tube and fifth test tube.

Wherein the first tube stores a conjugate of the first single-stranded DNA and the first protein antigen.

The second tube stores a conjugate of a second protein antigen, a second single-stranded DNA, and an acceptor fluorophore. The first protein antigen and the second protein antigen are capable of forming an antibody-antigen complex with the antibody of interest in the presence of the antibody of interest. In contrast, if the target antibody is not present, an immune reaction between the two protein antigens and the target antibody does not occur, nor does an antibody antigen complex form, so that assembly between single-stranded DNA is not initiated.

A third tube stores a conjugate of the donor fluorophore and a third single stranded DNA. The first single-stranded DNA, the second single-stranded DNA, and the third single-stranded DNA are assembled into a collar structure based on proximity effects under conditions of formation of an antibody antigen complex, the spatial conformation of the collar structure is such that the donor fluorescent group and the acceptor fluorescent group spontaneously align on the same side of the collar structure, and the spatial distance between the two is less than a limiting distance at which fluorescence resonance energy transfer can occur, for example, in the range of 70 angstroms to 99 angstroms, which provides conditions for fluorescence resonance energy transfer between the two fluorescent groups.

The fourth tube stores an antioxidant capable of inhibiting oxidation of the donor fluorophore. Alternatively, the antioxidant may be modified on the carrier molecule. Alternatively, the carrier molecule may be selected from graphene oxide.

The fifth tube stores the oxidizing agent. The oxidizing agent is capable of oxidizing the donor fluorophore to emit a first fluorescence. The oxidizing agent and the antioxidant are not present in the sample to be tested at the same time. The antioxidants and carrier molecules need to be removed from the sample to be tested before the oxidizing agent is added. Because the antioxidant is modified on the carrier molecules, and the graphene oxide of the carrier molecules has a lamellar network structure, the antioxidant is very easy to remove from a sample to be detected, and the removal of the antioxidant can be realized by removing the carrier molecules. In addition, graphene oxide can also adsorb free third single-stranded DNA, thereby adsorbing a conjugate of a donor fluorophore and the third single-stranded DNA, so that the antioxidant inhibits the donor fluorophore in a free state from being improperly oxidized, thereby inhibiting the donor fluorophore from improperly emitting background fluorescence.

In the examples of the present application, the detection principle of the target antibody detection kit is as follows:

under the condition that the solution to be detected contains the target antibody, the first protein antigen and the second protein antigen can form an antibody-antigen complex with the target antibody. The first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA are closely spaced, hybridized and self-assembled into a neck ring structure. Six DNA sequences in the three single-stranded DNA are complementarily paired in pairs to form a neck part of the neck ring structure, and the rest of the non-DNA sequences form a ring part of the neck ring structure. The two DNA sequences within each single stranded DNA cannot be complementarily paired, but only with the complementary sequences of the other single stranded DNA. The spatial conformation of the neck ring structure is such that the donor fluorophore and the acceptor fluorophore are on the same side of the neck ring structure and are spaced apart by a distance that ensures fluorescence resonance energy transfer between the two. Under the condition that the fourth reagent is removed, the oxidant can oxidize the donor fluorescent group and enable the donor fluorescent group to emit first fluorescence, and the first fluorescence excites the acceptor fluorescent group to emit second fluorescence based on the fluorescence resonance energy transfer effect, so that the content of the target antibody is obtained according to the intensity of the second fluorescence.

In the absence of the target antibody in the solution to be tested, the antibody-antigen complex and neck ring structure cannot be formed, and even if the antioxidant is removed and then the oxidant is added to cause the donor fluorophore to emit the first fluorescence, the donor fluorophore is separated from the acceptor fluorophore by a distance greater than the limit distance at which fluorescence resonance energy transfer can occur, and the donor fluorophore cannot excite the acceptor fluorophore to emit the second fluorescence. The failure to obtain the intensity of the second fluorescence indicates that the content of the target antibody in the solution to be measured is zero, and further indicates that the solution to be measured does not contain the target antibody.

In the embodiment of the application, the acceptor fluorescent group can emit the second fluorescence under the excitation action of the excitation light, and if the excitation action of the first fluorescence is not performed, the acceptor fluorescent group does not emit the second fluorescence for measuring the content of the target antibody, so that the acceptor fluorescent group is used as the detection group and does not emit the background fluorescence basically, and the reliability of using the second fluorescence as the detection fluorescence is ensured.

Some embodiments of the present application provide a target antibody detection system comprising: the device comprises a reaction container, a microinjection pump, an optical filter, an optical signal detection module and a calculation module.

Wherein, the reaction vessel is provided with a containing chamber which can contain the solution to be tested.

The micro-injection pump is communicated with the accommodating chamber through an injection pipeline, and the mixture of the first reagent, the second reagent, the third reagent and the fourth reagent is injected into the accommodating chamber through the injection pipeline so as to be mixed with the solution to be tested. The first reagent is formed by coupling a first single-stranded DNA and a first protein antigen, the second reagent is formed by coupling a second protein antigen, a second single-stranded DNA and an acceptor fluorescent group in sequence, the third reagent is formed by coupling a donor fluorescent group and a third single-stranded DNA, and the fourth reagent contains an antioxidant for inhibiting the donor fluorescent group from being oxidized to emit first fluorescence.

The optical filter is arranged on the emergent light path of the first fluorescence and allows the second fluorescence with the same wavelength as the maximum emission wavelength of the acceptor fluorescent group to pass through.

The optical signal detection module is arranged on an emergent light path of the first fluorescence and positioned at the downstream side of the optical filter, and acquires the second fluorescence transmitted from the optical filter. The intensity value of the second fluorescence may be 0, which indicates that no target antibody exists in the solution to be measured, because the acceptor fluorescent group is excited light, not oxidized light, and the acceptor fluorescent group itself does not emit the second fluorescence under the condition that no excited light is excited, so that no background fluorescence noise is generated, so that the intensity of the second fluorescence can reach zero under the condition that no target antibody exists, and if the first fluorescence is adopted as the detection fluorescence, the first fluorescence is oxidized light due to the presence of the oxidizing substances in the solution to be measured, and the first fluorescence is oxidized by the oxidizing substances to emit the background fluorescence noise, so that the intensity of the first fluorescence under the condition that no target antibody exists is generally not 0. Therefore, the second fluorescence is adopted as the detection fluorescence more accurately than the first fluorescence, and the error is smaller.

And the calculation module is used for converting the second fluorescence into a digital signal and obtaining the content of the target antibody in the solution to be detected according to a functional relation between the fluorescence intensity and the antibody content.

Due to the adoption of the technical scheme, the following technical effects can be achieved by some embodiments of the application:

some embodiments of the present application use a combination of an immune response and a fluorescence resonance energy transfer effect to detect whether a test solution contains a target antibody. The method comprises the following steps:

under the condition that the solution to be detected contains the target antibody, the first protein antigen, the target antibody and the second protein antigen form an antibody antigen complex based on immune reaction, so that the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA are pulled in at intervals, DNA assembly is initiated, a neck ring structure is formed, the donor fluorescent group and the acceptor fluorescent group are positioned on the same side of the neck ring structure, and therefore a fluorescence resonance energy transfer phenomenon is generated between the donor fluorescent group and the acceptor fluorescent group, and the acceptor fluorescent group emits second fluorescence as a fluorescent signal to be detected. And obtaining the content of the target antibody in the solution to be detected according to a preset functional relation between the fluorescence intensity and the antibody content and the intensity of the fluorescence signal to be detected.

Under the condition that the target antibody does not exist in the solution to be detected, an antibody antigen complex and a neck ring structure cannot be formed, and the acceptor fluorescent group cannot be excited by excitation light (namely first fluorescence) to emit second fluorescence, so that a fluorescent signal to be detected cannot be captured, and the fact that the target antibody does not exist in the solution to be detected is indicated. In addition, even if the donor fluorophore emits background fluorescence under the action of some oxidizing substances, because the neck ring structure cannot be formed, the spatial distance between the donor fluorophore and the acceptor fluorophore is larger than the minimum distance required by the fluorescence resonance energy transfer effect, the fluorescence resonance energy transfer effect between the two fluorophores does not occur, and the acceptor fluorophore does not emit second fluorescence based on the background fluorescence. Therefore, the qualitative detection of whether the target antibody exists in the solution to be detected and the quantitative detection of the content of the target antibody in the solution to be detected are realized.

According to the embodiment of the application, the second fluorescence emitted by the acceptor fluorescent group which is not easy to generate background fluorescence noise is used as a fluorescence signal to be detected, the first fluorescence emitted by the donor fluorescent group which is usually provided with the background fluorescence noise is not used as the fluorescence signal to be detected, the influence of the background fluorescence noise on a detection result can be greatly reduced, the detection sensitivity is improved, the detection error is reduced, and the detected protein content is closer to a true value.

Drawings

Fig. 1 is a schematic illustration of an antibody-antigen complex and neck ring structure according to some embodiments of the present application.

Fig. 2 is a schematic diagram of a detection method of some embodiments of the present application. In fig. 2, when an antibody of interest (Target shown in fig. 2) is present, two identical antigens and the antibody of interest form an antibody-antigen complex, and a neck ring structure is formed between single-stranded DNA molecules. After the oxidized graphene modified with the antioxidant is eluted, an oxidant (alkali solution of hydrogen peroxide) is added, and the acridinium ester is oxidized by the oxidant to emit first fluorescence of 430nm, and the first fluorescence excites the quantum dot to emit second fluorescence of 605nm, which is called a Signal on state. When the Target antibody is not present (No Target shown in fig. 2), no antibody-antigen complex and neck ring structure are generated, the third single-stranded DNA is adsorbed on the surface of graphene oxide by pi-pi stacking, and when graphene oxide modified with an antioxidant is eluted, the conjugate of the third single-stranded DNA and the third single-stranded DNA remains in the eluted liquid together with graphene oxide, the acridine ester is oxidized by the oxidizing substance in the liquid to generate background fluorescence, and the conjugate of the second protein antigen, the second single-stranded DNA and the quantum dot is present in the liquid remaining after elution. The quantum dot does not generate fluorescence due to no excitation of excitation light, and is called a Signal off state at this time, which indicates that the liquid does not have the target antibody.

Reference numerals: the antibody 1, the first protein antigen 2, the second protein antigen 3, the first single-stranded DNA 4, the second single-stranded DNA 5, the third single-stranded DNA6, the donor fluorophore 7, the acceptor fluorophore 8, the first DNA sequence 9, the second DNA sequence 10, the third DNA sequence 11, the fourth DNA sequence 12, the fifth DNA sequence 13, the sixth DNA sequence 14, the complex of graphene oxide and antioxidant 15 (i.e., the fourth reagent).

Detailed Description

The technology of the various embodiments of the present application is described in detail below in conjunction with the detailed description. It should be understood that the following detailed description is merely intended to aid those skilled in the art in understanding the present application and is not intended to limit the present application. In addition, the following detailed description can be arbitrarily combined to form new embodiments without inventive effort.

[ reagent combination for detecting target antibody ]

Some embodiments of the present application provide a reagent combination. The reagent combination is used for detecting whether the target antibody exists in the solution to be detected, so that the qualitative detection of the target antibody is realized. In addition, the reagent combination can also obtain the concentration of the target antibody in the solution to be detected on the premise that the target antibody exists in the solution to be detected, thereby realizing quantitative detection of the content of the target antibody.

In some embodiments of the present application, the test solution may be from a blood sample or other non-blood sample. Wherein the blood sample may be from a whole blood sample, a serum sample or a plasma sample.

In some embodiments of the present application, the kind of the target antibody to be detected is not particularly limited. Illustratively, the target antibody may be a hepatitis B surface antibody, a hepatitis C surface antibody, or a cytomegalovirus IgG, or the like. In some embodiments of the present application, the molecular weight of the target antibody to be detected may be in the range of 50 to 1000KD, or may be in the range of 100KD to 500 KD.

In some embodiments of the present application, the reagent combination comprises: a first reagent, a second reagent, a third reagent, and a fourth reagent.

Wherein the first reagent is formed by coupling a first single-stranded DNA and a first protein antigen. The sugar ring at the 3' -end of the first single-stranded DNA is modified by an NH2C7 modification group, and the NH2C7 modification group is covalently linked with the amino group of the first protein antigen through a first coupling agent. The NH2C7 modification group modifies the sugar ring at the 3' -end of the first single-stranded DNA, not the base. The first coupling agent may be a bis-succinimidyl suberate sodium salt. The amino group in the first protein antigen that is linked to the first coupling agent is not located at the first epitope of the first protein antigen, otherwise the first protein antigen cannot specifically bind to the antibody of interest. The 3' -end of the first single-stranded DNA has no modification group.

In some embodiments, the full length sequence of the first single stranded DNA is as set forth in SEQ ID No: 1. The specific sequence may be ACGCTGAGTTATCAACGACTTTTTTTATCACATCAGGCTCTAGCGTATGCTATTG, but is not limited to the above sequence.

In some embodiments, the first single stranded DNA comprises a first DNA sequence and a second DNA sequence. In the first single-stranded DNA, the first DNA sequence may be located upstream of the second DNA sequence in order from the 5 'end to the 3' end. Illustratively, the first DNA sequence may be GCTGAGTT from 5 'to 3' and the second DNA sequence CAACGAC from 5 'to 3'. However, the first DNA sequence and the second DNA sequence are not complementarily paired. In various embodiments of the present application, no complementary pairing occurs between the two DNA sequences contained within each single stranded DNA. Complementary pairing of single-stranded DNA between different reagents occurs, thereby assembling a neck-ring structure.

In some embodiments, the first single stranded DNA has 55 nucleotides, the first DNA sequence covers the 3 rd to 10 th base site of the first single stranded DNA from the 5 'end, and the second DNA sequence covers the 13 th to 19 th base site of the first single stranded DNA from the 5' end.

In some embodiments, the first antigen epitope of the first protein antigen is capable of specifically binding to the antibody of interest. The antibody of interest is an antibody capable of having a specific affinity with a first epitope of the first protein antigen, which specifically recognizes only the first epitope of the first protein antigen, but not the other epitopes of the first protein antigen.

The second reagent may be formed by sequentially coupling a second protein antigen, a second single-stranded DNA, and a receptor fluorophore.

In some embodiments, the second antigen epitope of the second protein antigen is capable of specifically binding to the antibody of interest, which specifically recognizes only the second antigen epitope of the second protein antigen, and does not recognize other antigen epitopes of the second protein antigen. The first protein antigen is the same protein antigen as the second protein antigen, and the first epitope is the same as the second epitope. The antibody of interest is an antibody capable of having affinity with a second epitope of the second protein antigen. Because the target antibody is of a Y-type structure, a stable antibody-antigen complex is formed when it binds to the epitopes of both the first protein antigen and the second protein antigen. Thus, when the target antibody exists in the solution to be detected, the first protein antigen and the second protein antigen can react with the target antibody in an immune way to form an antibody-antigen complex.

In some embodiments, the full length sequence of the second single stranded DNA is as set forth in SEQ ID No: 2. The specific sequence may be TACGTCCAGAACTTTACCAAACCACACCCTTTTTTTGTCGTTGGCTGAGATTC, but is not limited to the above sequence.

In some embodiments, the second single stranded DNA has a third DNA sequence and a fourth DNA sequence. In the second single-stranded DNA, the third DNA sequence is located upstream of the fourth DNA sequence in the order from the 5 'end to the 3' end. Illustratively, the third DNA sequence is GTCGTTG from 5 'to 3' and the fourth DNA sequence is GCTGAGAT from 5 'to 3'. The third DNA sequence is complementary to the second DNA sequence. There is no complementary relationship between the third DNA sequence and the fourth DNA sequence, and therefore, the possibility of mismatches within the DNA strand is reduced.

In some embodiments, the second single stranded DNA has 53 nucleotides. The third DNA sequence covers 37 to 43 base sites of the second single-stranded DNA from the 5 'end, and the fourth DNA sequence covers 44 to 51 base sites of the second single-stranded DNA from the 5' end.

In some embodiments, the 3' end of the second single stranded DNA is attached to an acceptor fluorophore. Illustratively, the sugar ring at the 3' end of the second single-stranded DNA is modified with a thiol group, the surface of the acceptor fluorophore is modified with an amino group, and the thiol group is covalently linked to the amino group of the surface of the acceptor fluorophore via a third coupling agent. The third coupling agent may be 4- (N-maleimidomethyl) cyclohexane-1-carboxylic acid succinimidyl ester.

In some embodiments, the sugar ring at the 5' end of the second single stranded DNA is modified with an NH2C6 modifying group, covalently linked by an NH2C6 modifying group to the amino group of the second protein antigen via a second coupling agent. The second coupling agent is bis-succinimidyl suberate sodium salt. The amino group in the second protein antigen that is linked to the second coupling agent is not located at the second epitope of the second protein antigen, otherwise the second protein antigen cannot specifically bind to the antibody of interest.

The third reagent may be coupled to the third single stranded DNA by a donor fluorophore.

In some embodiments, the sugar ring at the 5' end of the third single stranded DNA is modified with an NH2C6 modifying group, the NH2C6 modifying group being covalently linked to the donor fluorophore.

In some embodiments, the full length sequence of the third single stranded DNA is as set forth in SEQ ID No: 3. The specific sequence may be CGATCTCAGCAACTCAGCAGCG, but is not limited to the above sequence.

In some embodiments, the third single stranded DNA comprises a fifth DNA sequence and a sixth DNA sequence, the fifth DNA sequence and the sixth DNA sequence not being complementary.

In some embodiments, in the third single stranded DNA, the fifth DNA sequence is located upstream of the sixth DNA sequence in order from the 5 'end to the 3' end.

In some embodiments, the third single stranded DNA has 22 nucleotides, the fifth DNA sequence covers the 3 rd to 10 th base site of the third single stranded DNA from the 5 'end, and the sixth DNA sequence covers the 11 th to 18 th base site of the third single stranded DNA from the 5' end. The sequence from the 5 'end to the 3' end of the fifth DNA sequence may be ATCTCAGC. The sequence from the 5 'end to the 3' end of the sixth DNA sequence may be AACTACC.

In some embodiments, the fifth DNA sequence is complementary to the fourth DNA sequence, the sixth DNA sequence is complementary to the first DNA sequence, and the third DNA sequence is complementary to the second DNA sequence. When the solution to be detected contains the target antibody, the first protein antigen, the second protein antigen and the target antibody form an antibody antigen complex, the formation of the antibody antigen complex drives the formation of conformational change and DNA assembly between three single-stranded DNA, a neck ring structure can be formed between the three single-stranded DNA by means of the complementary pairing relation between the DNA sequences, a donor fluorescent group and an acceptor fluorescent group are positioned on the same side of the neck ring structure, and fluorescence resonance energy transfer (Fluorescence resonance energy transfer, FRET) occurs between the two fluorescent molecules.

In some embodiments, the donor fluorophore emits a first fluorescence under conditions that allow oxidation by an oxidizing agent, the first fluorescence exciting the fluorophore to emit a second fluorescence according to a fluorescence resonance energy transfer effect under conditions that allow pairing of the first single-stranded DNA, the second single-stranded DNA, and the third single-stranded DNA, so as to obtain the content of the target antibody according to the intensity of the second fluorescence. When the target antibody is not present in the solution to be measured, the distance between the donor fluorophore and the acceptor fluorophore does not satisfy the conditions for fluorescence resonance energy transfer even though the donor fluorophore has strong background fluorescence, and therefore, the acceptor fluorophore does not generate second fluorescence. If the second fluorescence intensity is not obtained from the solution to be tested, it is indicated that the target antibody is not present in the solution to be tested, thereby avoiding false positives due to background fluorescence when only one fluorescent group is used for detection. When the target antibody exists in the solution to be detected, two identical antigens are combined with the target antibody simultaneously to form a stable antibody-antigen complex, and three single-stranded DNA forms a neck ring structure. The antibody-antigen complex and the neck ring structure are capable of providing a distance between the donor fluorophore and the acceptor fluorophore sufficient to produce a fluorescence resonance energy transfer effect, whereby the amount of the target antibody is determined based on a standard curve between the intensity and the intensity content of the second fluorescence emitted by the acceptor fluorophore.

In some embodiments, the donor fluorophore emits fluorescence without illumination by excitation light, but rather emits light under the oxidation of an oxidizing agent. However, the fluorescence emitted by the acceptor fluorescent group needs to be irradiated by the excitation light, and if the excitation light does not irradiate, the acceptor fluorescent group does not actively emit fluorescence, so background fluorescence is not easy to generate, and therefore, the measurement result of the embodiment of the application is not interfered by the background fluorescence of the acceptor fluorescent group. Compared with a method of emitting fluorescence by only one fluorescent group, the method of each embodiment of the application can effectively avoid interference of background fluorescence of fluorescent molecules, so that the measurement result is more accurate. The excitation light of the acceptor fluorophore is derived from the first fluorescence emitted by the donor fluorophore, but the first fluorescence alone is not sufficient to cause the acceptor fluorophore to emit the second fluorescence. Even if the donor fluorophore is present with background fluorescence, the background fluorescence does not excite the donor fluorophore to emit a second fluorescence if the donor fluorophore is spaced from the acceptor fluorophore by more than the minimum spacing required for the fluorescence resonance energy transfer effect. When the target antibody exists in the solution to be detected, the neck ring structure can enable the distance between the donor fluorescent group and the acceptor fluorescent group to be smaller than the minimum distance required by the fluorescence resonance energy transfer effect, and then the donor fluorescent group can excite the acceptor fluorescent group to emit second fluorescence. In a word, the background fluorescence of the donor fluorescent group can be effectively prevented from influencing the detection result, and the measurement error is reduced.

In some embodiments, the donor fluorophore and acceptor fluorophore need to be capable of fluorescence resonance energy transfer upon detection, requiring the following conditions to be met: the first reagent, the second reagent and the third reagent are complementarily paired in the presence of a target antibody to form a neck ring structure, so that the distance between the donor fluorescent group and the acceptor fluorescent group is less than or equal to 100 angstroms. At this time, the first fluorescence emitted from the donor fluorophore can become excitation light for the acceptor fluorophore, thereby exciting the acceptor fluorophore to generate the second fluorescence (as shown in FIG. 1).

In some embodiments, donor fluorescenceThe group may be an acridinium ester. The acridinium ester emits fluorescence not requiring excitation light, but rather oxidation luminescence is achieved in the presence of an oxidizing agent, and background fluorescence is present in the acridinium ester due to the possible presence of oxidizing substances in the solution to be measured, which also oxidizes and causes luminescence of the acridinium ester. If the fluorescence of acridinium ester is used as the measurement fluorescence, background fluorescence will interfere with the measurement fluorescence, so in order to further improve the sensitivity of detection and reduce measurement errors, the embodiments of the present application do not use the fluorescence of acridinium ester as the measurement fluorescence. Chemiluminescent substrate of acridinium ester is H ₂ O ₂ Is also called an oxidizing agent. When acridinium esters are combined with H ₂ O ₂ In the presence of an alkaline solution, the molecule of the acridinium ester is attacked by hydrogen peroxide ion, and the acridinium ester can react with hydrogen peroxide (H) ₂ O ₂ ) Unstable dioxyethane is formed, and subsequent decomposition of dioxyethane emits fluorescence.

In some embodiments, the donor fluorophore acridinium ester has a maximum emission wavelength of 430nm. In some embodiments, the acceptor fluorophore may be a quantum dot. The maximum absorption wavelength of the acceptor fluorophore quantum dot may be in the range of 420nm to 520nm, such as 470nm, and the maximum emission wavelength may be in the range of 595nm to 615nm, such as 605nm. Thus, the donor and acceptor fluorophores in the examples herein are capable of fluorescence resonance energy transfer effects. In some embodiments, the quantum dot is a core-shell quantum dot, the core layer material of which is selected from one or more of CdSe, cdS, cdTe, cdSeTe, cdZnS, znTe, cdSeS, pbS and PbTe, and the shell layer material of which is selected from one or more of ZnS, znSe, znSeS, pbS and PbSeS. In some embodiments, the quantum dots may have a particle size in the range of 3nm to 5nm, and may be 4.1nm, for example.

In some embodiments, G in the first single-stranded DNA, the second single-stranded DNA, and the third single-stranded DNA may be _iso G is substituted, C can be _iso C is replaced. Since natural nucleic acid is also present in blood samples and the like when the solution to be measured is derived from these samples, the non-natural base pair is introduced _iso G and _iso c) Can avoid the first single-stranded DNAThe second single-stranded DNA and the third single-stranded DNA are combined with nucleic acid in the blood sample in a non-specific way, so that measurement errors caused by DNA mismatch are avoided. In addition, these unnatural base pairs do not affect the pairing between the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA, and can still form a stable neck ring structure, thereby not affecting the generation of the second fluorescence. Illustratively, G in the full-length sequence of the first single-stranded DNA is _iso G is substituted by C _iso C is replaced. G in the full-Length sequence of the second Single-stranded DNA _iso G is substituted by C _iso C is replaced. G in the full-Length sequence of the third Single-stranded DNA _iso G is substituted by C _iso C is replaced.

In some embodiments, G in the first DNA sequence and the sixth DNA sequence paired with each other is _iso G is substituted by C _iso C is replaced. Illustratively, the first DNA sequence is from 5 'to 3' end _iso G _iso CT _iso GA _iso GTT, AA in the sixth DNA sequence from 5 'end to 3' end _iso CT _iso CA _iso G _iso C。

In some embodiments, G in the second DNA sequence and the third DNA sequence paired with each other is _iso G is substituted by C _iso C is replaced. Illustratively, the second DNA sequence is from 5 'to 3' end _iso CAA _iso C _iso GA _iso C, the third DNA sequence is from 5 'end to 3' end _iso GT _iso C _iso GTT _iso G。

In some embodiments, G in the fourth DNA sequence and the fifth DNA sequence paired with each other is _iso G is substituted by C _iso C is replaced. Illustratively, the fourth DNA sequence is from 5 'to 3' end _iso G _iso CT _iso GA _iso GAT, AT from 5 'to 3' of the fifth DNA sequence _iso CT _iso CA _iso G _iso C。

In the above-described embodiments of the present invention, _iso the structural formula of G can be:

_iso the structural formula of C can be:

_iso g and G _iso The bonding mode of C can be as follows:

representing ribose.

Thus, the first and second substrates are bonded together, _iso g and G _iso C can generate complementary pairing, does not influence the mutual pairing of the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA, but can prevent the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA from being mismatched with natural nucleic acid in the solution to be tested, so that the measurement error caused by the mismatch between the single-stranded DNA and the natural nucleic acid molecule can be reduced.

The fourth reagent comprises: an antioxidant for the donor fluorophore to be oxidized to emit a first fluorescence. During detection, a first reagent, a second reagent, a third reagent and a fourth reagent are added into the solution to be detected, and the mixture is mixed to form a sample to be detected. When the antioxidant exists in the sample to be tested, even if the first reagent, the second reagent and the third reagent form a neck ring structure, the donor fluorescent group acridinium ester does not emit fluorescence, because the antioxidant can inhibit the oxidation luminescence of the acridinium ester. Therefore, it is necessary to remove the antioxidant from the sample to be tested prior to testing.

In some embodiments, to achieve smooth removal of the antioxidant from the sample to be tested, the fourth reagent further comprises a carrier molecule and binds the antioxidant to the surface of the carrier molecule. At this time, since the carrier molecule has a large molecular weight, it is relatively easy to remove from the sample to be measured. As long as the carrier molecule is removed, simultaneous removal of the antioxidant can be achieved.

In some embodiments, the carrier molecule may be Graphene Oxide (GO). The carboxyl group on the graphene oxide is combined with the hydroxyl group on the antioxidant through the sulfoxide oxide condensing agent, and the carboxyl group on the graphene oxide is combined with the amino group on the antioxidant through 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride. The first reagent, the second reagent, the third reagent and the fourth reagent are added into the solution to be detected to form a sample to be detected, the third single-stranded DNA is adsorbed on the surface of the graphene oxide through pi-pi stacking, the end-marked Acridinium Ester (AE) cannot emit oxidation light due to the existence of an antioxidant, and even if a small part of the Acridinium ester emits chemiluminescence, background fluorescence with the wavelength of 430nm is generated, and the measurement result cannot be influenced. Because the fluorescence obtained during detection comes from the acceptor fluorophore quantum dot, not from the acridinium ester, only the fluorescence emitted by the quantum dot can be obtained by arranging a filter, and the background fluorescence of the acridinium ester can be filtered out. In addition, even if a small portion of the acridine ester has background fluorescence, because no neck ring structure is present, the acridine ester does not excite quantum dot fluorescence based on fluorescence resonance energy transfer. Therefore, the embodiment of the application can reduce the influence of the background fluorescence of the acridine ester on the measurement result to the maximum extent, and further reduce the measurement error. In some embodiments, the fluorescence emitted by the quantum dots may be obtained through filters and photomultiplier tubes (Photomultiplier tube, PMT). Illustratively, if the quantum dot emits fluorescence at 605nm, the filter only allows light of 605nm wavelength to pass.

In some embodiments, the antioxidant may be selected from any one or more of cannabidiol, vitamin C, vitamin E, tea polyphenols, glutathione. The oxidizing agent may comprise an alkaline solution of hydrogen peroxide. After removal of the antioxidant, the addition of the oxidizing agent causes the donor fluorophore acridinium ester to fluoresce.

The embodiments of the present application recognize an antibody of interest by an immune reaction, thereby bringing together a pair of DNA distances coupled to the antibody, thereby initiating DNA assembly, triggering cascade DNA assembly, and causing a fluorescence resonance energy transfer effect between two fluorescent molecules to generate a detection signal.

Various embodiments of the present application use Acridinium Esters (AE) as fluorescent energy donors (donor), and fluorescent Quantum Dots (QDs) as fluorescent energy acceptors (acceptors), based on chemiluminescent resonance energy transfer systems. The fluorescent signal amplification is realized through immune reaction and DNA self-assembly, and the detection of the content of the target antibody is converted into the detection of the fluorescent signal intensity. The methods of the embodiments of the present application may be performed homogeneously. Compared with the traditional fluorescence resonance energy transfer analysis method, the detection method of the embodiment of the application is simple and rapid, and does not need expensive laser. The embodiment of the application adopts the second fluorescence as the detection fluorescence, so that the background interference of the first fluorescence is reduced. The embodiment of the application adopts immune reaction to enrich the target antibody, has good selectivity to the target antibody and high detection sensitivity.

[ method for detecting target antibody ]

As shown in fig. 2, some embodiments of the present application provide a method for detecting an antibody of interest, which may use the above-described combination of reagents. Features relating to the combination of reagents described above may be incorporated into this section. The detection method of the above embodiment includes the following steps:

(1) Providing a first reagent, a second reagent, a third reagent and a fourth reagent, adding the first reagent, the second reagent, the third reagent and the fourth reagent into the solution to be tested, and mixing to form a sample to be tested. The first reagent is formed by coupling a first single-stranded DNA and a first protein antigen. The second reagent is formed by coupling a second protein antigen, a second single-stranded DNA and a receptor fluorescent group in sequence. The third reagent is formed by coupling a donor fluorophore and a third single-stranded DNA. Under the condition that the solution to be detected contains the target antibody, the first protein antigen, the target antibody and the second protein antigen form an antibody-antigen complex, and the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA form a neck ring structure, so that the donor fluorescent group and the acceptor fluorescent group are positioned on the same side of the neck ring structure.

(2) Removing the fourth reagent from the sample to be measured, adding an oxidizing agent for oxidizing the donor fluorophore to emit the first fluorescence and collecting the second fluorescence at the maximum emission wavelength of the acceptor fluorophore. The fourth reagent contains an antioxidant for inhibiting the oxidation of the donor fluorophore by the oxidizing substance in the solution to be tested. Since the donor fluorophore does not emit the first fluorescence in the presence of the antioxidant, the antioxidant needs to be removed in advance before the oxidant is added. In addition, the donor fluorophore is protected from oxidation by an antioxidant before being oxidized, so that background fluorescence emitted by the donor fluorophore due to influence of other factors can be reduced.

(3) Under the condition that the second fluorescence is not collected, judging that the solution to be detected does not contain the target antibody; and under the condition that the second fluorescence is collected, obtaining the content of the target antibody in the solution to be detected according to the intensity of the second fluorescence based on a functional relation between the fluorescence intensity and the antibody content.

In this step, the donor fluorescent group is oxidized to generate first fluorescence, and in order to avoid the influence of the first fluorescence on the detection result, a filter is used to filter out the first fluorescence, and the filter only allows the transmission of the second fluorescence emitted by the acceptor fluorescent group, and at this time, the content of the target antibody is obtained according to the intensity of the second fluorescence. If the relative intensity of the second fluorescence is 0, it indicates that the test solution does not contain the target antibody. And if the relative intensity of the second fluorescence is not 0, obtaining the content of the target antibody in the solution to be detected according to a functional relation between the relative intensity of the second fluorescence and the content of the antibody. The relative intensity refers to the fluorescence intensity value remaining after the background fluorescence intensity of the control group is excluded from the intensity of the second fluorescence signal.

In some embodiments, the working concentration of the first reagent in the sample to be tested is from 1nM to 20nM. Working concentration refers to the concentration of each reagent at the time of actual detection, i.e., the final concentration of each reagent in the sample to be tested. The working concentration is not equal to the storage concentration of each reagent in the target antibody detection kit. In some embodiments, the working concentration of the second reagent in the sample to be tested is from 1nM to 20nM. In some embodiments, the working concentration of the third reagent in the sample to be tested is 0.05nM to 0.2nM. In some embodiments, the working concentration of the fourth reagent in the sample to be tested is from 15 μg/ml to 25 μg/ml.

In some embodiments, the test solution blood sample is from a whole blood sample, a serum sample, or a plasma sample.

In some embodiments, the time of mixing is from 5 minutes to 10 minutes. If the mixing time is too short, the antibody-antigen complex and neck ring structure may not be fully formed, and fluorescence resonance energy transfer between the donor and acceptor fluorophores may not then occur fully, which may result in a measured fluorescence value that is less than the actual value. If the mixing is too long, the antibody-antigen complex and neck ring structure may be destroyed, which may also result in a measured fluorescence value that is less than the actual value.

In some embodiments, the temperature of mixing is 36 degrees to 37 degrees.

In some embodiments, the volume of oxidant is 200 μl. The oxidant is alkaline hydrogen peroxide solution, and the pH value is 8.0. The alkaline hydrogen peroxide solution was prepared by dissolving hydrogen peroxide in TBS buffer, wherein the final concentration of hydrogen peroxide was 0.1M and the final concentration of TBS was 10mM.

In some embodiments, the antibody of interest comprises a hepatitis b surface antibody, a hepatitis c surface antibody, or a cytomegalovirus IgG. In other embodiments, however, the target antibodies are not limited to the several above. So long as the first protein antigen and the second protein antigen of the present application are capable of specifically binding to the same target antibody, respectively, and form a stable antibody-antigen complex. If the first protein antigen and the second protein antigen are respectively combined with two target antibodies, the combination state is unstable, the combination is easy to break and the combination is re-combined, and finally, the first protein antigen and the second protein antigen are combined with 1 target antibody at the same time, and a relatively stable antibody-antigen complex is formed. The antibody antigen complex further causes the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA to be pulled in a distance to form a neck ring structure, and the donor fluorescent group and the acceptor fluorescent group are positioned on the same side of the neck ring structure, so that the donor fluorescent group can excite the acceptor fluorescent group to generate second fluorescence. Thus, if one target antibody corresponds to one acceptor fluorophore, the number of target antibodies is linearly related to the fluorescence intensity of the acceptor fluorophore, and the content of the target antibody can be calculated according to the unitary first-order equation (i.e., the functional relation between the intensity of the second fluorescence and the antibody content) contained in the standard curve and the obtained fluorescence intensity of the acceptor fluorophore.

In some embodiments, specific detection steps are as follows: mixing the reagent with a blood sample or a whole blood sample or a serum sample or a plasma sample to be detected containing a target antibody, performing incubation reaction for 5-10 minutes at 37 ℃ on a chemiluminescent detector, adding chemiluminescent substrate hydrogen peroxide, sodium hydroxide and TBS buffer solution serving as oxidants, and collecting the generated chemiluminescent fluorescent signals through a PMT detection module in the chemiluminescent detector. And automatically calling a standard curve by the chemiluminescent detector, and reporting the concentration of the target antibody in the sample to be detected according to the functional relation between the fluorescence intensity and the antibody content in the standard curve.

[ target antibody detection kit ]

Some embodiments of the present application provide a target antibody detection kit that uses the detection method described above for detection. The target antibody detection kit comprises: first test tube, second test tube, third test tube, fourth test tube, fifth test tube.

Wherein the first tube stores a conjugate of the first single-stranded DNA and the first protein antigen. The first single-stranded DNA contains 55 bases and is modified at the 3' -end with an NH2C7 group. The 3' C7 amino modified primer was purchased from Kirschner Biotech Co. The NH2C7 group is covalently linked to the amino group of the first protein antigen via the first coupling agent bis-succinimidyl suberate sodium salt (BS 3), thereby forming a conjugate of the first single stranded DNA and the first protein antigen.

The second tube stores a conjugate of a second protein antigen, a second single-stranded DNA, and an acceptor fluorophore. The first protein antigen and the second protein antigen are capable of forming an antibody-antigen complex with the antibody of interest in the presence of the antibody of interest. The second single-stranded DNA contains 53 bases, a thiol group is modified at the 3 'end, and an NH2C6 group is modified at the 5' end. Thiol-modified reagent 3'SH C6, 5' Aminolinker (C6) modified primers were purchased from Kirsrui Biotechnology Co., ltd. The 5 'modification is added to the 5' sugar ring in the form of an amine phosphite in the last step of the synthesis cycle by beta-cyanoethyl chemistry, rather than to the last base. The thiol at the 3' end is covalently linked to the amino groups on the surface of the amino-modified quantum dot QDs via a third coupling agent, 4- (N-maleimidomethyl) cyclohexane-1-carboxylic acid succinimidyl ester (SMCC). In some embodiments, the amino-modified water-soluble quantum dot may be of the type amino-water-soluble quantum dot (PEG) -605, of the composition CdSe/ZnS, commercially available from Seamantadine Biotechnology Inc. The maximum absorption peak wavelength of (PEG) -605 was 470nm, the maximum emission wavelength was 605nm, and the particle size was 4.1nm. The amino group of the amino-modified quantum dot is coupled with the thiol group at the 3' end of the second single-stranded DNA to form a conjugate of the second single-stranded DNA and the quantum dot. The NH2C6 group at the 5' end of the second single-stranded DNA is covalently bound to the amino group on the second protein antigen via a second coupling agent BS3, forming a conjugate of the second protein antigen, the second single-stranded DNA and the acceptor fluorophore.

A third tube stores a conjugate of the donor fluorophore and a third single stranded DNA. The first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA can form a neck ring structure under the condition of forming an antibody antigen complex; the donor fluorophore and acceptor fluorophore can be on the same side of the neck ring structure. The third single stranded DNA contains 22 bases and is modified at the 5' end with an NH2C6 group. The modified primer 5'Aminolinker (C6) was added to the sugar ring at the 5' end of the third single stranded DNA by beta-cyanoethyl chemistry in the form of an amine phosphite in the last step of the synthesis cycle, rather than to the last base. The modified primers were purchased from gold SpA. The conjugate of the donor fluorophore and the third single stranded DNA was formed by the addition of an acridinium ester (NSP-DMAE-NHS) purchased from Suzhou subfamily technologies Co., ltd., CAS number 194357-64-7. The 3 to 10 base sites of the third single-stranded DNA from the 5' end are fully complementary to the bases of the 3 to 10 base sites of the second single-stranded DNA from the 3' end (i.e., 44 to 51 base sites from the 5' end). The 5 to 12 base sites of the third single-stranded DNA from the 3' -end (i.e., the 11 th to 18 th base sites from the 5' -end) are completely complementary to the bases of the 3 to 10 base sites of the first single-stranded DNA from the 5' -end, as shown in FIG. 1.

The fourth tube stores an antioxidant capable of inhibiting oxidation of the donor fluorophore. The antioxidant may be bound to the surface of the carrier molecule. In some embodiments, the carrier molecule may be graphene oxide.

The fifth cuvette stores an oxidizing agent capable of oxidizing the donor fluorophore to emit first fluorescence.

The detection principle of the target antibody detection kit in the above embodiment is as follows:

the third single-stranded DNA has 8 bases and is complementarily paired with the first single-stranded DNA and the second single-stranded DNA, wherein the natural base pairs G and C are replaced by non-natural base pairs _iso G and _iso C。

in the absence of the target antibody, a neck ring structure is not formed, the third single-stranded DNA is adsorbed on the surface of Graphene Oxide (GO) through pi-pi stacking, the end-labeled Acridinium Ester (AE) cannot emit light by oxidation due to the existence of an antioxidant, and even if a small part of acridinium ester generates background fluorescence, the chemiluminescence (430 nm wavelength) of the acridinium ester cannot be detected by PMT due to an optical filter (only allowing 605nm light to pass through) of the instrument.

The first protein antigen and the second protein antigen are capable of forming an antibody-antigen complex with the antibody of interest in the presence of the antibody of interest. Because the first protein antigen is coupled to the first single-stranded DNA, the second protein antigen is coupled to the second single-stranded DNA, and the antibody antigen complex allows the first single-stranded DNA and the second single-stranded DNA to be sufficiently close to form an orthocomplex and to hybridize to the third single-stranded DNA, such that the first single-stranded DNA, the second single-stranded DNA, and the third single-stranded DNA form a neck ring structure, and the donor fluorophore and the acceptor fluorophore are on the same side of the neck ring structure. The complex formed by the antibody and the DNA is not substantially adsorbed by the graphene oxide carrier molecule, so that the antioxidant coupled to the carrier molecule does not substantially affect the luminescence of the acridinium ester. Under conditions where the fourth reagent is removed, the added oxidizing agent oxidizes the donor fluorophore and causes it to emit a first fluorescence that excites the acceptor fluorophore to emit a second fluorescence (e.g., 605 nm) based on fluorescence resonance energy transfer, so that the amount of target antibody is obtained based on the intensity of the second fluorescence.

[ target antibody detection System ]

The present application provides a target antibody detection system, comprising: the device comprises a reaction container, a microinjection pump, an optical filter and a calculation module.

The microinjection pump is communicated with the accommodating chamber of the reaction container through an injection pipeline, and the mixture of the first reagent, the second reagent, the third reagent and the fourth reagent is injected into the accommodating chamber; the first reagent is formed by coupling a first single-stranded DNA and a first protein antigen, the second reagent is formed by coupling a second protein antigen, a second single-stranded DNA and an acceptor fluorescent group in sequence, the third reagent is formed by coupling a donor fluorescent group and a third single-stranded DNA, and the fourth reagent contains an antioxidant for inhibiting the donor fluorescent group from being oxidized to emit first fluorescence.

The optical filter is arranged on the emergent light path of the first fluorescence and allows the second fluorescence with the same maximum emission wavelength as the acceptor fluorescent group to pass through.

The optical signal detection module is arranged on the downstream side of the optical filter positioned on the emergent light path of the fluorescent signal, and acquires second fluorescent light transmitted from the optical filter.

The calculation module converts the second fluorescence into a digital signal and obtains the content of the target antibody in the solution to be detected according to a functional relation between the fluorescence intensity and the antibody content. The standard curve contains a standard equation, wherein the standard equation is a unitary one-time equation and contains a one-to-one correspondence relation between the digital signal and the content of the target antibody.

The embodiment of the application provides a simple, rapid and sensitive homogeneous phase chemiluminescence immunoassay protein detection method by combining a graphene oxide coupling antioxidant and a dual quenching mechanism of an optical filter and a chemiluminescence resonance energy transfer and immunoassay technology. In contrast to existing immunoassay methods, some embodiments of the present application have the following features:

(1) Some embodiments of the application are homogeneous immunoassay methods, which are simple to operate, and simultaneously greatly shorten the clinical test specimen turnover time (TAT), and can sample whole blood without centrifugal treatment of blood specimens, and the detection report can be sent out in about 5 minutes.

(2) According to the method, the acridine ester is oxidized light, the quantum dots are excited light, self-excitation light between the acridine ester and the quantum dots can be achieved, a complex external excitation light system is not needed, and complexity and cost of a measuring instrument can be effectively reduced. Because the requirements of matched detection equipment are reduced, the modules are reduced, the cost is reduced, the failure rate is also greatly reduced, and automatic detection or miniaturized portable bedside detection (POCT) can be realized.

(3) The acridinium ester-quantum dot luminescent system of some embodiments of the application introduces a double quenching mechanism (graphene oxide-reducing agent and optical filter), has lower background fluorescence and higher detection sensitivity, and is suitable for detection with higher sensitivity.

(4) According to the method, the graphene oxide-antioxidant quenching mechanism is induced through immune reaction, the switching efficiency reaches 100% through the introduction of an additional optical filter, and the quantum dots are enabled to emit light through the combination of a chemiluminescent resonance energy transfer effect, so that the steps of separation and cleaning are not needed.

(5) The DNA molecules in some embodiments of the present application contain unnatural base pairs (isoG and isoC) that avoid non-specific binding to nucleic acids in the sample.

The techniques of the present application are further described below in connection with various preparations and examples.

Preparation example preparation of a conjugate of a second Single-stranded DNA and a acceptor fluorophore (Quantum dot)

The preparation example provides a preparation method of a conjugate of a second single-stranded DNA and quantum dots, which comprises the following steps:

1. preparing SMCC solution: 10mg of 4- (N-Maleimidomethyl) cyclohexane-1-carboxylic acid succinimidyl ester (4- (N-Maleimidomethyl) cyclohexanecarboxylic acid N-hydroxysuccinimide ester, SMCC) are weighed out in 1mL DMF. SMCC was purchased from Shanghai Alasdine Biochemical technologies Co., ltd., product number N159712, CAS number 64987-85-5.

2. Preparing a second single-stranded DNA solution: the second single-stranded DNA was taken at 10. Mu.M, and 1mL of purified water was added for dissolution.

3. Preparing a conjugate of a second single-stranded DNA and quantum dots: 100. Mu.L of the second single-stranded DNA solution was placed in an EP tube, 200. Mu.L of QDs (commercially available from Seamantadine Biotechnology Co., ltd., model amino water-soluble quantum dot (PEG) -605, concentration 8. Mu.M) was added, 3. Mu.L of SMCC solution was added, and the mixture was mixed well and incubated at 37℃for 30 minutes.

4. And (3) dialysis: the conjugate of the conjugated second single-stranded DNA and quantum dot was aspirated from the EP tube, added to a dialysis bag (5 kd gauge), and the bundle of dialysis bags was placed in a beaker containing 2-3L TE solution (10mM Tris,1mM EDTA,PH =8.0) for dialysis. The dialysis bag is soaked in advance before dialysis. Changing the dialyzate for 2-3 hours for one time, dialyzing for three times, collecting the liquid in the dialyzing bag after the dialyzing, placing the liquid in a centrifuge tube, and storing at 2-8 ℃ for later use.

Preparation example preparation of conjugate of two donor fluorophore (acridinium ester) and third Single-stranded DNA

The present preparation provides a method for preparing a conjugate of an Acridinium Ester (AE) and a third single-stranded DNA, comprising the steps of:

1. preparing a third single-stranded DNA solution: mu.M of the third single-stranded DNA was taken and dissolved in 1mL of purified water.

2. Preparing NHS-AE solution: 4mg of acridinium ester (NSP-DMAE-NHS) was weighed out and dissolved in 1mL of purified water. Acridinium esters are purchased from Suzhou subfamily technologies Inc., CAS number 194357-64-7.

3. Coupling: to each 1mg of NHS-AE solution, 10. Mu.L of the third single-stranded DNA solution was added, and the mixture was mixed well in an EP tube and incubated at 37℃for 30min.

4. And (3) dialysis: sucking out the coupled product from the EP tube, adding into a dialysis bag (specification 5 kd), putting the pricked dialysis bag into a beaker filled with 2-3L TE solution (10mM Tris,1mM EDTA,PH =8.0), dialyzing (soaking the dialysis bag in advance), changing the dialyzate for 2-3 hours for one time, dialyzing for three times, collecting the liquid in the dialysis bag after the dialysis is completed, putting the liquid into a centrifuge tube, and storing at 2-8 ℃ for later use.

Preparation example III preparation of conjugate of first Single-stranded DNA and first protein antigen

The present preparation provides a method for preparing a conjugate of a first single-stranded DNA and a first protein antigen, comprising the steps of:

1. preparing a BS3 solution: 10mg of bis-succinimidyl suberate sodium salt (BS 3) was weighed out and dissolved in 1mL of purified water. BS3 was purchased from shanghai aladine biochemical technologies, inc., cat No. S304724.

2. Activating: taking out the packaged first protein antigen, thawing, and centrifuging and mixing uniformly. mu.L of BS3 solution was added to 1mg of the first protein antigen, 6.5. Mu.L of the first single-stranded DNA was added thereto, and the mixture was mixed well in an EP tube and incubated at 37℃for 30 minutes.

3. And (3) dialysis: sucking out the conjugate of the first single-stranded DNA and the first protein antigen from the EP tube, adding the conjugate into a dialysis bag (specification 100 kd), putting the pricked dialysis bag into a beaker filled with 2-3L PBS solution, dialyzing (soaking the dialysis bag in advance), changing the dialyzate for 2-3 hours for one time, dialyzing for three times, collecting the liquid in the dialysis bag after the dialysis is completed, putting the liquid into a centrifuge tube, and storing at 2-8 ℃ for later use.

Preparation example IV preparation of conjugate of second protein antigen, second Single-stranded DNA and acceptor fluorophore

The present preparation provides a method for preparing a conjugate of a second protein antigen, a second single-stranded DNA and an acceptor fluorophore, comprising the steps of:

1. preparing a BS3 solution: 10mg of bis-succinimidyl suberate sodium salt (BS 3) was weighed out and dissolved in 1mL of purified water. BS3 was purchased from shanghai aladine biochemical technologies inc.

2. Activating: taking out the packaged second protein antigen, thawing, and centrifuging and mixing. mu.L of BS3 solution was added to 1mg of the second protein antigen, 6.5. Mu.L of the conjugate of the second single-stranded DNA and the quantum dot was added, and the mixture was mixed well in an EP tube and incubated at 37℃for 30min.

3. And (3) dialysis: sucking out the conjugate of the second protein antigen, the second single-stranded DNA and the acceptor fluorescent group from the EP tube, adding the conjugate into a dialysis bag (specification is 100 kd), putting the pricked dialysis bag into a beaker filled with 2-3L PBS solution, dialyzing (soaking the dialysis bag in advance), changing the dialyzate for one time for 2-3 hours, dialyzing for three times, collecting the liquid in the dialysis bag after the dialysis is completed, putting the liquid in a centrifuge tube, and storing at 2-8 ℃ for standby.

Example 1

This example detects hepatitis b surface antibody (HBsAb) in serum based on a homogeneous immunoassay method of graphene oxide-antioxidant quenching and acridine ester chemiluminescence. Wherein, the first protein antigen (also called first scaffold protein) is purchased from a Pengpeng organism, the clone number is HBsAg-11#, and the second protein antigen (also called second scaffold protein) and the first protein antigen are the same protein. The two antigens were coupled to the corresponding DNA molecules by the preparation examples described above. The specific detection method comprises the following steps:

1. Preparing a detection solution: the conjugate of the first single-stranded DNA and the first protein antigen (DNA 1-scaffold protein 1 conjugate), the second protein antigen, the conjugate of the second single-stranded DNA and the quantum dot (scaffold protein 2-DNA2-QDs conjugate), the conjugate of the acridine ester and the third single-stranded DNA, and the antioxidant-modified graphene oxide (GO-AOD) were mixed to have final concentrations of 10nM, 0.15. Mu.M and 20. Mu.g/ml, respectively.

2. mu.L of calibration solution or serum sample containing antibody against hepatitis B surface (HBsAb) at various concentrations was mixed with 200. Mu.L of detection solution and incubated at 37℃for 5-10 minutes.

3. After incubation, 200. Mu.L of chemiluminescent substrate was added by HSCL-10000 chemiluminescent instrument. Chemiluminescent substrates include: 10mM TBS buffer, 0.1M hydrogen peroxide lye, pH=8.0. And immediately detecting chemiluminescent signals of the solution by a photomultiplier tube (PMT) for 3s. Based on the recorded chemiluminescence values (RLU), a calibration curve of the hepatitis b surface antibody and the concentration of HBsAb in the serum sample to be tested were obtained.

After multiple detection, the detection limit of the HBsAb of the embodiment is 2-1000IU/mL. Through detecting 40 cases of clinical samples, the error between the detection value of the HBsAb and the Roche test value of the embodiment is-3.67% -3.67%, which proves that the detection method of the embodiment has higher accuracy. The detection results are shown in the following table 1. The Roche assay refers to a kit for quantitative detection of HBsAb in Roche diagnosis.

Table 1 shows a comparison table of the detection values of the present example and the Roche detection method

Example two

In this example, qualitative detection of hepatitis C surface antibody (HCVAb) in serum was performed based on a homogeneous immunoassay method of graphene oxide-antioxidant quenching and acridine ester chemiluminescence. Wherein, the first protein antigen (also called as a first scaffold protein) is purchased from a fei peng organism, the clone number is C114, and the second protein antigen (also called as a second scaffold protein) and the first protein antigen are the same protein. The two antigens were coupled to the corresponding DNA by the preparation examples described above. The specific detection method comprises the following steps:

1. preparing a detection solution: the conjugate of the first single-stranded DNA and the first protein antigen, the conjugate of the second protein antigen, the second single-stranded DNA and the quantum dot, the conjugate of the acridine ester and the third single-stranded DNA, and the antioxidant-modified graphene oxide were mixed so that their final concentrations were 20nM, 0.15. Mu.M, and 20. Mu.g/ml, respectively.

2. mu.L of calibration solution or serum samples containing antibodies on the surface of hepatitis C were mixed with 200. Mu.L of detection solution and incubated at 37℃for 5-10 min.

3. After incubation, 200. Mu.L of chemiluminescent substrate was added by HSCL-10000 chemiluminescent instrument, the chemiluminescent substrate comprising: 10mM TBS buffer, 0.1M hydrogen peroxide in alkaline solution, pH=8.0, and immediately detecting the chemiluminescent signal of the solution by a photomultiplier tube (PMT) for 3s. Based on the recorded chemiluminescence values (RLU), a calibration curve for HCVAb and negative and positive determinations of HCVAb in the serum samples to be tested are obtained.

Through detecting 40 cases of clinical samples, the negative coincidence rate of the HCVAb and the Roche test results of the embodiment is 100%, the positive coincidence rate is 100%, and the total coincidence rate is 100%, which indicates that the detection method of the embodiment has higher accuracy. Specific tests are shown in Table 2.

Table 2 is a table showing comparison of detection values of the present example and the Roche detection method

Wherein positive compliance = a/(a+c) ×100% = 100%. Negative compliance = D/(a+b) ×100% = 100%. Total compliance = a+d/(a+b+c+d) ×100% = 100%.

Example III

This example detects cytomegalovirus IgG (CMV IgG) in serum based on a homogeneous immunoassay method of graphene oxide-antioxidant quenching and acridine ester chemiluminescence. Wherein the first protein antigen is purchased from a Pengpeng organism and has a clone number of HCMV-Ag1. The second protein antigen (also called a second scaffold protein) is the same protein as the first protein antigen. The two antigens were coupled to the corresponding DNA by the preparation examples described above. The specific detection method comprises the following steps:

2. mu.L of calibration solution or serum samples containing cytomegalovirus IgG at various concentrations were mixed with 200. Mu.L of reagent solution and incubated at 37℃for 5-10 minutes.

3. After incubation, 200. Mu.L of chemiluminescent substrate was added by HSCL-10000 chemiluminescent instrument. Chemiluminescent substrates include: 10mM TBS buffer, 0.1M hydrogen peroxide lye, pH=8.0. And immediately detecting chemiluminescent signals of the solution by a photomultiplier tube (PMT) for 3s. Based on the recorded chemiluminescence values (RLU), a calibration curve of CMV IgG and the concentration of CMV IgG in the serum sample to be tested were obtained.

After multiple detection, the detection limit of CMV IgG of the embodiment is 0.25-500U/mL.

Through detecting 40 clinical samples, the error between the detection value of CMV IgG and the Roche test value of the embodiment is 1.91%, which indicates that the detection method of the embodiment has higher accuracy. Specific tests are shown in Table 3.

Table 3 shows a comparison table of the detection values of the present example and the Roche detection method

The present application has been described with respect to the above-described embodiments, however, the above-described embodiments are merely examples of implementation of the present application. It must be noted that the disclosed embodiments do not limit the scope of the present application. On the contrary, modifications and equivalent arrangements included within the spirit and scope of the claims are intended to be included within the scope of the present application.

SEQUENCE LISTING

<110> Nanjing Pu Bio-technology Co., ltd

<120> reagent composition for detecting target antibody, kit, detection system and detection method

<130> SUP220182CN

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 55

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

acgctgagtt atcaacgact ttttttatca catcaggctc tagcgtatgc tattg 55

<210> 2

<211> 53

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tacgtccaga actttaccaa accacaccct ttttttgtcg ttggctgaga ttc 53

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

cgatctcagc aactcagcag cg 22

Claims

1. A reagent combination for detecting an antibody of interest, comprising:

a first reagent formed by coupling a first single-stranded DNA and a first protein antigen; the first single-stranded DNA comprises a first DNA sequence and a second DNA sequence; the first antigen of the first protein antigen can specifically bind to the target antibody;

the second reagent is formed by sequentially coupling a second protein antigen, a second single-stranded DNA and a receptor fluorescent group; the second single-stranded DNA has a third DNA sequence and a fourth DNA sequence, the third DNA sequence being complementary to the second DNA sequence; the second antigen of the second protein antigen is capable of specifically binding to the target antibody;

a third reagent coupled by a donor fluorophore and a third single-stranded DNA; the third single-stranded DNA comprises a fifth DNA sequence complementary to the fourth DNA sequence and a sixth DNA sequence complementary to the first DNA sequence; the donor fluorescent group emits first fluorescence under the condition that the donor fluorescent group can be oxidized by an oxidizing agent, and the first fluorescence excites the acceptor fluorescent group to emit second fluorescence under the condition that the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA are mutually paired so as to obtain the content of the target antibody according to the one-to-one correspondence between the intensity and the fluorescence intensity of the second fluorescence and the content of the antibody;

A fourth reagent comprising: an antioxidant for inhibiting the donor fluorophore from being oxidized to emit the first fluorescence; the fourth reagent further comprises a carrier molecule, the surface of which binds the antioxidant; forming an antibody antigen complex by the first protein antigen, the second protein antigen and the target antibody in the presence of the target antibody, wherein the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA are complementarily paired to form a neck ring structure, so that the distance between the donor fluorescent group and the acceptor fluorescent group is smaller than the limit distance capable of fluorescence resonance energy transfer;

the donor fluorophore is an acridinium ester;

the acceptor fluorescent group is a quantum dot;

g in the first DNA sequence and the sixth DNA sequence is detected _iso G is substituted by C _iso C is substituted; and/or

G in the second DNA sequence and the third DNA sequence is detected _iso G is substituted by C _iso C is substituted; and/or

G in the fourth DNA sequence and the fifth DNA sequence is detected _iso G is substituted by C _iso C is substituted; and/or

G in the full-length sequence of the first single-stranded DNA _iso G is substituted by C _iso C is substituted; and/or

G in the full-length sequence of the second single-stranded DNA _iso G is substituted by C _iso C is substituted; and/or

G in the full-length sequence of the third single-stranded DNA _iso G is substituted by C _iso C is substituted;

wherein the said _iso The structural formula of G is:

the said _iso The structural formula of C is:

_iso g and G _iso The bonding mode of C is as follows:

representing ribose.

2. The combination of reagents for detecting an antibody of interest according to claim 1, wherein the donor fluorophore and the acceptor fluorophore are on the same side of the neck ring structure.

3. The combination of reagents for detecting an antibody of interest according to claim 1, wherein the first protein antigen is identical to the second protein antigen, and the first epitope is identical to the second epitope.

4. The reagent combination for detecting an antibody of interest according to claim 1, wherein the quantum dot is a core-shell structure quantum dot, the core layer material of which is selected from one or more of CdSe, cdS, cdTe, cdSeTe, cdZnS, znTe, cdSeS, pbS and PbTe, and the shell layer material of which is selected from one or more of ZnS, znSe, znSeS, pbS and PbSeS; and/or

The particle size range of the quantum dots is 3nm to 5nm; and/or

The maximum absorption wavelength of the quantum dot is 470nm, and the maximum emission wavelength is 605nm; and/or

The maximum emission wavelength of the acridinium ester is 430nm.

5. The combination of reagents for detecting an antibody of interest according to claim 1, wherein the sugar ring at the 3' end of the first single-stranded DNA is covalently linked to the amino group of the first protein antigen by a first coupling agent; and/or

The 3 'end of the second single-stranded DNA is linked to the acceptor fluorophore, and the sugar ring of the 5' end thereof is covalently linked to the amino group of the second protein antigen through a second coupling agent; and/or

The sugar ring at the 5' end of the third single-stranded DNA is covalently linked to the donor fluorophore.

6. The combination of reagents for detecting an antibody of interest according to claim 5, wherein the sugar ring at the 3' end of the second single-stranded DNA is modified with a thiol group, the surface of the acceptor fluorophore is modified with an amino group, and the thiol group is covalently linked to the amino group on the surface of the acceptor fluorophore via a third coupling agent; and/or

The first coupling agent is bissuccinimidyl suberate sodium salt; and/or

The second coupling agent is bissuccinimidyl suberate sodium salt; and/or

The third coupling agent is 4- (N-maleimidomethyl) cyclohexane-1-carboxylic acid succinimidyl ester.

7. The combination of reagents for detecting an antibody of interest according to claim 1, wherein in the first single-stranded DNA, the first DNA sequence is located upstream of the second DNA sequence in order from the 5 'end to the 3' end; and/or

The third DNA sequence is located upstream of the fourth DNA sequence in the order from the 5 'end to the 3' end in the second single-stranded DNA; and/or

In the third single-stranded DNA, the fifth DNA sequence is located upstream of the sixth DNA sequence in order from the 5 'end to the 3' end; and/or

The first single-stranded DNA has 55 nucleotides, the first DNA sequence covers the 3 rd to 10 th base sites of the first single-stranded DNA from the 5 'end, and the second DNA sequence covers the 13 th to 19 th base sites of the first single-stranded DNA from the 5' end; and/or

The second single-stranded DNA has 53 nucleotides, the third DNA sequence covers 37 to 43 base sites of the second single-stranded DNA from the 5 'end, and the fourth DNA sequence covers 44 to 51 base sites of the second single-stranded DNA from the 5' end; and/or

The third single-stranded DNA has 22 nucleotides, the fifth DNA sequence covers the 3 rd to 10 th base sites of the third single-stranded DNA from the 5 'end, and the sixth DNA sequence covers the 11 th to 18 th base sites of the third single-stranded DNA from the 5' end.

8. The combination of reagents for detecting an antibody of interest according to claim 1, wherein the first DNA sequence is GCTGAGTT from 5 'end to 3' end and the sixth DNA sequence is AACTCAGC from 5 'end to 3' end; and/or

The second DNA sequence is CAACGAC from the 5 'end to the 3' end, and the third DNA sequence is GTCGTTG from the 5 'end to the 3' end; and/or

The fourth DNA sequence is GCTGAGAT from the 5 'end to the 3' end, and the fifth DNA sequence is ATCTCAGC from the 5 'end to the 3' end; and/or

The full-length sequence of the first single-stranded DNA is shown as SEQ ID No:1 is shown in the specification; and/or

The full-length sequence of the second single-stranded DNA is shown as SEQ ID No:2 is shown in the figure; and/or

The full-length sequence of the third single-stranded DNA is shown as SEQ ID No: 3.

9. The combination of reagents for detecting an antibody of interest according to claim 1, wherein the antioxidant is selected from any one or more of cannabidiol, vitamin C, vitamin E, tea polyphenols, glutathione; and/or

The oxidizing agent comprises an alkaline solution of hydrogen peroxide.

10. The combination of reagents for detecting an antibody of interest according to claim 9, wherein the carrier molecule is graphene oxide; the carboxyl on the graphene oxide is combined with the hydroxyl on the antioxidant through an oxidation sulfoxide condensing agent, and the carboxyl on the graphene oxide is combined with the amino on the antioxidant through 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride.

11. A method for detecting an antibody of interest using the reagent combination of claim 1, comprising the steps of:

adding a first reagent, a second reagent, a third reagent and a fourth reagent into the solution to be detected, and mixing to form a sample to be detected; the first reagent is formed by coupling a first single-stranded DNA and a first protein antigen, the second reagent is formed by coupling a second protein antigen, a second single-stranded DNA and an acceptor fluorescent group in sequence, and the third reagent is formed by coupling a donor fluorescent group and a third single-stranded DNA; under the condition that the solution to be detected contains a target antibody, the target antibody forms an antibody-antigen complex with the first protein antigen and the second protein antigen, the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA form a neck ring structure, and the donor fluorescent group and the acceptor fluorescent group are positioned on the same side of the neck ring structure;

removing the fourth reagent for inhibiting oxidation of the donor fluorophore from the sample to be measured, adding an oxidizing agent for oxidizing the donor fluorophore to emit first fluorescence and collecting second fluorescence at the maximum emission wavelength of the acceptor fluorophore;

Under the condition that the second fluorescence is not collected, judging that the target antibody is not contained in the solution to be detected; and under the condition that the second fluorescence is collected, obtaining the content of the target antibody in the solution to be detected according to the intensity of the second fluorescence based on a one-to-one correspondence formula of the fluorescence intensity and the antibody content.

12. The method for detecting an antibody of interest according to claim 11, wherein the working concentration of the first reagent in the sample to be detected is 1nM to 20nM; and/or

The working concentration of the second reagent in the sample to be detected is 1nM to 20nM; and/or

The working concentration of the third reagent in the sample to be detected is 0.05nM to 0.2nM; and/or

In the sample to be detected, the working concentration of the fourth reagent is 15 mu g/ml to 25 mu g/ml; and/or

The solution to be tested is from a whole blood sample, a serum sample or a plasma sample; and/or

The mixing time is 5 minutes to 10 minutes; and/or

The temperature of the mixing is 36 ℃ to 37 ℃; and/or

The volume of the oxidant is 200 mu L, and the oxidant is alkaline hydrogen peroxide solution; and/or

The target antibody comprises hepatitis B surface antibody, hepatitis C surface antibody, or cytomegalovirus IgG.

13. An antibody detection kit of interest comprising the combination of reagents of claim 1, comprising:

a first tube storing a conjugate of a first single-stranded DNA and a first protein antigen;

a second tube storing a conjugate of a second protein antigen, a second single-stranded DNA, and a receptor fluorophore; the first protein antigen and the second protein antigen can form an antibody-antigen complex with the target antibody in the presence of the target antibody;

a third tube storing a conjugate of the donor fluorophore and a third single stranded DNA; the first single-stranded DNA, the second single-stranded DNA and the third single-stranded DNA can form a neck ring structure under the condition that the antibody antigen complex is formed, and the donor fluorescent group and the acceptor fluorescent group excite the acceptor fluorescent group to emit second fluorescence when positioned on the same side of the neck ring structure so as to obtain the content of the target antibody according to the intensity of the second fluorescence;

a fourth tube storing an antioxidant capable of inhibiting oxidation of the donor fluorophore; and

and a fifth tube storing an oxidizing agent capable of oxidizing the donor fluorescent group to emit a first fluorescence.

14. The target antibody detection kit of claim 13, wherein the donor fluorophore is an acridinium ester; and/or the acceptor fluorophore is a quantum dot.

15. An antibody detection system of interest comprising the combination of reagents of claim 1, comprising:

a reaction vessel having a receiving chamber capable of receiving a solution to be measured;

a microinjection pump which is communicated with the accommodating chamber through an injection pipeline and injects a mixture of a first reagent, a second reagent, a third reagent and a fourth reagent into the accommodating chamber through the injection pipeline; the first reagent is formed by coupling a first single-stranded DNA and a first protein antigen, the second reagent is formed by coupling a second protein antigen, a second single-stranded DNA and an acceptor fluorescent group in sequence, the third reagent is formed by coupling a donor fluorescent group and a third single-stranded DNA, and the fourth reagent contains an antioxidant for inhibiting the donor fluorescent group from being oxidized to emit first fluorescence;

the optical filter is arranged on an emergent light path of the first fluorescence and allows the second fluorescence emitted by the acceptor fluorescent group to pass through;

the optical signal detection module is arranged on an emergent light path of the first fluorescence and positioned at the downstream side of the optical filter, and acquires the second fluorescence transmitted from the optical filter; and the calculation module is used for converting the second fluorescence into a digital signal and obtaining the content of the target antibody in the solution to be detected according to a one-to-one correspondence relation between the fluorescence intensity and the antibody content.