CN115058541B

CN115058541B - Compositions, kits, methods and uses for detecting and typing a feline stomatitis pathogen

Info

Publication number: CN115058541B
Application number: CN202210692370.0A
Authority: CN
Inventors: 汤睿; 范文洲; 夏慧芝; 贾小梅; 毛君杰; 邱先锋; 罗莎; 戴立忠
Original assignee: Hunan Dashengchong Medical Biotechnology Co ltd
Current assignee: Hunan Dashengchong Medical Biotechnology Co ltd
Priority date: 2022-06-17
Filing date: 2022-06-17
Publication date: 2023-05-09
Anticipated expiration: 2042-06-17
Also published as: CN115058541A

Abstract

The invention belongs to the field of molecular biology detection; in particular, it relates to the detection of a feline stomatitis pathogen; and more particularly to a composition for detecting 4 feline stomatitis pathogens, including feline calicivirus, feline herpesvirus, feline leukemia virus, and feline aids virus. At the same time, kits comprising the compositions, uses of the compositions, and methods for detecting and typing a feline stomatitis pathogen are also provided. The composition for detecting and parting the cat stomatitis pathogens mainly utilizes a multiplex fluorescence PCR and melting curve analysis method to detect various pathogens such as cat calicivirus, cat herpesvirus, cat leukemia virus, cat AIDS virus and the like and internal standards in one tube, so that different pathogens can be treated differently, and the treatment and prevention are more effective.

Description

Compositions, kits, methods and uses for detecting and typing a feline stomatitis pathogen

Technical Field

The invention belongs to the field of molecular biology detection; in particular, it relates to the detection of a feline stomatitis pathogen; more specifically, it relates to the detection of feline calicivirus, feline herpesvirus, feline leukemia virus, and feline aids virus for a total of 4 feline stomatitis pathogens.

Background

With the development of social economy and the improvement of life quality of people, the pet industry in China is rapidly developed, and the health of pets is increasingly valued by pet owners and pet doctors. Cat stomatitis (feline stomatitis) is one of the most common diseases in clinic, and both the cat with the current wave and the cat with the family are ill in clinic, wherein the cat with the current wave is the most. Inflammatory ulcerative diseases of the mouth of cats (felitis) are inflammations occurring in the surface or deep tissues of the mucous membrane of the mouth of cats, which can be formed secondarily from primary or systemic diseases of the mouth, and the manifestations of the inflammation can be local or diffuse. The disease causes are complicated, and for example, stomatitis may occur due to various sharp foreign matters such as stimulation of bone chips, thorns, iron wires, steel needles, wood thorns, etc., damage of irregular teeth, ingestion of corrosive chemical toxins or lack of vitamins A, B, etc. In addition, infections like certain infectious diseases, such as feline tracheitis virus, feline calicivirus, are causative agents of ulcerative glossitis in cats. J.O. knowles et al, in 1989, suggested that cats had stomatitis with more severe clinical symptoms than any other animal, and that there was no effective means for treatment.

Feline Calicivirus (FCV), a caliciviridae, a genus of impetigo virus, is a single stranded RNA virus. FCV is a viral respiratory infectious disease in cats that is mainly manifested as canker sores, eye and nose secretions increase, salivation, conjunctivitis, photophobia, stomatitis, tracheitis, bronchitis, with biphasic fever. Is a frequently-occurring disease of cats, has high incidence rate, and can cause pneumonia, dyspnea and even death when infected by virulent strains. The main infectious sources are diseased cats and cats with poison, and the diseased cats can discharge a large amount of viruses along with secretions and excreta in the acute stage, so that the infected cats are directly infected. The cat with poison can become an asymptomatic pathogen carrier after treatment, but can expel poison for a long time after clinical rehabilitation, and is a dangerous infectious source. In recent years, in China, the United states, the United kingdom, and Italy, etc., malignant systemic diseases (FCV-associedvirus systems diseases) have been successively outbreaked in cats caused by FCV infection, which strain is called FCV-VSD strain, can infect adult cats and cause symptoms such as hyperthermia, edema, head and limb ulcers and jaundice, and exhibits a high mortality rate. FCV is an important pathogen that is prevalent in felines, not only in cats, but also wild felines such as tigers and lions.

Feline herpesvirus type I (Feline herpesvirus type, FHV-I), also known as feline rhinotracheitis virus, belongs to the herpesviridae, subfamily A herpesviruses, is a enveloped double-stranded DNA virus. FHV-I can cause acute and highly contagious upper respiratory infections in cats with morbidity up to 100%. Although most adult cats can recover after infection, the upper respiratory tract and eyes of the young cats are mainly affected, when the infection symptoms are serious, obvious upper respiratory tract infection symptoms such as depression, cough, sneeze and the like, eye symptoms such as purulent secretion, keratoconjunctivitis and the like appear, and severe infection can cause lobular pneumonia and periocular skin ulcers. The death rate of the kittens can reach 50%, and the kittens can carry poison for life and expel poison, can be vertically spread, and has great harm. The virus proliferates in the nose, throat, trachea and bronchi, tongue, conjunctiva, etc. of the sick cat. In addition, FHV-I can still be hidden in the parts such as trigeminal nerve, optic nerve and tonsil to cause life-long toxic, and can cause secondary infection when the immunity of the cat is low or a stress reaction occurs, thereby causing clinical symptoms such as chronic nasosinusitis, turbinate degeneration, dendritic keratitis and the like. The disease was first discovered from the united states, then discovered and prevalent in canada, the united kingdom, the netherlands, switzerland, hungary, vietnam, etc., and in our country suspicious cases have been discovered and isolated from viruses. However, in the national standard and local standard of experimental animals, the detection requirement and relevant regulations of experimental cats are not provided at present.

A retrovirus of the subfamily Magnomonas, subfamily C-type Oncoviridae, and mammalian subgenera C-type Oncoviridae, belonging to the genus Max leukemia virus (Feline leukemia virus, feLV) is a enveloped single-stranded RNA virus. FeLV has four subtypes of FeLV-A, feLV-B, feLV-C and FeLV-T. Type a is present in almost all FeLV infected cats and can lead to severe immunosuppression. Type B, present in about 50% felv infected cats, can cause tumors. Type C, present only in about 1% felv infected cats, can lead to severe anemia. Common disorders of feline leukemia are malignant lymphoma, myelogenous leukemia, degenerative thymus atrophy, non-regenerative anemia, etc., with malignant lymphoma being the most severe in cats. Feline leukemia virus (FeLV) is characterized by a life-long infection in cats, no obvious symptoms at early stages, persistent viremia with consequent difficulty in post-treatment, and ultimately fatal outcome. Accurately diagnosing the cat leukemia in early stage of the disease and timely giving treatment is the best choice for curing the cat leukemia. Continuously infected cats become a direct source of feline leukemia virus, and saliva, feces, urine, milk and nasal secretions all contain viruses and are transmitted to healthy cats through the respiratory tract and the digestive tract. Isolation of diagnosed diseased cats is an effective way to control feline leukemia virus. If the immune response does not occur after infection of the body, the virus may cause persistent viremia (40%) to become the carrier of the virus. Viremia usually occurs 2-4 weeks after FeLV infection, and about 50% of cats with persistent viremia die within 1 year after FeLV infection.

The feline immunodeficiency virus (Feline Immunodeficiency Virus, FIV) is a member of the group of retroviridae, lentivirus, feline lentivirus, mature FIV particles are round or oval in shape, 105nm to 125nm in size, and comprise mainly the envelope, capsid and core, and contain reverse transcriptase, with T lymphocyte activity and magnesium ion dependent reverse transcriptase activity in vitro. It is also called cat AIDS because it is very similar to human AIDS in etiology, clinical symptoms, pathogenesis and so on. FIV is mainly found in interstitial fluid such as blood, saliva and cerebrospinal fluid, and is often transmitted by licking or licking between the different species, and naturally infects more than 20 felines, and is widely found worldwide. The main occurrence among domestic cats is the wandering cat, so the wandering cat is defined as a highly dangerous group, the infection rate increases with age, and in proportion to the density of the wandering cat, the incidence rate of domestic cats is generally 3% (North America) to 40% (Japan), and the infection rate of non-domestic cats in some areas reaches 100%. Meanwhile, the FIV has long incubation period, and the period from infection to clinical symptoms is about 3-10 years. Since there is currently no FIV vaccine effective in protecting wild felines, it is only possible to use early diagnosis and disruption of the transmission pathway as a primary precaution in practice.

The clinical symptoms of the several main diseases of cats are similar, all of which can show stomatitis symptoms, and often have mixed infection, which causes difficulty in diagnosis. Thus, there is a need in the art for a composition that can detect these several pathogens simultaneously so that targeted therapies can be administered, while being low cost and highly sensitive.

Disclosure of Invention

In view of this, the present invention provides, in a first aspect, a composition for detecting and typing a cat stomatitis pathogen, the composition comprising:

an FHV-I upstream primer shown as SEQ ID NO. 1, an FHV-I downstream primer shown as SEQ ID NO. 2, and an FHV-I probe shown as SEQ ID NO. 3;

an FCV upstream primer shown as SEQ ID NO. 4, an FCV downstream primer shown as SEQ ID NO. 5, and an FCV probe shown as SEQ ID NO. 6;

an FeLV upstream primer shown as SEQ ID NO. 7, an FeLV downstream primer shown as SEQ ID NO. 8, and an FeLV probe shown as SEQ ID NO. 9;

an FIV upstream primer as shown in SEQ ID NO. 10, an FIV downstream primer as shown in SEQ ID NO. 11, and an FIV probe as shown in SEQ ID NO. 12.

Further, the fluorophores of the probes within the composition are different from each other and do not interfere with each other.

As used herein, "distinct and non-interfering with each other" means that the fluorophores used for each probe in the composition are different and do not affect each other's detection, i.e., can be performed using different channels. For example FAM, HEX, ROX and CY5 can be used, which groups do not have close absorbance values and can select different channels so as not to interfere with each other.

In some specific embodiments, the compositions of the invention are used in fluorescent PCR.

In the present invention, the fluorescent reporter group may be selected from FAM, HEX, ROX, VIC, CY, 5-TAMRA, TET, CY and JOE, but is not limited thereto.

Further, the 3' end of the probe also has a quenching group, such as BHQ1, BHQ2, or MGB.

In a specific embodiment, the 3' end of the probe is BHQ1.

In a specific embodiment, the 3' end of the probe is an MGB.

Further, the amount of the primer in the composition is 0.02. Mu.M to 0.25. Mu.M; the amount of probe in the composition is 0.02. Mu.M to 0.25. Mu.M.

Further, the composition also comprises an internal standard upstream primer shown as SEQ ID NO. 13 and an internal standard downstream primer shown as SEQ ID NO. 14.

The composition for detecting and parting the cat stomatitis pathogens mainly utilizes a multiplex fluorescence PCR and melting curve analysis method to detect various pathogens such as cat calicivirus, cat herpesvirus, cat leukemia virus, cat AIDS virus and the like and internal standards in one tube, so that different pathogens can be treated differently, and the treatment and prevention are more effective. The composition of the invention, combined with a fluorescent probe melting curve method, has low cost and high flux. And the operation is simple, and the result reading process can be judged through the Ct value and the melting peak Tm value.

Further, in some embodiments, the compositions of the invention may include one or more of the above-described primers and probes. In the present invention, "pair" refers to the detection of a target of the matching upstream and downstream primers and probes, or the matching upstream and downstream primers.

In a particular embodiment, the ingredients of the composition of the invention are present in separate packages.

Further, the components of the composition of the present invention are present in a mixed form.

In a second aspect, the invention provides the use of a composition of the invention as described above in the preparation of a kit for detecting and typing a cat stomatitis pathogen.

In a third aspect, the invention provides a kit for detecting and typing a feline stomatitis pathogen, the kit comprising a composition of the invention as described above.

Further, the kit also comprises a negative quality control and a positive quality control.

Further, the kit also comprises dNTP, PCR buffer solution and Mg ²⁺ At least one of them.

Still further, the kit further comprises: at least one of a nucleic acid releasing agent, a nucleic acid extracting reagent, uracil glycosylase and a DNA polymerase.

Further, the kit further comprises a nucleic acid releasing reagent, a nucleic acid extracting reagent, dNTPs, uracil glycosylase, a DNA polymerase, a PCR buffer solution and Mg ²⁺ At least one of them.

Further, the concentration of the DNA polymerase is 3U/reaction to 15U/reaction, for example, the DNA polymerase may be Taq enzyme.

In a specific embodiment, the kit of the invention comprises: taq enzyme, uracil glycosylase, mg ²⁺ 、Mn ² ⁺ Rnasin, dNTPs, primers, probes and PCR buffer.

Common PCR buffer consists of Tris-HCl and MgCl ₂ Buffer systems such as KCl and Triton X-100. The total volume in a single PCR reaction tube is typically 20. Mu.L to 100. Mu.L.

In a specific embodiment, the kit of the invention is compatible with digital PCR amplification systems, i.e., can be used directly on a digital PCR instrument for amplification.

In a fourth aspect, there is provided a method for detecting and typing a cat stomatitis pathogen, the method comprising the steps of:

1) Extracting or releasing nucleic acid of a sample to be tested;

2) Performing a fluorescent quantitative PCR analysis on the nucleic acid obtained in step 1) using the composition of the invention as described above or the kit of the invention as described above;

3) The results were obtained and analyzed.

In the present invention, the sample for detection may be pharynx, nose, eye swab/EDTA anticoagulated whole blood (serum) or the like, but is not limited thereto.

Further, the reaction conditions of the fluorescent quantitative PCR are as follows:

reverse transcription is carried out at 50-60 ℃ for 5-15 minutes for 1 cycle; activating Taq enzyme at 95 deg.c for 1-10 min for 1 cycle; denaturation at 95℃for 5-20 seconds, annealing at 55-60℃and more preferably 60℃for 20-60 seconds and more preferably 25s, 40-50 cycles, melting curve analysis, 62-75℃for one cycle.

In a specific embodiment, a method for detecting and typing a feline stomatitis pathogen for non-diagnostic purposes is provided, the method comprising the steps of:

1) Extracting or releasing nucleic acid of a sample to be tested;

3) The results were obtained and analyzed.

Drawings

FIG. 1 shows the detection results (fluorescence channel) of the composition of the present invention;

FIG. 2 shows the results (melting curve) of the compositions of the present invention;

FIGS. 3-6 show the sensitivity test results (FAM, HEX, ROX, CY channels, respectively) of the compositions of the present invention;

FIGS. 7 to 9 show the results of specific detection of the compositions of the present invention;

FIGS. 10 to 18 show the results of the comparative example composition of the present invention;

FIGS. 19-20 show the results of different condition detection (FAM channel) for compositions of the present invention.

Detailed Description

The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention.

Example 1, primers and probes used in the present invention

TABLE 1

Name of the name	Sequence(s)	Numbering device
			FHV-I-F	CCGACGTGACCCTAATCATAGA	SEQ.ID NO 01
FHV-I-R	CAGGAGGTTCTCGTGGAAGTGTT	SEQ.ID NO 02
			FHV-I-P	TCTCTGGTCTGTTTCCCACTCGCAAGATA	SEQ.ID NO 03
FCV-F	TTGTCAATGACAGTGTTAGGTTGG	SEQ.ID NO 04
			FCV-R	CGACGAAGAGCCCAGGCC	SEQ.ID NO 05
FCV-P	AATCAGCATGTGGTAACCGTTAATTCGG	SEQ.ID NO 06
			FeLV-F	ATGTATGATTCCATTTAGTCCCCA	SEQ.ID NO 07
FeLV-R	GGTAATTTTCCATGCCTTGTGAA	SEQ.ID NO 08
			FeLV-P	CCTACCCCAAAAACCTAGCCAGCTATT	SEQ.ID NO 09
FIV-F	ATTACTATTATGGTGGGGATTTGA	SEQ.ID NO				10
			FIV-R	TTGTTTTTGCTGTATTGACCATG	SEQ.ID NO		11
FIV-P	ACCCCGGAAGACAAATTACAAGAAGAAC	SEQ.ID NO 12
			IC-F	TAATTGAAATTGCACCCATATCGG	SEQ.ID NO 13
IC-R	CCACTTAAATCCTAAAGTTCCAGA	SEQ.ID NO 14

Wherein the fluorescent group of the FHV-I probe is FAM; the fluorophore of the FCV probe is HEX; the fluorescent group of the FeLV probe is ROX; the fluorophore of the FIV probe is CY5. The fluorophore of the internal standard downstream primer is FAM.

Example 2 method of detecting a cat stomatitis pathogen

The invention detects that the sample is throat, nose, eye swab/EDTA anticoagulated whole blood (serum), extract DNA with this company's magnetic bead method, carry on the following operation in the sample treatment room:

extracting by a magnetic bead method:

1. measuring a plurality of pre-mixed solutions 1 according to the number of samples to be measured, and adding 200 mu L of samples into each tube;

2. adding 40 mu L of pre-mixed solution 2, covering a tube cover, shaking and uniformly mixing for 30s, and heating at 60 ℃ for 4min;

3. low-speed instantaneous centrifugation, placing the centrifuge tube on a 4-hole magnetic separator, and slowly absorbing and discarding waste liquid after 2-3 min (note that the waste liquid does not touch magnetic beads adsorbed on the inner side of the tube wall); standing the centrifuge tube on the magnetic separator for 1-2 min, and completely removing waste liquid at the bottom of the tube again;

4. adding 100 mu L of pre-mixed solution 3, repeatedly blowing and uniformly mixing for 5-10 times, eluting magnetic beads on the wall of a centrifugal tube to the bottom of the tube, and standing for 2min at room temperature; the centrifuge tube was placed on a magnetic separator for 2min, and then the eluted nucleic acid was added to the appropriate amount of the kit amplification reagent (10. Mu.L of nucleic acid per amplification reaction was recommended).

The formula of the pre-mixed solution 1 comprises the following raw materials:

0.5-1.0% (W/V) SDS, 10-15% (V/V) formamide, 300-650 mmol/L NaCl, L, tris-Cl 20-100 mmol/L L, EDTA-2 mmol/L L, PMSF 0.8.8-1.2 mmol/L Tris-Cl with pH 7.0-8.0.

The formula of the pre-mixed solution 2 comprises the following raw materials:

proteinase K, 0.3% -1.0% (W/V) SDS, 100 mmol/L-150 mmol/L NaCl, 10 mmol/L-20 mmol/L L, tris-HCl, L, EDTA mmol/L-2 mmol/L, 10% -20% (V/V) silicone oil.

The formula of the pre-mixed solution 3 comprises the following raw materials:

0.05％～0.2％(W/V)SDS、NaHCO ₃ 20mmol/L～60mmol/L，Tris-HCl 10mmol/L～20mmol/L。

the detection kit provided by the invention further comprises the following real-time fluorescence PCR reaction system:

PCR amplification procedure

Analysis of results:

1) The detection signals of the target targets are FAM and HEX (or VIC), ROX and CY5 channels, and the detection signals of the internal standard are melting curves of FAM channels in the reaction liquid.

2) Setting of Baserine: baseline is generally set to 3-15 cycles, and can be specifically adjusted according to actual conditions; the adjustment principle is as follows: the region where the fluorescent signal was more stable before exponential amplification was selected.

The Start point (Start) bypasses signal fluctuations at the beginning of the fluorescent collection and the End point (End) is reduced by 1-2 cycles from the sample Ct where exponential amplification occurred earliest. Setting of Threshold: the principle is set so that the threshold line just exceeds the highest point of the normal negative control.

3) As a result, yin-yang determination: whether the FAM channel detects a melting curve in the reaction liquid or not is analyzed firstly, and if the Tm value is within a judging range, the detection is effective, so that the subsequent analysis can be continued.

4) If the internal standard does not detect the melting curve or the Tm is not in the judging range in the HEX channel in the reaction liquid, the concentration of the detected sample is too low or the reaction is inhibited by the interfering substances, and the experiment needs to be prepared again.

5) Interpretation rules:

example 3 detection results of test samples of the inventive composition

The primers and probes shown in example 1 were used to detect various positive pathogens by the method of example 2, and the experimental results are shown in FIGS. 1 to 2. The results show that each channel can be normally detected, the multiplex PCR system can detect the condition of the corresponding target, and all pathogens are typed.

Example 4 sensitivity of the composition of the invention

The positive samples are diluted to 500, 5000 and 50000 copies/mL respectively by the negative samples, so as to verify the sensitivity of the reagent and the detection method. The partial detection results are shown in figures 3-6, and the results show that the method provided by the invention has high sensitivity and the detection concentration can reach 500 copies/mL.

EXAMPLE 5 specificity of the composition of the invention

The primers and probes shown in example 1 were subjected to multiplex PCR detection on a fluorescent quantitative PCR apparatus according to the method described in example 2, for pathogens having homology to nucleic acid sequences and being susceptible to the same or similar clinical symptoms (e.g., M.felis, B.bronchiseptica, etc.), which are pathogens of the upper respiratory tract of cats, and the results are shown in FIGS. 7 to 9. From the graph, each target spot detection is negative, and the composition has good specificity.

Comparative example 1, remaining poorly performing primers and probes designed according to the invention

Because of the base-pairing rules, dimers are formed between the primer and/or probe, but with little probability, this can be eliminated at the beginning of the design. However, when multiple pathogens are jointly detected, a plurality of primers and probes are arranged, dimers are easy to occur between the primers and the primers, between the probes and the probes or between the primers and the probes, so that the conservation of design (which is crucial to the accuracy of detection) is ensured, and the mutual interference among different primer probes is considered, so that the primer probes need to be carefully designed.

Thus, the inventors have also devised that the remaining primers and probes (sequences not shown) constitute different detection systems, also for detecting a variety of pathogens. Specific detection results are shown in fig. 10-18, and it can be seen from the figures that the fluorescence amplification of the detection amplification curve is low, the sensitivity detection effect is poor, and part of targets even have no amplification curve, so that the overall detection effect is poor.

Meanwhile, the inventor also performs a series of comparative experiments with respect to the annealing temperature, and part of the experimental results are shown in fig. 19 to 20, and as can be seen from the figures, the annealing temperature is 60 ℃, and the effect is best when the annealing temperature is 25 seconds.

Sequence listing

<110> Hunan Dasheng pet doctor science and technology Co., ltd

<120> compositions, kits, methods and uses for detecting and typing a feline stomatitis pathogen

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213> artificial sequence

<400> 1

ccgacgtgac cctaatcata ga 22

<210> 2

<211> 23

<212> DNA

<213> artificial sequence

<400> 2

caggaggttc tcgtggaagt gtt 23

<210> 3

<211> 29

<212> DNA

<213> artificial sequence

<400> 3

tctctggtct gtttcccact cgcaagata 29

<210> 4

<211> 24

<212> DNA

<213> artificial sequence

<400> 4

ttgtcaatga cagtgttagg ttgg 24

<210> 5

<211> 18

<212> DNA

<213> artificial sequence

<400> 5

cgacgaagag cccaggcc 18

<210> 6

<211> 28

<212> DNA

<213> artificial sequence

<400> 6

aatcagcatg tggtaaccgt taattcgg 28

<210> 7

<211> 24

<212> DNA

<213> artificial sequence

<400> 7

atgtatgatt ccatttagtc ccca 24

<210> 8

<211> 23

<212> DNA

<213> artificial sequence

<400> 8

ggtaattttc catgccttgt gaa 23

<210> 9

<211> 27

<212> DNA

<213> artificial sequence

<400> 9

cctaccccaa aaacctagcc agctatt 27

<210> 10

<211> 24

<212> DNA

<213> artificial sequence

<400> 10

attactatta tggtggggat ttga 24

<210> 11

<211> 23

<212> DNA

<213> artificial sequence

<400> 11

ttgtttttgc tgtattgacc atg 23

<210> 12

<211> 28

<212> DNA

<213> artificial sequence

<400> 12

accccggaag acaaattaca agaagaac 28

<210> 13

<211> 24

<212> DNA

<213> artificial sequence

<400> 13

taattgaaat tgcacccata tcgg 24

<210> 14

<211> 24

<212> DNA

<213> artificial sequence

<400> 14

ccacttaaat cctaaagttc caga 24

Claims

1. A composition for detecting and typing a cat stomatitis pathogen, the composition comprising:

2. The composition of claim 1, wherein the composition further comprises an internal standard upstream primer as set forth in SEQ ID No. 13 and an internal standard downstream primer as set forth in SEQ ID No. 14.

3. The composition according to claim 1 or 2, wherein the fluorophores of each probe of the composition are different from each other and do not interfere with each other.

4. The composition of claim 3, wherein the fluorophore of the FHV-I probe is FAM; the fluorophore of the FCV probe is HEX; the fluorescent group of the FeLV probe is ROX; the fluorophore of the FIV probe is CY5; the fluorophore of the internal standard downstream primer is FAM.

5. The composition of any one of claims 1-4, wherein the composition is present in a mixed form.

6. Use of a composition according to any one of claims 1 to 5 for the preparation of a kit for detecting and typing a cat stomatitis pathogen.

7. A kit for detecting and typing a cat stomatitis pathogen, the kit comprising the composition of any one of claims 1 to 5.

8. The kit of claim 7, wherein the kit further comprises a nucleic acid release reagent, a nucleic acid extraction reagent, dNTPs, uracil glycosylase, a DNA polymerase, a PCR buffer, and Mg ²⁺ At least one of them.

9. A method for detecting and typing a feline stomatitis pathogen for non-diagnostic purposes, the method comprising the steps of:

1) Extracting or releasing nucleic acid of a sample to be tested;

2) Performing a fluorescent quantitative PCR analysis on the nucleic acid obtained in step 1) using the composition of any one of claims 1 to 5 or the kit of any one of claims 7 to 8;

3) The results were obtained and analyzed.

10. The method of claim 9, wherein the reaction conditions of the fluorescent quantitative PCR are:

reverse transcription is carried out at 50-60 ℃ for 5-15 minutes for 1 cycle; activating Taq enzyme at 95 deg.c for 1-10 min for 1 cycle; denaturation at 95 ℃ for 5-20 seconds, annealing at 55-60 ℃ for 20-60 seconds, 40-50 cycles, melting curve analysis, 62-75 ℃ and one cycle.