CN115060902A - cGAS methylation modification as tumor diagnosis and prognosis analysis marker, and detection reagent and application thereof - Google Patents

Abstract

The invention discloses cGAS methylation modification serving as a tumor diagnosis and prognosis analysis marker, in particular human-derived cGASK362 or mouse-derived cGAS K350 methylation modification, and also discloses a detection reagent and application of the cGAS methylation modification. The methylation modification of the human-derived cGAS K362 and the mouse-derived cGAS K350 can be used as tumor diagnosis and prognosis analysis markers, and especially plays an important role in immune escape of colorectal cancer and melanoma; the invention also prepares an antibody which specifically recognizes the cGAS methylation modification. The expression level of cGAS methylation modification in tumor tissues is obviously higher than that of normal tissues through verification, and the cGAS methylation modification is obviously negatively related to the prognosis of tumor patients; inhibition of cGAS methylation modification in combination with immune checkpoint inhibitors in combination with treatment suppressed the development of tumors. The cGAS methylation modification can be used as a marker for tumor diagnosis and prognosis analysis, can clearly and clearly represent tumor immune escape and poor prognosis, and provides an important reference basis for clinical diagnosis and treatment schemes.

Description

cGAS methylation modification as tumor diagnosis and prognosis analysis marker, and detection reagent and application thereof

Technical Field

The invention relates to the technical field of tumor markers, in particular to cGAS methylation modification serving as a tumor diagnosis and prognosis analysis marker, a detection reagent and application thereof, and specifically, the cGAS methylation modification comprises human-derived cGAS K362 methylation modification and mouse-derived cGAS K350 methylation modification.

Background

Tumors are serious diseases and threaten human life and health seriously. With the rise of immune checkpoint mab therapy and CAR-T cell therapy, tumor immunotherapy has achieved tremendous success. Current immune checkpoint molecules that are under intensive clinical research include: cytotoxic T lymphocyte-associated antigen 4(CTLA-4), programmed death receptor 1(PD-1) and its ligand (PD-L1). And the antibodies of the immune checkpoint blocking agents PD-1 and PD-L1 are used for blocking the PD-1/PD-L signal channel, so that the clinical test shows good curative effect, and the antibody becomes a standard treatment method for various malignant tumors including blood tumors and solid tumors including non-small cell lung cancer and the like. However, although immune checkpoint mab therapy has enjoyed promising success in clinical anti-tumor applications, there are still large differences in response rates among different tumors. At present, the objective remission rate of the known PD-1 antibody in Hodgkin lymphoma can reach 66% -95%, while in tumors such as malignant melanoma and the like, the rate is only 10% -30%, and partial patients may have disease hyper-progression after receiving monoclonal antibody treatment. Therefore, in clinical application, a biomarker with high sensitivity and high specificity and a new tumor immunotherapy target are searched, and the method has important clinical value for tumor therapy.

The cGAS-STING-TBK1 signaling pathway plays an important role in the recognition of cytoplasmic DNA and initiation of type I interferon responses mediated antitumor in the body. During chemoradiotherapy, the DNA recognition receptor of dendritic cells (DC cells) -cyclic GMP-AMP synthase (cGAS) -recognizes DNA fragments after tumor cell death, catalyzing the production of 2',3' -cyclic GMP-AMP (cgamp). The second messenger, cGAMP, activates the signaling pathway downstream of STING-TBK1 and interferon regulatory factor 3(IRF 3). Thereafter, phosphorylated IRF3 translocates into the nucleus, promoting type I interferon production and antigen presentation, enhancing the ability of T cells to activate and kill tumor cells. Therefore, the interferon signal regulation initiated by the cGAS-STING-TBK1 pathway is deeply researched, the influence of the interferon signal regulation on the specific infiltration and infiltration degree of immune cells in tumor tissues is analyzed, and the method has important guiding significance on antitumor immunotherapy.

However, in the prior art, the mechanism of the cGAS methylation modification affecting cGAS activity is rarely reported, and the application of cGAS methylation modification in antitumor immunotherapy and tumor prognosis analysis is not reported.

Disclosure of Invention

In order to overcome at least one problem existing in the prior art, the method is based on the following steps: the cGAS-mediated DNA induction signal channel promotes the generation of type I interferon, promotes antigen presentation, enhances the activation of T cells, plays an important role in antitumor immunity, inhibits the activity of cGAS to cause tumor immunity escape, and reduces the treatment sensitivity of an immune checkpoint blocking agent; the invention provides a tumor marker for simultaneously characterizing tumor diagnosis and patient prognosis analysis, in particular to clearly characterizing tumor immune escape and poor prognosis, and obtaining a modified antibody for a specific detection marker, thereby forming a detection method with good development prospect and providing an important reference basis for clinical diagnosis and treatment schemes.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided a marker for use in a tumour diagnostic and/or prognostic assay, said marker being a cGAS methylation modification.

Further, the cGAS methylation modification is a human-derived cGAS K362 methylation modification or a murine-derived cGAS K350 methylation modification.

Further, the methylation modification is a monomethylation modification.

Further, the tumors include hematological tumors, solid tumors and the like, such as intestinal cancers and melanomas; in particular, colorectal carcinoma and melanoma; more specifically colorectal cancer.

In a specific embodiment, the cGAS methylation modification (specifically cGAS K362 methylation modification) is significantly highly expressed in colorectal cancer tissues, and is significantly negatively correlated with prognosis of tumor patients.

A second aspect of the invention provides the use of a marker for tumour diagnosis and/or prognosis as defined in any one of the first aspects of the invention, said use being selected from at least one of the following uses: the application in preparing a detection reagent or a kit of the marker, the application as a tumor drug action target, the application in screening or preparing drugs for treating tumors and/or improving tumor patient prognosis, the application in evaluating tumor prognosis, the application in characterizing tumor immune escape and the application in preparing a tumor treatment scheme.

In a third aspect, the present invention provides a medicament for treating tumors and/or improving the prognosis of tumor patients, comprising a cGAS methylation inhibitor. The inhibitor can be any suitable inhibitor in the art that inhibits the level of methylation modification.

Further, the cGAS methylation inhibitor is an inhibitor for inhibiting a human-derived cGAS K362 methylation modification level or for inhibiting a murine-derived cGAS K350 methylation modification level.

Further, the cGAS methylation inhibitor is Chaetocin.

Further, the medicament for treating a tumor and/or improving the prognosis of a patient with a tumor further comprises an immune checkpoint blocker. The immune checkpoint blocking agent may be any suitable agent in the art, such as a CTLA-4 antibody, a PD-1 antibody, a PD-L1 antibody, and the like.

Further, the immune checkpoint blockade agent is a PD-1 antibody.

In a specific embodiment, the above-described cGAS methylation inhibitor inhibits the murine cGAS K350 methylation modification level, promotes cGAS response to the DNA-sensing signaling pathway, and in combination with immune checkpoint blockade therapy suppresses the development of melanoma and colorectal cancer, significantly inhibiting tumor growth.

A fourth aspect of the present invention is a detection reagent for a marker for tumor diagnosis and/or prognosis analysis, according to any one of the first aspects of the present invention, which comprises a reagent for specifically recognizing cGAS methylation modification in tumor tissues and tumor cells.

Further, the reagent is an antibody specifically recognizing human-derived cGAS K362 methylation modification or an antibody specifically recognizing murine-derived cGAS K350 methylation modification.

Further, the method for producing the antibody comprises: the antigen polypeptide is coupled with carrier protein keyhole limpet hemocyanin to form antigen and immunize host animals, and the specific recognition antibody is obtained by a specific affinity purification method. The antigen polypeptide is a polypeptide sequence based on cGAS methylation modification sites, and the operation methods of all steps in the antibody preparation method can adopt the conventional technical means in the field.

Further, the antibody is a polyclonal antibody.

Further, the antigenic polypeptides of the human cGAS K362 methylation modified antibody are: CQLRLKPFYLVPK(me) HAKE (SEQ ID NO. 1); the antigen polypeptide of the murine cGAS K350 methylation modified antibody is CTNLRREPFYLVPK(me) NAKD (SEQ ID NO. 2).

Furthermore, the detection reagent is a kit containing an antibody specifically recognizing human-derived cGAS K362 methylation modification or an antibody specifically recognizing murine-derived cGAS K350 methylation modification.

In a fifth aspect, the invention provides a use of the detection reagent of any one of the fourth aspect, wherein the use is selected from one of the following uses: application in preparing a kit for detecting tumors, application in preparing a tumor prognosis analysis kit, application in preparing a tumor immunotherapy scheme kit/application in determining a tumor immunotherapy scheme, and application in evaluating a tumor immune escape mechanism by cGAS methylation (application in verifying that cGAS methylation promotes colorectal cancer immune escape). The tumors comprise: colorectal carcinoma and melanoma.

In a sixth aspect of the present invention, there is provided a method for detecting a cGAS methylation modification level in a cell for a non-diagnostic purpose, wherein a detection reagent according to any one of the fourth aspects of the present invention is mixed with a test sample to perform detection of cGAS methylation-modified water.

Compared with the prior art, the invention has the following beneficial effects by adopting the technical scheme:

the invention researches the influence mechanism of cGAS methylation modification on the activity of the cGAS methylation modification, and firstly provides that the cGAS methylation modification (particularly human-derived cGAS K362 methylation modification or mouse-derived cGAS K350 methylation modification) can be used as a marker for tumor diagnosis and prognosis analysis, particularly clearly represents tumor immune escape and poor prognosis, and provides an important reference basis for clinical diagnosis and treatment schemes.

The invention discovers that the site of cGAS subjected to monomethylation modification is at K362 of human origin and K350 of mouse origin, and prepares methylation modified antibodies of K362 of human origin and K350 of mouse origin. Experiments prove that the cGAS K362 methylation modification has specific high expression in colorectal cancer tissues, but does not have the specific high expression phenomenon in normal tissues, and the K362 methylation modification is obviously and negatively correlated with the prognosis of a tumor patient, so that the cGAS K362 methylation can be used as a marker for tumor diagnosis and prognosis analysis. In addition, experimental verification shows that in a mouse tumor model, tumor growth can be obviously inhibited by inhibiting cGAS methylation modification and combining with immune checkpoint blocker treatment, so that cGAS methylation can clearly represent tumor immune escape and poor prognosis, and an important reference basis is provided for clinical diagnosis and treatment schemes.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention without limiting the invention. In the drawings:

FIG. 1 is a schematic diagram of mass spectrometry results after co-immunoprecipitation of cGAS in one embodiment of the invention;

FIG. 2 is a diagram illustrating the results of the conservative analysis of cGAS methylation modification sites in different species according to an embodiment of the present invention;

FIG. 3 is a diagram showing the results of specific detection of cGAS human K362 and murine K350 methylation modified antibodies in one embodiment of the present invention;

FIG. 4 is a graph showing the results of an analysis of the correlation between the expression of cGAS K362 methylation modification in tumor tissue and the prognosis of a patient with a tumor according to an embodiment of the present invention;

figure 5 is a graphical representation of the results of inhibition of cGAS methylation modification in combination with immune checkpoint blocker treatment on tumor growth in mice in one embodiment of the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. The experimental methods without specifying specific conditions in the following examples were generally determined according to national standards. The experimental materials not shown in the following examples are all commercially available materials. The equipment used in the steps in the following examples is conventional. If there is no corresponding national standard, it is carried out according to the usual international standards, to the conventional conditions or to the conditions recommended by the manufacturer. Unless otherwise indicated, all parts are parts by weight and all percentages are percentages by mass. Unless defined or indicated otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention.

It should be noted that the embodiments and features of the embodiments may be combined with each other without conflict. The invention is further described with reference to the following drawings and specific examples, which are not intended to be limiting.

Sources of experimental materials used in the following examples: Anti-pSTING (Ser366) (E9A9K), Anti-pSTING (Ser365) (8F4W), Anti-pTBK1/NAK (Ser172) (D52C2), Anti-pSTING (Ser365) (D8F4W), Anti-human cGAS (D1D3G) Rabbit mAb, Anti-mouse cGAS (D3O8O), Anti-STING (D2P2F), Anti-TBK1(D1B4) from CST antibody, Anti-FLAG (20543-1-AP), Anti-MYC (16286-1-AP), HA (51064-2-AP) from Proteiech antibody, Anti-HA-tag antibody beads (M20013L) and Anti-tag antibody beads (M200 20012M) from MY antibody. Anti-FLAG-tag mouse Anti-soil photos (A2220) from Sigma.

Example 1 Mass Spectrometry identification of the sites of methylation modification by cGAS

In this embodiment, a mass spectrometry method is used to determine cGAS methylation modification sites, and the implementation method and steps include:

cGAS overexpressed in co-immunoprecipitated 293T cells was used. The method comprises the following specific steps: 1. transfecting FLAG-cGAS plasmid 5ug in 10cm dish, and collecting cell sediment after transfecting for 48 hours; 2. the cells were lysed with a cell lysis buffer (20mM HEPES (pH 7.8), 400mM KCl, 5% Glycerol, 5mM EDTA, 0.4% NP40, phosphatase and protease inhibitors (phosphatase and protease inhibitors)), and after centrifugation at 12000rpm for 25 minutes at four high speed, the supernatant was collected; 3. co-immunoprecipitated FLAG-cGAS was immunoprecipitated with M2 beads, incubated for 4 hours at four degrees, washed three times with cell lysate and three times with PBS. The mass spectrum identification result of the human-derived cGAS is shown in figure 1 by the direct mass spectrum analysis (LC-MS/MS, red represents b ions and blue represents y ions) of the co-immunoprecipitated sample.

The results in FIG. 1 show the sites of methylation modification of cGAS and show the signal peak of methylation modification, with monomethylation modification occurring at lysine (K) at position 362 of human cGAS (i.e., cGAS 362K methylation modification).

The sequence of the cGAS K362 site in different species was also analyzed in this example. The specific analysis method comprises the following steps: the conservation of the human-derived cGAS K362 locus in different species is analyzed by an NCBI-BLAST online database, and K362 is found to be very conserved in mammals such as human, monkey, mouse and rabbit. The results of the above sequence analysis are shown in FIG. 2, which shows that the K362 site is well conserved in mammals and the site of monomethylation modification in murine cGAS is located at the K350 site (i.e., cGAS 350K methylation modification).

Example 2 preparation of cGAS methylation-modified antibody and verification of specificity and potency thereof

This example performs the preparation of antibodies modified by human K362 and modified by murine K350 methylation and their specificity and potency verification based on cGAS 362K methylation and cGAS 350K methylation identified in example 1.

(1) Preparation of cGAS methylation modified antibody

The antigen polypeptide sequences of the K362 methylation modified antibody are respectively shown as follows:

K362-monomethylated peptide(K362-me)：CQLRLKPFYLVPK(me)HAKE。

the antigen polypeptide sequence of the K350 methylation modified antibody is shown as follows:

K350-monomethylated peptide(K350-me)：CTNLRREPFYLVPK(me)NAKD。

in this example, rabbit polyclonal antibody preparation was performed by the following steps: new Zealand white rabbit is used as host, and the antigen polypeptide and carrier protein Keyhole Limpet Hemocyanin (KLH) are synthesized and coupled to form antigen immune host animal. The antibody serum adopts a specific affinity purification method to obtain an antibody which specifically recognizes the methylation modification of the human K362 or the methylation modification of the mouse K350.

(2) Specificity and potency verification of cGAS methylation modified antibody

In this example, the specificity and potency of the cGAS methylation-modified antibody obtained were measured from Dot blot, Western blot and immunohistochemical levels, respectively. The Dot blot method is to fix the polypeptide on an acetate fiber membrane and then detect the specificity of the cGAS methylated antibody by an immunoblotting method. The Western blot detection method comprises the following steps: 1. detecting the specificity of the cGAS methylated antibody for recognizing endogenous cGAS by using cGAS endogenous knockout cell lysate; 2. the specificity of the recognition site of cGAS methylated antibodies was tested using a methylation site mutant (K mutated to R, lacking methylation modification ability). Immunohistochemistry methods were used to test the effect of cGAS methylation antibodies for tissue level detection. The results of the above detection are shown in FIG. 3.

In the above detection method, the cGAS gene knockout cell line is constructed by the following method: 1. the cGAS gene knockout cell line is obtained by a CRISPR-Cas9 gene knockout technology, 1 sgRNA is selected by adopting a B16F10 cell line, the specific sequence is TCTCGTACCCAAGAATGCAA, the sgRNAs are constructed on a GFP-458 vector, the sgRNAs are transfected into target cells through plasmids, positive cells expressed by GFP are plated into a 96-well plate through flow sorting, one cell is arranged in each well, the cGAS gene knockout efficiency is detected by a Western blot method after the cells grow to be monoclonal, and the cGAS gene knockout cell line is obtained. 2. The stability of cGAS mRNA was interfered with by transfecting cGAS siRNA in HT-29 cells using conventional siRNA interference techniques, resulting in a decrease in cGAS expression levels.

The construction method of the human K362R mutant and the mouse K350R mutant comprises the following steps: the construction of subclones constructed by conventional mutants was carried out on pcDNA 3.1-HA-human cGAS and pcDNA 3.1-cmyc-mouse cGAS wild-type vectors. Given the very low cGAS expression in the HCT116 cell line, cGAS-low expressing tumor tissues were tumor tissues tumorigenic with HCT116 cells; cGAS high expression tumor tissue is used in clinical colorectal cancer patient samples.

As can be seen from section A of FIG. 3, the Dot blot method detects in vitro that the methylation modification of K362 only recognizes the methylation-modified polypeptide, but not the polypeptide antigen without the methylation modification. As can be seen from section B of FIG. 3, the Dot blot method detects that the methylation modification of K350 only recognizes the methylation-modified polypeptide, but not the polypeptide antigen without the methylation modification. As can be seen from fig. 3, part C and part D, cGAS gene knockdown cell lines and K362R mutant were selected to test the specificity of the K362 methylation-modified antibody, and as a result, they were found to recognize specifically human cGAS.

As can be seen from parts E and F of fig. 3, cGAS gene-knockdown cell lines and K350R mutant were selected to test the specificity of the K350 methylation-modified antibody, and as a result, they were found to specifically recognize murine cGAS. From the section G in fig. 3, it is found that the specificity of the K362 methylation-modified antibody was detected in cGAS low-expression and high-expression tumor tissues by immunohistochemistry, and as a result, it was found that the antibody specifically recognizes endogenous cGAS.

Example 3 analysis of the relevance of expression of cGAS K362 methylation modification in tumor tissue to prognosis of tumor patients

In the embodiment, expression levels of cGAS K362 methylation modification in tumor tissues and normal tissues are detected by using a Western blot and an immunohistochemical method, and the correlation between the levels of cGAS K362 methylation modification and the prognosis of colorectal cancer patients is analyzed. In this example, 320 cases of colon cancer tissue chips were used to detect the difference in the cGAS K362 methylation modification level between tumor tissue and normal tissue, and the detection results are shown in fig. 4.

The Western blot method comprises the following steps: 1. after the target cells were sufficiently lysed with a cell lysate (50mM Tris-HCl (pH 7-9), 300mM NaCl, 1% Triton X-100, supplemented with a protease inhibitor and phosphatase inhibitor cocktail), they were centrifuged at 12,000rpm at 4 ℃ for 25 minutes at high speed; 2. taking cell supernatant to perform downstream experiments, and performing SDS-PAGE electrophoresis after obtaining a sample; 3. the PAGE samples were transferred to PVDF membrane (Millipore) for subsequent immunoblotting experiments, and the primary antibody used was as shown in FIG. 4, part A.

Immunohistochemistry and expression level analysis method: 1. tissue specimens, including heart tissue pretreated by cardiac perfusion, fixed in 10% neutral buffered formalin overnight, then dehydrated in increasing concentrations of isopropanol, then alcohol-stripped with xylene; 2. the specimens were embedded in paraffin cassettes to facilitate tissue sectioning. Standard staining of 3 μm thick sections of each sample block with hematoxylin and eosin (H & E); 3. for immunohistochemistry, tissue sections were deparaffinized and incubated in citrate buffer at 95 ℃ for 40 minutes to recover antigen, then incubated overnight at 4 ℃ with primary antibodies including anti-cGAS K362me (1:100 dilution); 4. after three washes, the tissue sections were incubated with biotinylated anti-rabbit IgG (1:100 dilution) for 1 hour at RT, then washed three times, after which streptavidin-horseradish peroxidase conjugate was added and the slides were incubated for 45 minutes; 5. after three washes with PBS, DAB solution was added and the slides were counterstained with hematoxylin. Negative controls were treated in the same manner, but without the addition of primary antibody; 6. in the experiment, 320 colorectal cancer patients are researched by adopting a Tissue Microarray (TMA); 7. immunohistochemical staining was assessed by an independent pathologist. The staining range was scored 0-3, corresponding to the percentage of immunoreactive tumor cells (0% -10%, 11% -25%, 26% -75% and 76% -100%, respectively) and the staining intensity (negative, score 0; weak, score 1; strong, score 2; very strong, score 3). A score of 0-3 was calculated by multiplying the staining degree score by the intensity score, giving a low (0-1) level or high (2-3) level value for each sample.

Parts a and B of fig. 4 show that cGAS K362 methylation modification is expressed at significantly higher levels in tumor tissues than in normal tissues; part C of fig. 4 shows that cGAS K362 methylation modification is clearly negatively correlated with prognosis of tumor patients, indicating that the cGAS K362 methylation modification can be used as a tumor marker for colorectal cancer diagnosis and prognosis analysis.

Example 4 inhibition of cGAS methylation modification in combination with immune checkpoint blockade treatment on tumor growth in mice

This example investigates the effect of cGAS 350K methylation modification on cGAS activity, tumor immune escape, and its effect on tumor growth using a subcutaneous tumor-bearing model of colorectal and melanoma for detecting tumor growth status, treatment with the inhibitor Chaetocin (a specific inhibitor of Histone Methyltransferase (HMT) su (var) 3-9) for inhibiting cGAS methylation modification levels, and combination treatment with Chaetocin and PD-1 antibodies for comparison of tumor growth differences.

The experimental steps comprise: 1. 0.5 to 1 × 10 ⁶ B16F10 or 1X 10 ⁶ MC38 cells were injected subcutaneously with C57BL/6 of 7-8 weeks old, and tumor volume was calculated as tumor volume ═ length × width × width/2; 2. in tumor volume to 75mm ³ On the left and right, intervention treatment is given; 3. mice were injected intraperitoneally with DMSO (10%) in PBS or chaetocin (25mg/kg) once every three days for three treatment courses; 4. mice were injected intraperitoneally with anti-mouse-PD-1(BP0146, CD279) or rat IgG2a isotype mAbs (BP0089) (Bioxcell), 100. mu.g (MC38) or 200. mu.g (B16F10) per mouse, once every three days for three courses; 5. combination therapy, experimental groups were as in figure 5 part C and part D. Its detection nodeAs shown in fig. 5.

As can be seen from the parts a and B in fig. 5, cGAS methylation inhibits cGAS activity, and Chaetocin inhibits the methylation modification level of endogenous cGAS K350 in murine cell lines B16F10 and MC38, promotes cGAS response to DNA-induced signaling pathways, and promotes tumor immune escape. As can be seen from the sections C and D of fig. 5, the effect of the combination treatment of the inhibitor Chaetocin and the immune checkpoint blocking agent on tumor growth was examined using a mouse subcutaneous tumor-bearing model, and the results showed that the combination treatment of the inhibition of cGAS methylation (Chaetocin) and the immune checkpoint blocking agent (PD-1 antibody) significantly inhibited tumor growth.

From the above examples, the 362 th lysine of the human-derived cGAS monomethylation modification site and the 350 th lysine of the mouse-derived cGAS monomethylation modification site are obtained by mass spectrometry, and the K362 methylation modification specific antibody and the K350 methylation modification specific antibody are obtained by polyclonal antibody preparation. The cGAS K362 methylation modification is found to be obviously higher in expression level in tumor tissues than in normal tissues and obviously negatively correlated with the prognosis of tumor patients by detecting the cGAS methylation modification level in colorectal cancer tissues, and the cGAS methylation modification can be used as a tumor marker for tumor diagnosis and prognosis analysis. In addition, the invention detects the effect of inhibiting cGAS methylation on the combined treatment of tumors by immune checkpoint blockers through a subcutaneous mouse tumor-bearing model, finds that Chaetocin inhibits cGAS methylation and is combined with a PD-1 antibody to obviously inhibit the growth of mouse tumors, and provides an important reference basis for clinical diagnosis and treatment schemes.

While the invention has been described with reference to a preferred embodiment, it will be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention.

Sequence listing

<110> tenth people hospital in Shanghai City

<120> cGAS methylation modification serving as tumor diagnosis and prognosis analysis marker, and detection reagent and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 17

<212> PRT

<213> antigenic polypeptide of cGAS K362 methylation-modified antibody (Artificial Sequence)

<220>

<221> METHYLATION

<222> (13)..(13)

<400> 1

Cys Gln Leu Arg Leu Lys Pro Phe Tyr Leu Val Pro Lys His Ala Lys

1 5 10 15

Glu

<210> 2

<211> 18

<212> PRT

<213> antigenic polypeptide of cGAS K350 methylation-modified antibody (Artificial Sequence)

<220>

<221> METHYLATION

<222> (14)..(14)

<400> 2

Cys Thr Asn Leu Arg Arg Glu Pro Phe Tyr Leu Val Pro Lys Asn Ala

1 5 10 15

Lys Asp

Claims (10)

1. A marker for use in tumor diagnosis and/or prognosis analysis, wherein said marker is a human-derived cGAS K362 methylation modification or a murine-derived cGAS K350 methylation modification.

2. The marker for use in the diagnosis and/or prognosis of tumours according to claim 1, wherein said tumours comprise colorectal carcinoma and melanoma.

3. Use of a marker for tumor diagnosis and/or prognosis analysis according to claim 1 or 2, wherein said use is selected from at least one of the following uses: the application of the marker in preparing a detection reagent or a kit of the marker, the application of the marker as an action target of a tumor medicament, the application in screening or preparing medicaments for treating tumors and/or improving the prognosis of tumor patients, the application in evaluating the prognosis of tumors, the application in characterizing the immune escape of tumors and the application in preparing tumor treatment schemes.

4. The use according to claim 3, wherein the medicament for treating tumors and/or improving the prognosis of tumor patients comprises a cGAS methylation inhibitor; wherein, the cGAS methylation inhibitor is an inhibitor for inhibiting the methylation modification level of human-derived cGAS K362 or inhibiting the methylation modification level of murine-derived cGAS K350.

5. The use according to claim 4, wherein said cGAS methylation inhibitor is Chaetocin.

6. The use of claim 4 or 5, wherein the medicament for treating a tumor and/or improving the prognosis of a patient with a tumor further comprises an immune checkpoint blockade agent.

7. The use of claim 6, wherein the immune checkpoint blockade agent comprises a PD-1 antibody.

8. A detection reagent for a marker for tumor diagnosis and/or prognosis analysis according to claim 1 or 2, wherein the detection reagent comprises a reagent for specifically recognizing cGAS methylation modification in tumor tissue and tumor cells; wherein the reagent is an antibody specifically recognizing human-derived cGAS K362 methylation modification or an antibody specifically recognizing murine-derived cGAS K350 methylation modification.

9. The detection reagent according to claim 8, wherein the antibody is prepared by a method comprising: the antigen polypeptide is coupled with carrier protein keyhole limpet hemocyanin to form antigen and immunize host animals, and the specific recognition antibody is obtained by a specific affinity purification method.

10. The detection reagent according to claim 9, wherein the sequence of the antigen polypeptide of the human cGAS K362 methylation modified antibody is shown as SEQ ID No. 1; the sequence of the antigen polypeptide of the murine cGAS K350 methylation modified antibody is shown in SEQ ID NO. 2.

Images