CN115054588B - miR181 a-manganese dioxide nanocomposite and preparation method and application thereof - Google Patents
miR181 a-manganese dioxide nanocomposite and preparation method and application thereof Download PDFInfo
- Publication number
- CN115054588B CN115054588B CN202210606005.3A CN202210606005A CN115054588B CN 115054588 B CN115054588 B CN 115054588B CN 202210606005 A CN202210606005 A CN 202210606005A CN 115054588 B CN115054588 B CN 115054588B
- Authority
- CN
- China
- Prior art keywords
- mir181a
- solution
- mno
- mir181
- manganese dioxide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/513—Organic macromolecular compounds; Dendrimers
- A61K9/5146—Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
- A61K33/32—Manganese; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
- A61K41/0038—Radiosensitizing, i.e. administration of pharmaceutical agents that enhance the effect of radiotherapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
- A61K47/6949—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit inclusion complexes, e.g. clathrates, cavitates or fullerenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E60/00—Enabling technologies; Technologies with a potential or indirect contribution to GHG emissions mitigation
- Y02E60/13—Energy storage using capacitors
Abstract
The invention discloses a miR181 a-manganese dioxide nanocomposite and a preparation method and application thereof. The preparation of the miR181 a-manganese dioxide nanocomposite comprises the following steps: (1) KMnO 4 Mixing the solution with polyallylamine hydrochloride solution to obtain MnO 2 A nanoparticle dispersion; (2) To MnO 2 Adding miR181a solution into the nanoparticle dispersion liquid, and stirring; then adding methylimidazole solution, stirring, adding zinc nitrate solution, reacting for 20-40min, centrifuging, and washing to obtain miR181a/MnO 2 A @ ZIF-8 dispersion; (3) miR181a/MnO 2 Mixing @ ZIF-8 dispersion with C18-PMH-PEG; and (3) performing ultrasonic treatment in ice water bath, centrifuging, and collecting supernatant to obtain the miR181 a-manganese dioxide nanocomposite. The miR181 a-manganese dioxide nanocomposite of the invention shows remarkable H in weak acidic tumor microenvironment 2 O 2 The decomposition activity reduces the tumor hypoxia and improves the sensitivity of colon cancer cells to radiotherapy; meanwhile, DNA damage after radiotherapy can be directly caused, and the curative effect of colon cancer is further improved.
Description
Technical Field
The invention relates to the technical field of colon cancer radiotherapy, in particular to a miR181 a-manganese dioxide nanocomposite and a preparation method and application thereof.
Background
Colon cancer is a common malignant tumor of the digestive tract occurring in the colon part, and is well developed at the junction of the rectum and the sigmoid colon, and the incidence rate accounts for the 3 rd position of the gastrointestinal tumor. Despite the current progress in the study of the molecular mechanisms of colon cancer, standard drug therapies for colon cancer remain limited. The Tumor Microenvironment (TME) comprises a variety of cell types involved in tumor angiogenesis. During the proliferation of the tumor, the demands for nutrition and oxygen are gradually changed, and once the diameter of the tumor focus exceeds a few millimeters, the hypoxia and nutrition deficiency state can trigger the angiogenesis switch of the tumor, so that the angiogenesis in the tumor is obviously increased and the tumor rapidly progresses. Hypoxia inducible factor (HIF-1. Alpha.) is a transcription factor that is highly expressed in the tumor microenvironment. It has regulating effect on proliferation, apoptosis, angiogenesis, anaerobic glycolysis, etc. of tumor, and can enhance adaptability of tumor cells to hypoxia by regulating cell state. Because of the hypoxia of the tumor, the conversion of tumor cells from oxidative phosphorylation to anaerobic glycolysis produces large amounts of lactic acid, which adds to the incomplete vasculature around the tumor tissue, causing catabolite accumulation, contributing to the low pH environment in the microenvironment. Studies have shown that HIF-1. Alpha. Has an important regulatory role in angiogenesis at tumor sites, primarily by modulating Vascular Endothelial Growth Factor (VEGF). Meanwhile, hypoxia also has a resistance effect on some current treatment means. Hypoxia, for example, induces up-regulation of P-glycoprotein (P-gp) and thus allows intracellular drugs to be pumped out of the cell, resulting in resistance and failure of chemotherapy.
At present, the treatment of colon cancer is a comprehensive treatment means which mainly uses surgery and is assisted by chemotherapy, radiotherapy, targeted treatment and the like. Radiation therapy is an important component of comprehensive treatment of colon cancer, and radiation therapy is carried out before operation, so that the tumor volume can be reduced, bleeding in operation can be reduced, stage of tumor can be reduced, and radical excision rate can be improved. In particular, in middle and late stage patients with concurrent metastasis, radiotherapy plays an important role in controlling tumor growth and metastasis. However, colon cancer is relatively insensitive to conventional radiotherapy treatment regimens compared to other malignancies. Clinically, it is difficult to achieve a sufficient dose due to radiation tolerance dose limitations in adjacent normal tissues. Radiation therapy often fails due to tumor cell resistance caused by radiation therapy and the presence of hypoxic tumor microenvironment. This resistance is associated with hypoxia, cell cycle arrest and related genetic alterations in the tumor microenvironment. For the above reasons, it is important to increase the sensitivity of tumors to radiation.
mirnas are a class of endogenous, non-coding RNAs with regulatory functions found in eukaryotes, which are about 20-25 nucleotides in size. mirnas regulate the function of target genes at the post-transcriptional or translational level, and are involved in physiological and pathological processes such as cell proliferation, apoptosis, and metabolism. mirnas can regulate more than one third of human mrnas. Recent studies have found that mirnas regulate tumor angiogenesis by targeting pro/anti-angiogenic factors, including RTKs signaling proteins, hypoxia Inducible Factor (HIF), VEGF, TSP-1, reactive Oxygen Species (ROS), and the like. miRNAs are tissue specific and in the tumor state, there are some specific miRNAs that can be deregulated. The miRNA can target the expression of tens or hundreds of genes, is positioned in the center of a complex regulation network, and once the miRNA changes, the expression of a downstream target gene can be influenced, so that the functions of cells are influenced. miRNA mimic MRX34 has entered phase I clinical trials. In the oncology field, research on mirnas is generally focused on monitoring the development and progression of tumors and targeting tumor therapies. In recent years, with the continuous and intensive research on individual treatment of tumors, a plurality of documents report that miRNAs are closely related to the curative effects of certain antitumor drugs. However, the disorders of miRNA therapy, such as inherent vulnerability under biological conditions, suboptimal delivery efficiency and rapid blood clearance, remain unresolved.
Disclosure of Invention
Against the prior artThe invention aims to provide a miR181 a-manganese dioxide nanocomposite and a preparation method and application thereof. The miR181 a-manganese dioxide nanocomposite of the invention shows remarkable H in weak acidic tumor microenvironment 2 O 2 The decomposition activity reduces the tumor hypoxia and improves the sensitivity of colon cancer cells to radiotherapy; meanwhile, DNA damage after radiotherapy can be directly caused, and the curative effect of colon cancer is further improved.
In order to achieve the above purpose, the invention adopts the following technical scheme:
the invention provides a preparation method of a miR181 a-manganese dioxide nanocomposite, which comprises the following steps:
(1) KMnO 4 Mixing the solution with polyallylamine hydrochloride solution to obtain MnO 2 A nanoparticle dispersion;
(2) To MnO 2 Adding miR181a solution into the nanoparticle dispersion liquid, and stirring for 2-4h; then adding methylimidazole solution, stirring for 20-40min, adding zinc nitrate solution, reacting for 20-40min, centrifuging, and washing to obtain miR181a/MnO 2 A @ ZIF-8 dispersion;
(3) miR181a/MnO 2 Mixing @ ZIF-8 dispersion with C18-PMH-PEG; and (3) performing ultrasonic treatment in ice water bath, centrifuging, and collecting supernatant to obtain the miR181 a-manganese dioxide nanocomposite.
Preferably, in step (1), the KMnO 4 The concentration of the solution is 3-4mg/ml, and the concentration of the polyallylamine hydrochloride solution is 35-40mg/ml; the KMnO 4 The volume ratio of the solution to the polyallylamine hydrochloride solution is (8-10): 1.
Preferably, in step (1), the KMnO 4 The time for the mixing reaction of the solution and the polyallylamine hydrochloride solution is 20-30 minutes.
Polyallylamine hydrochloride solutions are cationic polyelectrolytes that are capable of reducing potassium permanganate to manganese dioxide nanoparticles.
Preferably, in the step (2), the concentration of the miR181a solution is 0.7-0.9mg/ml, the concentration of the methylimidazole solution is 0.5-1.5mg/ml, and the concentration of the zinc nitrate solution is 0.5-1.5mg/ml;
the MnO 2 The volume ratio of the dispersion liquid to the miR181a solution to the methylimidazole solution to the zinc nitrate solution is 2: (0.8-1):2:2.
Preferably, in the step (2), miR181a in the miR181a solution is miR181a-2-3p, and the nucleotide sequences of the miR181a are shown as SEQ ID NO.1 and SEQ ID NO. 2; the method comprises the following steps:
Sense strand:AACAUUCAACGCUGUCGGUGAGU；(SEQ ID NO.1)
antisense strand:UCACCGACAGCGUUGAAUGUUUU。(SEQ ID NO.2)
preferably, in step (3), miR181a/MnO 2 ZIF-8 and C18-PMH-PEG are mixed according to the mass ratio of (5-15): 100.
Preferably, in the step (3), the ultrasonic frequency is 25-35kHz, and the ultrasonic time is 80-100 minutes.
In a second aspect of the invention, miR181 a-manganese dioxide nanocomposite prepared by the method is provided.
According to the miR181 a-manganese dioxide nanocomposite, ZIF-8 is used as a framework material, manganese dioxide nanoparticles and miR181a are loaded, and polyethylene glycol is coated on the surface of the composite, so that the dispersibility and stability of the composite are improved, and the miR181a is protected from ribonuclease.
Preferably, the particle size of the miR181 a-manganese dioxide nanocomposite is 120-150nm.
In a third aspect of the invention, there is provided the use of a miR181 a-manganese dioxide nanocomposite as described above in any one of (1) - (3) below:
(1) Preparing a colon cancer radiotherapy sensitizer;
(2) Preparing a medicament for inhibiting tumor angiogenesis after radiotherapy;
(3) Preparing the medicine for inhibiting the migration of colon cancer cells.
The invention has the beneficial effects that:
the miR181 a-manganese dioxide nanocomposite is formed by compounding manganese dioxide nanoparticles, miR181a and ZIF-8 nanoparticles, and the outer layer is wrapped by polyvinyl alcohol. The nanoenzyme has the advantages of being easy to use compared with natural enzymesThe synthesis and catalytic activity are adjustable, and the stability under severe environment is strong. MnO (MnO) 2 The nanoparticle has peroxidase activity, and is triggered by endogenous H 2 O 2 Is decomposed to increase O in tumor 2 Concentration, thereby reducing the radiotolerance of the tumor. MnO (MnO) 2 The high-expression glutathione in the tumor microenvironment is converted into glutathione disulfide, so that the scavenging effect of the glutathione on-OH is reduced, and the killing effect of the chemotherapeutic drug on tumor cells is enhanced.
ZIF-8 nanoparticles are multifunctional nanocarriers that modulate functional nucleic acids through electrostatic and ligand interactions. ZIF-8 nanoparticles can achieve tumor-targeted accumulation of nucleic acid payloads through enhanced permeability and retention effects and promote uptake of nucleic acids by cells without degradation. ZIF-8 is prepared by eliminating Zn in acidic tumor microenvironment 2+ Coordination with imidazole facilitates controlled release of nucleic acids. In addition, it has good biodegradability and low cytotoxicity, and is an attractive gene vector.
MnO 2 Nanoparticles have peroxidase activity, but MnO 2 Nanoparticles are easy to agglomerate and accumulate in MnO 2 MnO inside nanoparticle stacks 2 Failure to react with hydrogen peroxide results in insufficient reaction with hydrogen peroxide, resulting in low reaction efficiency, mnO 2 The particles do not react sufficiently. The invention adds MnO 2 The nano particles are loaded on the surfaces of ZIF-8 particles to lead MnO to be 2 The nano particles are dispersed on the surface of the ZIF-8 nano particles, thereby improving MnO 2 Contact area of nanoparticle and hydrogen peroxide to make MnO 2 The nano particles can fully react with hydrogen peroxide, so that the reaction efficiency is improved, and MnO is realized 2 Nanoparticles and ZIF-8 particles for O 2 Has the coordination and synergy effects.
The ubiquitous nucleases in the body prevent cell-specific delivery of mirnas in the body. In order to prolong the circulation time and reduce the nonspecific uptake of normal cells, polyethylene glycol is coated on the surface of the miR181 a-manganese dioxide nanocomposite. MnO is added to 2 MnO obtained by immobilizing nano enzyme on ZIF-8 surface 2 ZIF-8 has better peroxidationHydrogenase activity, and prevents aggregation, improves dispersibility and stability, and protects miR181a from ribonuclease.
Nano-delivery of mirnas can improve targeting efficiency, prevent degradation of mirnas by endogenous ribonucleases, and facilitate escape of mirnas from endogenous bodies. The radiosensitizer miRNA-181a directly causes DNA damage after radiotherapy.
MnO 2 ZIF-8 exhibits remarkable catalase activity under physiological pH or weak acidic tumor microenvironment conditions, and can convert H 2 O 2 Decomposition into O 2 Obviously relieves tumor hypoxia and improves radiation sensitivity. MnO (MnO) 2 ZIF-8 enhances the deposition of intracellular radiant energy, causes DNA damage, and acts as a nanosensitizer. miR181a is provided by MnO2@ZIF-8 loading, as miR181a can enhance DNA damage-induced apoptosis by directly targeting Rad17 and modulating the CHK2 pathway.
The miR181 a-manganese dioxide nanocomposite of the invention can inhibit neovascularization and catalyze O by promoting immune cell infiltration and DNA damage 2 Has obvious radiosensitization effect on colon cancer. miR181 a-manganese dioxide nanocomposite pair H 2 O 2 Has good catalytic activity, and can be used for treating endogenous H in specific acidic tumor microenvironment 2 O 2 Generates a large amount of O 2 Thereby significantly reversing hypoxia in TME.
Drawings
Fig. 1: schematic of sequential synthesis procedure of miR181a NPs and schematic for effective radiotherapy of colon cancer;
fig. 2: characterization and performance results of miR181a NPs; a transmission electron microscope and an element map of miR181a NPs; (B) High resolution XPS (X-ray photoelectron spectroscopy) of miR181a NPs; (C) X-ray crystal diffraction of miR181a NPs; (D) an aqueous phase ascending profile of miR181a NPs; (E) in vitro catalytic oxidation of hydrogen peroxide by miR181a NPs; (F) FTIR of miR181a NPs; (G) particle size distribution of miR181a NPs; (H) detection of MiR181a expression by QRT-PCR.
Fig. 3: experimental results of miR181a NPs to reduce hypoxia and enhance radiosensitivity; (a) group 5 cell beta-tubulin immunofluorescent staining; (B) CCK8 assay proliferation potency; (C) And (D) detecting apoptosis of 5 groups of MC38 cells by using Annexin V/PI staining; (E) change in survival of groups after irradiation; (F) WB analysis of expression levels of HIF-1. Alpha. In group 5.
Fig. 4: miR181a NPs inhibit the migration and angiogenesis of colon cancer cells; (A) 24 hours 5 group cell migration status (black line represents cell migration progress); (B) angiogenesis assays were performed 12 days after each group; (C) relative migration (%) of five groups; . (D) five groups of microvascular density/mm 2; (E) total length (mm) of five groups of microvasculature. * P <0.05.
Fig. 5: therapeutic effect results of miR181a NPs on C57BL6 mice tumor-bearing model; in the figure, a: the medical linear accelerator is used for radiotherapy experiments; b: group 5 colon cancer tissue photographs and hematoxylin-eosin staining results; c: tumor weight; d: tumor volume; e: the number of neovascular microvessels in the group tumor tissue; f: expression level of HIF-1. Alpha. In tumor tissue.
Detailed Description
It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
As previously mentioned, radiation therapy is the primary treatment for colon cancer, but radiation therapy resistance has become a major obstacle limiting its use. This resistance is associated with Tumor Microenvironment (TME) hypoxia, cell cycle arrest, and related genetic alterations. Therefore, in the radiotherapy of tumors, it is particularly important how to increase the sensitivity of tumor cells to the radiotherapy.
Based on the above, the invention designs a miR181 a-manganese dioxide nanocomposite. The miR181 a-manganese dioxide nanocomposite of the invention takes ZIF-8 as a framework material and loads MnO 2 And coating polyethylene glycol on the surfaces of the nano particles and miR181 a. The miR181 a-manganese dioxide nanocomposite of the invention shows excellent catalytic simulation activity in decomposing hydrogen peroxide into oxygen, so that the catalytic simulation activity is remarkableReversing hypoxia in TME; the radiation sensitizer miRNA-181a directly causes DNA damage after radiotherapy, and miR181a is loaded to MnO 2 ZIF-8-polyethylene glycol nanocomposite to prevent degradation in circulatory system and to successfully carry miR181a into tumor. In a subcutaneous tumor model, the miR181 a-manganese dioxide nanocomposite provided by the invention overcomes radiation resistance and improves the treatment effect. miR181a and MnO 2 The multiple sensitization strategy of combined administration of ZIF-8 nanoenzymes provides a promising approach to the treatment of colon cancer. The sequential synthesis and treatment mechanism of the miR181 a-manganese dioxide nanocomposite is shown in figure 1.
In one embodiment of the invention, a method for preparing a miR181 a-manganese dioxide nanocomposite is provided, comprising the following steps:
(1) KMnO with concentration of 3-4mg/ml and 35-40mg/ml 4 Mixing the solution with polyallylamine hydrochloride solution according to the volume ratio of (8-10): 1, and reacting for 20-30 minutes to obtain MnO 2 A nanoparticle dispersion;
(2) At MnO 2 Adding miR181a solution with concentration of 0.7-0.9mg/ml into nanoparticle dispersion liquid, mnO 2 Nanoparticle dispersion: the volume ratio of miR181a solution is 20: (8-10), stirring for 3h; then adding 0.5-1.5mg/ml methylimidazole solution, stirring for 30min, adding 0.5-1.5mg/ml zinc nitrate solution, and reacting for 30min; the MnO 2 The volume ratio of the nanoparticle dispersion methylimidazole solution to the zinc nitrate solution is 1:1:1, a step of; centrifuging for 5-20 min at 1000-2000 r/min, washing, and drying to obtain miR181a/MnO 2 @ZIF-8；
(3) miR181a/MnO 2 Adding ZIF-8 and poly (maleic anhydride) octadecene-polyethylene glycol (5-15) in mass ratio of 100 into ultrapure water, and mixing; ultrasonic in ice water bath with ultrasonic frequency of 25-35kHz for 80-100 min, centrifuging, and collecting supernatant to obtain miR181 a-manganese dioxide nanocomposite (miR 181 a/MnO) 2 @ ZIF-8-PEG, abbreviated miR181a NPs).
In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below with reference to specific embodiments.
The test materials used in the examples of the present invention are all conventional in the art and are commercially available. Wherein:
MnO 2 and ZIF-8 were purchased from Siamiry Biotechnology Inc. anti-IFI 6 and anti-HIF-1 a were purchased from beijing boaosen biotechnology limited. anti-SSBP 1 was purchased from Wuhanfein Biotechnology Inc. miR181a was purchased from Shanghai Ji Ma pharmaceutical technologies Co. Sense strand: AACAUUCAACGCUGUCGGUGAGU; antisense strand: UCACCGACAGCGUUGAUAUGUUUU. miR181a terminal is NH-substituted 2 The group is modified, and has green fluorescence. The mouse colon cancer cell line (MC 38) and Human Umbilical Vein Endothelial Cells (HUVEC) were from the national academy of sciences cell bank. DMEM high sugar medium was purchased from prinocetary, cat: PM150210. Poly (maleic anhydride-alt-1-octadecene) (C18-PMH) was purchased from SigmaAldrich.5k PEG polymer was purchased from Beijing Kai Biotech Co.
The preparation of C18-PMH-PEG is prior art, and can be carried out by referring to the prior literature reports, for example, the following method can be selected for preparation:
143mg of 5kPEG and 10mg of C18-PMH (PEG/C18-PMH) reacted monomer molar ratio=1: 1) In a solution of 5mL of methylene chloride, 11mg of N- (3-dimethylaminopropyl) -N-ethylcarbodiimide and 6. Mu.L of triethylamine were reacted in the presence of stirring for 24 hours, and then methylene chloride was purged with N 2 And (5) drying. The final solid was dissolved in water to form a clear solution, which was dialyzed against a dialysis bag with a molecular weight cut-off (MWCO) of 14kDa to remove unreacted PEG. After lyophilization, storage was carried out at-20℃for further use.
Example 1: preparation and characterization of miR181 a-manganese dioxide nanocomposite
Preparation of mir181a-manganese dioxide nanocomposite (miR 181a NPs)
KMnO at room temperature 3.5mg/ml 4 The volume ratio of the solution to the polyallylamine hydrochloride of 37.4mg/ml is 9:1, and fully reacting for 20 minutes to obtain MnO 2 The nanoparticle dispersion was washed with double distilled water.0.8mg of miR181a is dissolved in 1ml of water to obtain 0.8mg/ml of miR181a solution, and 2ml of MnO with concentration of 1mg/ml is obtained 2 900 microliters of miR181a solution was added to the nanoparticle dispersion and stirred for 3 hours. Adding 2ml of 2-methylimidazole solution with the concentration of 1mg/ml, stirring for 30 minutes, adding 2ml of zinc nitrate solution with the concentration of 1mg/ml, stirring and reacting for 30 minutes, centrifuging for 10 minutes at the rotating speed of 1000 r/min, washing particles, and dispersing the particles in water to obtain miR181a/MnO 2 ZIF-8 dispersion (concentration: 2 mg/ml). 10mg of miR181a/MnO 2 ZIF-8 and 100 mg of C18PMH-PEG were added to 5ml of ultrapure water and mixed. Ultrasonic treatment is carried out in ice water bath for 90min with the frequency of 30kHz, centrifugation is carried out for 3 hours under the condition of 21000 Xg, unstable nanocomposite materials are removed, and supernatant fluid is collected, thus obtaining miR181 a-manganese dioxide nanocomposite materials (miR 181a NPs).
Characterization and Performance analysis of mir181a NPs
The transmission electron microscope and the element map of miR181a NPs are shown in FIG. 2A, wherein the first row of elements represented from left to right in the figure are C, N, O in sequence, and the second row of elements represented from left to right in the figure are Mn, zn and C, N, O, mn, zn in sequence; high resolution XPS (X-ray photoelectron spectroscopy) is shown in FIG. 2B. The synthesized miR181a NPs have a series of characteristic peaks, which indicate MnO 2 Is successfully loaded into ZIF-8 and kept with free MnO 2 The same structure indicates that miR181aNPs have water solubility and biocompatibility.
The result of the analysis of the crystal structure of miR181a NPs by using an X-ray diffractometer is shown in FIG. 2C, and the miR181a NPs have two wide diffraction peaks at 14.1 DEG and 22.3 DEG, which shows that the internal crystal structure is poor and similar to the amorphous physical phase structure.
Measurement of miR181a NPs in aqueous solution (200, 100, 50. Mu.g/ml) at 1W/cm 2 As a result of the temperature change under 808nm laser irradiation, the highest temperature of 200 μg/ml miR181a NPs solution reaches 56.8 ℃ and meets the requirement of thermal ablation treatment (more than 50 ℃), as shown in FIG. 2D. Shows that miR181a NPs are potential photothermal therapy sensitizers.
With 100. Mu. Mol/L H 2 O 2 In vitro catalytic performance test of miR181a NPs, the result is shown in FIG. 2E. H in solid tumor 2 O 2 The content is generally higher than that of normal tissue. To simulate H in tumor microenvironment 2 O 2 Is used at a content of 100. Mu. Mol/L H 2 O 2 In-vitro catalytic performance test is carried out on miR181a NPs, and the result shows that the miR181a NPs remarkably reduces H within 1 hour 2 O 2 Is contained in the composition.
The miR181a NPs is analyzed by a Fourier transform infrared absorption spectrometer, and the result is shown in figure 2F, 560-540 cm -1 MnO is detected at 2 Mn-O telescopic absorption band in (1), wherein the ether bond wavelength in PEG is 1108cm -1 An ester bond wavelength of 1560cm -1 . This indirectly indicates MnO 2 Successfully loaded into ZIF-8, PEG was successfully adsorbed on MnO 2 @ ZIF-8 surface.
The particle size of miR181a NPs was measured by a laser particle size potential analyzer, and the result is shown in FIG. 2G, mnO 2 The particle size of @ ZIF-8-PEG was 101nm and the dispersion index was 0.145. The particle size of miR181a NPs is 129nm, and the dispersion index is 0.132. And as the self-assembly process is carried out by a dynamic light scattering method, the size of the material is gradually increased, and the prepared miR181a NPs has good uniformity.
MnO 2 ZIF-8, miR181a NPs were incubated with MC38 cells. We found that the intake of mir181a was much higher than that of free miR181a 24H after miR181a NPs treatment, and the intracellular concentration of miR181a was increased up to 96H, demonstrating the protective and efficient delivery effect of ZIF-8 nanomaterials on miR181a (figure 2H).
The above results indicate that this example successfully produced a product with good H 2 O 2 miR181a NPs with catalytic properties.
Example 2: preparation of miR181 a-manganese dioxide nanocomposite
At room temperature, 3mg/ml KMnO was used 4 The volume ratio of the solution to 35mg/ml polyallylamine hydrochloride is 8:1, and fully reacting for 20 minutes to obtain MnO 2 The dispersion was washed with double distilled water. 0.7mg of miR181a is dissolved in 1ml of water to obtain 0.7mg/ml of miR181a solution, and the solution is treated with 2ml of MnO 2 800. Mu.l of miR181a solution was added to the dispersion and stirred for 3 hours. AddingAdding 2ml of 2-methylimidazole solution with the concentration of 0.5mg/ml, stirring for 30 minutes, adding 2ml of zinc nitrate solution with the concentration of 0.5mg/ml, stirring and reacting for 30 minutes, centrifuging for 5 minutes at the rotating speed of 1000 r/min, and washing miR181a/MnO 2 ZIF-8 particles, 5mg miR181a/MnO 2 ZIF-8 and 100 mg of C18PMH-PEG were added to 5ml of ultrapure water and mixed. Ultrasonic treatment is carried out in ice water bath for 80min with the frequency of 25kHz, centrifugation is carried out for 2.5 hours under the condition of 21000 Xg, unstable nano composite materials are removed, and supernatant fluid is collected, thus obtaining miR181a NPs.
Example 3: preparation of miR181 a-manganese dioxide nanocomposite
At room temperature, 4mg/ml KMnO was used 4 The volume ratio of the solution to the polyallylamine hydrochloride of 40mg/ml is 10:1, and fully reacting for 30 minutes to obtain MnO 2 The dispersion was washed with double distilled water. 0.9mg of miR181a is dissolved in 1ml of water to obtain 0.9mg/ml of miR181a solution, and the solution is treated with 2ml of MnO 2 1ml of miR181a solution was added to the dispersion, and the mixture was stirred for 3 hours. Adding 2ml of 2-methylimidazole solution with the concentration of 1.5mg/ml, stirring for 30 minutes, adding 2ml of zinc nitrate solution with the concentration of 1.5mg/ml, stirring and reacting for 30 minutes, centrifuging for 20 minutes at the rotating speed of 2000 r/min, and washing miR181a/MnO 2 ZIF-8 particles, 15 mg of miR181a/MnO 2 ZIF-8 and 100 mg of C18PMH-PEG were added to 5ml of ultrapure water and mixed. Ultrasonic treatment is carried out in ice water bath for 100min with the frequency of 35kHz, centrifugation is carried out for 3 hours under the condition of 21000 Xg, unstable nano composite materials are removed, and supernatant fluid is collected, thus obtaining miR181a NPs.
Comparative example: mnO (MnO) 2 Preparation of @ ZIF-8-PEG (without miR181 a)
KMnO at room temperature 3.5mg/ml 4 The volume ratio of the solution to the polyallylamine hydrochloride of 37.4mg/ml is 9:1, and fully reacting for 20 minutes to obtain MnO 2 The nanoparticle dispersion was washed with double distilled water. MnO at a concentration of 1mg/ml at 2ml 2 Adding 2ml of 1mg/ml 2-methylimidazole solution into the nanoparticle dispersion, stirring for 30min, adding 2ml of 1mg/ml zinc nitrate solution, stirring and reacting for 30min, centrifuging for 10 min at 1000 r/min, washing the particles, and dispersingIn water, mnO is obtained 2 ZIF-8 dispersion (concentration: 2 mg/ml). 10mg of MnO was further added 2 ZIF-8 and 100 mg of C18PMH-PEG were added to 5ml of ultrapure water and mixed. Ultrasonic treating in ice water bath for 90min at 30kHz for 3 hr under 21000 Xg, removing unstable nanocomposite, collecting supernatant to obtain MnO 2 @ ZIF-8-PEG (without miR181 a).
Test example:
selecting a mouse colon cancer MC38 cell line, and setting 5 experimental conditions: group A: wild type MC38 cells; group B wild MC38 cells +3GyX irradiation; group C, wild MC38 cells + GyX radiation +ZIF-8; group D wild MC38 cell + GyX radiation+MnO 2 @ ZIF-8-PEG (without miR181 a); group E: wild type MC38 cells + GyX irradiation +miR181a NPs (prepared in example 1). The cells were cultured in DMEM high sugar medium with 10% fetal bovine serum and 1% penicillin, and the composition of DMEM high sugar medium is shown in table 1. After cell culture for 24 hours, substances (ZIF-8, mnO) in each group were added 2 ZIF-8-PEG, miR181a NPs), the amounts of the added C-E groups are consistent, and the final concentration is 1mg/ml.
TABLE 1 description of the high sugar Medium composition of DMEM
| Morphology of the product | Liquid |
| Concentration of | 1× |
| Specification of specification | 500mL |
| PH | 7.2～7.4 |
| L-glutamine | 4mM |
| NaHCO 3 | 3700mg/L |
| D-glucose | 4500mg/L |
| Pyruvic acid sodium salt | 1mM |
| HEPES buffer | Without any means for |
| Phenol red indicator | 15mg/L |
| Storage conditions | 2-8 ℃ and is protected from light |
| Transportation conditions | Normal temperature |
| Expiration date | For 12 months |
Effect of mir181a NPs on sensitisation to colorectal cancer radiotherapy
1.1 cell proliferation and colony formation assay
Cell proliferation assays were performed using cell count Kit-8. The 96-well plates were dosed with 100 μl of medium per well for a total of 2000 cells. Cell viability was measured at 1, 4 and 7 days and absorbance was measured at 450nm using a TECAN Infinit M200 plate reader. To determine clonogenic capacity, cells were seeded into 6-well plates. The medium was changed every 3 days and the cells were cultured for 6 days until colonies were visible. At the end of the experiment, the cells were washed 2 times with phosphate buffered saline, fixed with 4% paraformaldehyde, stained with crystal violet for 30min, and counted for colonies >50 cells.
1.2 flow cytometry
Apoptosis was detected using an Annexin V-FITC apoptosis detection kit and flow cytometry. After 50,000 resuscitated cells were collected, 195. Mu.L of annexin V-FITC conjugate was added. Sequentially 5. Mu.L annexin V-FITC and 10. Mu.L propidium iodide staining solution were added and gently mixed. Incubate for 15 minutes under light and then analyze with FlowJo software for flow cytometry. The experimental results are shown in FIG. 3.
Fig. 3A is an experimental result of confocal fiber microscopy for morphological changes in the expression of the bone protein β -tubulin and apoptosis, the morphology of the cells of group E showing significant depolymerization and apoptosis characteristics compared to group a. The miR181a NPs has obvious inhibition effect on proliferation of tumor cells after radiotherapy.
FIG. 3B is a graph showing the results of experiments for evaluating cytotoxicity of miR181a NPs by CCK-8 method, mnO 2 Neither ZIF-8-PEG nor miR181a NPs showed significant cytotoxicity after 96 hours of incubation with MC38 cells.
Fig. 3C and 3D show that the apoptosis rate of the E group is significantly increased compared with the control group (a-D group) by detecting the apoptosis of the tumor cells 16h after X-ray irradiation by using flow cytometry, which indicates that miR181a NPs significantly promotes apoptosis of MC38 cells under the radiation treatment condition.
Fig. 3E shows the change in survival rate of each group of clone experiments for detecting apoptosis of tumor cells 16h after X-ray irradiation by flow cytometry, with significant increase in apoptosis rate in group E.
FIG. 3F shows the results of a western blot assay for HIF-1α expression. Hypoxia inducible factor-1α (HIF-1α) is the center of hypoxia response. Under normoxic conditions, HIF-1. Alpha. Is susceptible to enzymatic degradation; however, the protein remains highly active under tumor hypoxic conditions. Overcoming hypoxia is a key to achieving radiotherapy sensitization. The low HIF-1 alpha expression of the A group and the high HIF-1 alpha expression of the radiotherapy drug-resistant cells show that hypoxia is a typical characteristic of the radiotherapy drug-resistant cells and is the reason for the radiotherapy drug resistance of the radiotherapy drug-resistant cells. After miR181a NPs are added, the expression of the HIF-1 alpha of MC38 cells irradiated by X rays is obviously reduced, which indicates that the miR181a NPs can increase the oxygen content of MC38R cells and improve the radiosensitivity.
The results indicate that miR181a NPs increase radiosensitivity by alleviating tumor hypoxia.
Effect of mir181a NPs on MC38R cell line migration
2.1 scratch test
Each group of MC38 cells was added to a 6-well plate for 24 hours. Different treatment conditions were added according to the group. A vertical trace was established on the surface of the cell culture medium with a 200. Mu.L pipette tip. After 2 washes with phosphate buffered saline, the Dulbecco's modified Eagle's medium complete medium with 2% fetal bovine serum was changed, 2mL was added to each well, 2 duplicate wells were placed in each group, and the culture was continued for 48h. Migration of each group of cells was observed under a microscope and photographs were obtained.
2.2 angiogenesis experiments
Matrigel sol was spread on 96-well plates and then rapidly transferred to a sterile incubator at 37 ℃. After the Matrigel sol was solidified, HUVEC cells were seeded into 96-well plates at a concentration of 1X 104cells/ml and the treatment was the same. Cell culture medium was added for 12h, and HUVEC angiogenesis was observed under an inverted light microscope and photographed. The experimental results are shown in FIG. 4.
FIG. 4A shows the migration of cells (black lines represent the progress of cell migration) for 24 hours in 5 groups, FIG. 4C shows the relative migration (%) of five groups, which in turn are E>D>C≈B>A. Indicating MnO 2 The ZIF-8 nanoenzyme inhibits migration of tumor cells after radiotherapy.
FIG. 4B shows the results of angiogenesis assays performed 12 days after each group, and FIG. 4D shows five groups of microvascular densities/mm 2 Fig. 4E is the total length (mm) of the five sets of tubes. HIF-1 a directly regulates VEGF22 expression, promotes tumor angiogenesis, promotes tumor cell overgrowth, inhibits apoptosis, and is beneficial to tumor growth and invasion. The miR181a NPs showed significantly less microvascular density and overall tube length than the control group (a-D). The miR181a NPs has more obvious inhibition effect on tumor angiogenesis after radiotherapy.
Experimental investigation of mir181a NPs to reduce tumor microenvironment hypoxia in vivo
MC38 cells were subcutaneously injected into C57BL/6 mice on one side, and then the mice were randomly divided into 5 groups: the A group is not treated, the B-E group is subjected to 6Gy X radiation in the next day, and the C-E group is respectively injected with ZIF-8 and MnO with the concentration of 2mg/ml after the tumor is carried out for 7 days 2 ZIF-8-PEG (without miR181 a) and miR181a NPs (prepared in example 1) were injected at a dose of 1ml, and tumors were collected after 14 days.
3.1 Western blotting
Cells were collected and lysed with RIPA lysis buffer for 30min on ice. Total protein was quantified using the Bradford kit. Protein samples were separated by electrophoresis on a 12% gel and transferred to polyvinylidene fluoride membranes. Primary antibody (ligand concentration 1:10,000) was incubated overnight at 4 ℃ and secondary antibody at room temperature for 2 hours. Antibodies were used for caspase-3, HIF 1-alpha, HARP, beta-actin and gamma H2AX.
3.2 immunohistochemistry
Tissue paraffin embedding, deparaffinization, rehydration, and incubation with HIF1- α, caspase-3, and PDL1 primary antibodies overnight at 4 ℃. Then, the tissue and the horseradish peroxidase-labeled secondary antibody are incubated for 20min at room temperature, and 3,3' -diaminobenzidine working solution is dripped for color development. The protein expression of interest was evaluated in terms of percent positive cells and staining intensity. The staining intensities were 0 (< 10% positive cells), 1 (10-25% positive cells), 2 (25-50% positive cells), 3 (50-75% positive cells) and 4 (> 75% positive cells), respectively. The intensity level is 0, no signal is generated; 1. weak (pale yellow); 2. moderate (brown); the staining was intense. These scores were multiplied to obtain the final quantitative result for each stain. Total staining scores were 0-12, and were categorized as negative (-, 0-1), weak (+2-4), medium (++, 5-8) and strong (+9-12). Tissue samples were independently examined and evaluated by two pathologists. The experimental results are shown in FIG. 5
FIG. 5A shows the results of a medical linac for radiation therapy experiments, and FIG. 5C shows the tumor weights of group 5 mice, with the tumor weights of groups A-E being 0.633.+ -. 0.091g, 0.314.+ -. 0.095g, 0.302.+ -. 0.076g, 0.203.+ -. 0.021g, and 0.081.+ -. 0.019g, respectively. The result shows that miR181a significantly inhibits tumor growth of MC38 tumor-bearing mice in a radiotherapy model.
Anti-angiogenesis has become critical for tumor metastasis therapy. In this study, hematoxylin-eosin staining showed a significant decrease in the number of neovascular microvessels in miR181 aaps group tumor tissue (fig. 5B and 5E). Enzyme-linked immunosorbent assay showed that HIF-1α was significantly reduced in the miR181a group tumor tissue (fig. 5F), while reactive oxygen species were significantly increased in the tumor tissue. The finding is consistent with the in vitro experimental result, which indicates that miR181a NPs can improve tumor hypoxia of tumor-bearing mice, reduce HIF-1 alpha expression, inhibit formation of new blood vessels in tumors, and improve treatment effect.
The experimental result shows that the multisensitive radiotherapy strategy of miR181a NPs is specific to H 2 O 2 Has good catalytic activity. miR181a NPs mimic catalase from endogenous H in specific acidic tumor microenvironment 2 O 2 Generates a large amount of O 2 . In addition, by MnO 2 The nano-delivery of ZIF-8 nanoenzyme mimics miR181a to radiosensitize tumors in a mouse model of subcutaneous cholangiocarcinoma. miR181a NPs catalyze O by promoting immune cell infiltration and DNA damage, inhibiting neovascularization 2 Has obvious radiosensitization effect on colon cancer.
The foregoing description is only of the preferred embodiments of the present application and is not intended to limit the same, but rather, various modifications and variations may be made by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.
SEQUENCE LISTING
<110> general Hospital in western war zone of the liberated army of Chinese people
<120> miR181 a-manganese dioxide nanocomposite and preparation method and application thereof
<130> 2022
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> RNA
<213> miR181a-2-3p
<400> 1
aacauucaac gcugucggug agu 23
<210> 2
<211> 23
<212> RNA
<213> miR181a-2-3p
<400> 2
ucaccgacag cguugaaugu uuu 23
Claims (10)
1. The preparation method of the miR181 a-manganese dioxide nanocomposite is characterized by comprising the following steps of:
(1) KMnO 4 Mixing the solution with polyallylamine hydrochloride solution to obtain MnO 2 A nanoparticle dispersion;
(2) To MnO 2 Adding miR181a solution into the nanoparticle dispersion liquid, and stirring for 2-4h; then adding methylimidazole solution, stirring for 20-40min, adding zinc nitrate solution, reacting for 20-40min, centrifuging, and washing to obtain miR181a/MnO 2 A @ ZIF-8 dispersion;
(3) miR181a/MnO 2 Mixing @ ZIF-8 dispersion with C18-PMH-PEG; and (3) performing ultrasonic treatment in ice water bath, centrifuging, and collecting supernatant to obtain the miR181 a-manganese dioxide nanocomposite.
2. The method according to claim 1, wherein in step (1), the KMnO 4 The concentration of the solution is 3-4mg/ml, and the concentration of the polyallylamine hydrochloride solution is 35-40mg/ml; the KMnO 4 The volume ratio of the solution to the polyallylamine hydrochloride solution is (8-10): 1.
3. The method according to claim 1, wherein in step (1), the KMnO 4 The time for the mixing reaction of the solution and the polyallylamine hydrochloride solution is 20-30 minutes.
4. The method according to claim 1, wherein in the step (2), the concentration of the miR181a solution is 0.7-0.9mg/ml, the concentration of the methylimidazole solution is 0.5-1.5mg/ml, and the concentration of the zinc nitrate solution is 0.5-1.5mg/ml;
the MnO 2 The volume ratio of the dispersion liquid to the miR181a solution to the methylimidazole solution to the zinc nitrate solution is 2: (0.8-1):2:2.
5. The preparation method of claim 1 or 4, wherein in the step (2), miR181a in the miR181a solution is miR181a-2-3p, and the nucleotide sequences of the miR181a are shown as SEQ ID NO.1 and SEQ ID NO. 2.
6. The method according to claim 1, wherein in the step (3), miR181a/MnO 2 ZIF-8 and C18-PMH-PEG are mixed according to the mass ratio of (5-15): 100.
7. The method according to claim 1, wherein in the step (3), the ultrasonic frequency is 25 to 35kHz and the ultrasonic time is 80 to 100 minutes.
8. A miR181 a-manganese dioxide nanocomposite prepared by the preparation method of any one of claims 1-7.
9. The miR181 a-manganese dioxide nanocomposite according to claim 8, wherein the miR181 a-manganese dioxide nanocomposite has a particle size of 120-150nm.
10. The use of the miR181 a-manganese dioxide nanocomposite of claim 8 or 9 in any one of the following (1) - (3):
(1) Preparing a colon cancer radiotherapy sensitizer;
(2) Preparing a medicament for inhibiting tumor angiogenesis after radiotherapy;
(3) Preparing the medicine for inhibiting the migration of colon cancer cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210606005.3A CN115054588B (en) | 2022-05-31 | 2022-05-31 | miR181 a-manganese dioxide nanocomposite and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210606005.3A CN115054588B (en) | 2022-05-31 | 2022-05-31 | miR181 a-manganese dioxide nanocomposite and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115054588A CN115054588A (en) | 2022-09-16 |
| CN115054588B true CN115054588B (en) | 2023-06-27 |
Family
ID=83197705
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210606005.3A Active CN115054588B (en) | 2022-05-31 | 2022-05-31 | miR181 a-manganese dioxide nanocomposite and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115054588B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110408041A (en) * | 2019-08-28 | 2019-11-05 | 海南省妇幼保健院 | A kind of preparation method of C18-PMH-PEG compound |
| CN112362646A (en) * | 2020-10-27 | 2021-02-12 | 华南理工大学 | Glutathione sensor based on nanoenzyme, and preparation method and application thereof |
| CN113174141A (en) * | 2021-04-09 | 2021-07-27 | 中国石油大学(华东) | ZIF-8/MnO2Preparation method and application of composite material |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10889598B2 (en) * | 2017-11-21 | 2021-01-12 | Wisconsin Alumni Research Foundation | Method to make scalable ultrathin hexagonally faceted metal-organic framework (MOF) and method of using same for detecting explosives and other nitro-aromatic compounds |
-
2022
- 2022-05-31 CN CN202210606005.3A patent/CN115054588B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110408041A (en) * | 2019-08-28 | 2019-11-05 | 海南省妇幼保健院 | A kind of preparation method of C18-PMH-PEG compound |
| CN112362646A (en) * | 2020-10-27 | 2021-02-12 | 华南理工大学 | Glutathione sensor based on nanoenzyme, and preparation method and application thereof |
| CN113174141A (en) * | 2021-04-09 | 2021-07-27 | 中国石油大学(华东) | ZIF-8/MnO2Preparation method and application of composite material |
Non-Patent Citations (2)
| Title |
|---|
| miＲ-181a 调控结肠癌细胞生长的作用和机制研究;吴为明等;《第二军医大学学报》;第35卷(第5期);第574-576页 * |
| Ultrasmall Hyperbranched Semiconducting Polymer Nanoparticles with Di!erent Radioisotopes Labeling for Cancer Theranostics;Xuan Yi等;《ACS Nano》(第12期);第9142-9151页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115054588A (en) | 2022-09-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hua et al. | Hypoxia-responsive lipid-poly-(hypoxic radiosensitized polyprodrug) nanoparticles for glioma chemo-and radiotherapy | |
| Sun et al. | Saikosaponin D loaded macrophage membrane-biomimetic nanoparticles target angiogenic signaling for breast cancer therapy | |
| Tang et al. | Tumor‐microenvironment‐adaptive nanoparticles codeliver paclitaxel and siRNA to inhibit growth and lung metastasis of breast cancer | |
| Wang et al. | Integration of cascade delivery and tumor hypoxia modulating capacities in core-releasable satellite nanovehicles to enhance tumor chemotherapy | |
| Scheinman et al. | Functionalized STAT1 siRNA nanoparticles regress rheumatoid arthritis in a mouse model | |
| Yu et al. | Biodistribution and toxicity assessment of superparamagnetic iron oxide nanoparticles in vitro and in vivo | |
| Meng et al. | Tumor metabolism destruction via metformin-based glycolysis inhibition and glucose oxidase-mediated glucose deprivation for enhanced cancer therapy | |
| Huang et al. | Triple therapy of hepatocellular carcinoma with microRNA-122 and doxorubicin co-loaded functionalized gold nanocages | |
| Du et al. | Development of an interactive tumor vascular suppression strategy to inhibit multidrug resistance and metastasis with pH/H 2 O 2 responsive and oxygen-producing nanohybrids | |
| Zhang et al. | Enhanced radiotherapy using photothermal therapy based on dual-sensitizer of gold nanoparticles with acid-induced aggregation | |
| Liang et al. | Specific activation of cGAS-STING pathway by nanotherapeutics-mediated ferroptosis evoked endogenous signaling for boosting systemic tumor immunotherapy | |
| Duo et al. | Proof of concept for dual anticancer effects by a novel nanomaterial-mediated cancer cell killing and nano-radiosensitization | |
| Zhou et al. | Tumor microenvironment-specific chemical internalization for enhanced gene therapy of metastatic breast cancer | |
| Yang et al. | GSH/pH Dual Activatable Cross‐linked and Fluorinated PEI for Cancer Gene Therapy Through Endogenous Iron De‐Hijacking and in Situ ROS Amplification | |
| Luo et al. | Smart nanoparticles for breast cancer treatment based on the tumor microenvironment | |
| Hu et al. | Effective nanotherapeutic approach for metastatic breast cancer treatment by supplemental oxygenation and imaging-guided phototherapy | |
| Luo et al. | Multifunctional Calcium–Manganese Nanomodulator Provides Antitumor Treatment and Improved Immunotherapy via Reprogramming of the Tumor Microenvironment | |
| CN109762821B (en) | Interfering RNA for inhibiting expression of AFAP1-AS1 and application of interfering RNA in increasing sensitivity of breast cancer radiotherapy | |
| Wang et al. | Photoactivated DNA Nanodrugs Damage Mitochondria to Improve Gene Therapy for Reversing Chemoresistance | |
| CN115054588B (en) | miR181 a-manganese dioxide nanocomposite and preparation method and application thereof | |
| CN112741903A (en) | DNA/nano compound and preparation method and application thereof | |
| Hao et al. | Multifunctional miR181a nanoparticles promote highly efficient radiotherapy for rectal cancer | |
| Li et al. | Layered and orthogonal assembly of hydrophilic drugs and hydrophobic photosensitizers for enhanced cancer therapy | |
| CN113633654B (en) | Targeting drug and preparation method and application thereof | |
| Jin et al. | Co enhances agomir transfection under pathological conditions to inhibit mmp overexpression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |