CN115044983A - Preparation method and application of antigen-specific nano antibody polypeptide library - Google Patents
Preparation method and application of antigen-specific nano antibody polypeptide library Download PDFInfo
- Publication number
- CN115044983A CN115044983A CN202210717633.9A CN202210717633A CN115044983A CN 115044983 A CN115044983 A CN 115044983A CN 202210717633 A CN202210717633 A CN 202210717633A CN 115044983 A CN115044983 A CN 115044983A
- Authority
- CN
- China
- Prior art keywords
- antigen
- heavy chain
- antibody
- specific
- chain antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/10—Libraries containing peptides or polypeptides, or derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/06—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from serum
- C07K16/065—Purification, fragmentation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
- C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
Abstract
The invention discloses a preparation method and application of an antigen specificity nano antibody polypeptide library, which are realized by the following steps: obtaining immunized alpaca Peripheral Blood Mononuclear Cells (PBMC) and plasma; obtaining a heavy chain antibody; obtaining antigen-specific heavy chain antibody by using antigen cross-linked immune microspheres; performing enzyme hydrolysis on the IdeS antigen-specific heavy chain antibody to obtain a heavy chain antibody variable region; carrying out in-gel enzymolysis on the variable region of the heavy chain antibody by using a Trypsin, LysC and Glu protease mixture; extracting polypeptide in the colloidal particles, and drying in vacuum to obtain an antigen-specific nano antibody polypeptide library; and (4) identifying by using liquid chromatography-tandem mass spectrometry. The method can prepare the antigen specificity nano antibody polypeptide library with more abundant diversity and can be used for further screening the nano antibody.
Description
Technical Field
The invention belongs to the technical field of immunology and biology, and relates to a preparation method of an antigen-specific nano antibody polypeptide library, which can be used for screening antigen-specific nano antibodies.
Background
Mammalian antibodies typically consist of two heavy chains and two light chains, the Fc region of the heavy chains ensuring a longer half-life of the antibody in vivo. Traditional antibody drugs have some inevitable disadvantages: the molecules are large and difficult to penetrate tissues and cells, especially physiological barriers such as blood brain barrier and the like; easy aggregation and precipitation in the preparation, storage and transportation processes; easily trigger anti-antibody reaction; the probability of screening high affinity antibodies with biological activity is low. In 1993, scientists Hamers-Casterman and the like in belgium discovered a new antibody in camels and alpacas, the antibody only has 1/10 of the traditional antibody, but completely has antibody activity, namely, the antibody can effectively recognize a target antigen, the antibody has the capacity of penetrating tissues and reaching lesion sites, the antibody has excellent stability, can resist strong temperature and acid-base stimulation, has low immunogenicity and high affinity, is easy to carry out in vitro chemical and biological modification, and is a good antibody medicament. This antibody is now called a nanobody, which again contains 3 CDRs, of which CDR3 plays a major role for affinity. Compared with human antibody VH, CDR3 is longer, can form a convex ring structure, can penetrate into the interior of the antigen to better bind the antigen, and therefore has higher affinity. In addition, V H The hydrophobic residue of FR2 of H is replaced by a hydrophilic residue, so that the water solubility is better and the aggregate is not easy to form. Therefore, the wide application of the nano antibody in the field of biological medicine brings a great revolution.
The nano antibody has wide application range. In the field of drug therapy, the deletion of the Fc domain improves the safety of the nano antibody, and the effectiveness of the nano antibody is improved. The small molecular weight of the nano antibody is easy to permeate into certain hard-to-reach canceration tissues, and the distribution uniformity is better. In the anti-infection aspect, the nano antibody can prevent the diffusion of viruses by blocking the processes of virus-cell combination, virus entry, virus coating and the like. The blood brain barrier is a great obstacle for the development of the drugs for the central nervous system diseases, and some nano antibodies can penetrate the blood barrier, so that the nano antibodies have unique potential in treating the nervous system diseases. In addition, the nano antibody has unique application value in the fields of basic research, biological imaging, biological detection and the like.
Most of the existing nano antibody screening technologies are based on phage display technologies, a phage display library is constructed by extracting B cell transcriptome of immune alpaca, and the specific nano antibody is finally obtained through several rounds of strict antigen screening. The biggest drawback of these techniques is that the antibody diversity is not sufficient, and in addition, not all sequences are well expressed in phage, and some proteins are not properly folded and degraded, thus losing a lot of antibody information during the library preparation process. In a laboratory, an antigen-specific nano antibody is directly purified from serum by adopting an antigen immunoprecipitation method, a fingerprint region characteristic sequence of the antigen-specific nano antibody is analyzed by using a biological mass spectrometry technology, and a complete sequence of the antigen-specific nano antibody is obtained by combining deep sequencing of a T cell gene library. In principle, the method directly obtains the antibody from immune serum, maintains the original antibody diversity and immunological characteristics, and has certain advantages. However, in the actual operation process, the antigen-specific nanobody obtained by immunoprecipitation is difficult to digest before mass spectrometry, mainly because the fingerprint region characteristic sequence of the nanobody, particularly the CDR3 region, is longer than that of a common antibody and highly diverse, and is difficult to digest into shorter polypeptides, thereby affecting further mass spectrometry and bringing about serious obstacles to the application and popularization of the method.
Disclosure of Invention
The invention aims to provide a preparation method of an antigen-specific nano antibody polypeptide library, which can fully digest antigen-specific nano antibodies purified from immune serum, particularly fingerprint region characteristic sequences of the nano antibodies, and prepare the antigen-specific nano antibody polypeptide library for further nano antibody screening.
A preparation method of an antigen specificity nanometer antibody polypeptide library is realized by the following steps and technical scheme:
(1) and (3) alpaca immunization: selecting 1 healthy alpaca of about 2 years old, mixing human serum albumin with Freund's adjuvant at a ratio of 1: 1, emulsifying completely, injecting each alpaca at back subcutaneous multiple points according to a dose of 6-7 μ g/kg, immunizing for 4 times at intervals of 2 weeks, taking 100mL of alpaca anticoagulation peripheral blood at the end of the immunization program, centrifuging to obtain plasma, preserving at-20 ℃, separating PBMC by a density gradient centrifugation method, and adding a proper amount of TRizol reagent to preserve at-80 ℃ for later use.
(2) Purification of heavy chain antibody: alpaca plasma was diluted 10-fold with PBS, loaded onto a protein a column, washed with PBS, and then eluted with 3-fold volume of 100mM glacial acetic acid/150 mM NaCl pH 3.5 solution, and the flow-through was collected and immediately neutralized. Dialyzing with PBS to obtain alpaca heavy chain antibody.
(3) Purification of antigen-specific heavy chain antibodies: preparing human serum albumin cross-linked cyanogen bromide activated agarose gel microspheres, mixing the agarose gel microspheres with the dialyzed alpaca heavy chain antibody, and incubating for 1h at 4 ℃; and (3) passing the incubated mixed solution through a column, collecting agarose gel microspheres, washing the agarose gel microspheres by PBS, sequentially eluting the agarose gel microspheres by 20mM HEPES, pH7.5 solution containing 1M, 2M, 3M and 4.5M MgCl2, mixing eluates, and dialyzing the mixed eluates in PBS overnight to obtain the human serum albumin-specific heavy chain antibody.
(4)V H Acquisition of H variable region: IdeS protease is added into the dialyzed human serum albumin specific heavy chain antibody according to the proportion of 1IU to 50 mu g of substrate, and the mixture is incubated for 30min at 37 ℃.
(5)V H Multi-enzyme combined enzymolysis of H variable region: and (3) running the digested antibody on SDS-PAGE, cutting a heavy chain antibody variable region (namely a nano antibody) strip, and performing in-gel enzymolysis. The enzymolysis conditions are as follows: adding a proper amount of Trypsin, LysC and Glu protease mixed solution according to the proportion of 1IU of protein per 50 mu g, immersing colloidal particles, inversely placing in a 37 ℃ thermostat, and incubating for 12-16 h.
(6) Obtaining an antigen-specific nano antibody polypeptide library: stopping the enzymolysis reaction with 1 μ L10% trifluoroacetic acid solution, centrifuging at low speed to separate colloidal particles from the solution, sucking out the solution, and collecting in a new centrifuge tube; adding appropriate amount of extract (50% acetonitrile, 0.1% formic acid) into the colloidal particles, incubating at 37 deg.C for 30min, and mixing the supernatant with the previous supernatant. The extraction step is repeated twice; and (3) concentrating the supernatant in a vacuum centrifugal concentrator to obtain a dry peptide fragment, namely a human serum albumin specific nano antibody polypeptide library.
(7) Library identification: adding the polypeptide library into 20 mu L of 0.1% formic acid solution for redissolving, adding into a mass spectrum loading bottle, taking the fact that no air bubbles exist at the bottom of the bottle, and carrying out identification analysis on the library by using liquid chromatography-tandem mass spectrum.
The invention also aims to provide the application of the preparation method of the antigen-specific nano antibody polypeptide library in nano antibody screening.
Further, in some embodiments of the present invention, the method for preparing antigen-specific nanobody polypeptide library may be combined with various techniques including, but not limited to, deep sequencing of T cell gene library to obtain the complete sequence of antigen-specific nanobody.
The invention has the beneficial effects that:
the preparation method of the antigen specificity nano antibody polypeptide library provided by the invention can fully digest the purified antigen specificity nano antibody in immune serum, particularly the fingerprint region characteristic sequence of the nano antibody, and prepare the antigen specificity nano antibody polypeptide library with more abundant diversity for further nano antibody screening.
Drawings
FIG. 1 shows the purification and identification of alpaca heavy chain antibody;
FIG. 2 is a purification of human serum albumin specific heavy chain antibodies;
FIG. 3 is a heavy chain antibody after IdeS protease digestion;
FIG. 4 is a mass spectrometric identification of a human serum albumin-specific nanobody polypeptide library;
FIG. 5 is the whole gene sequence analysis of the human serum albumin specific nano antibody.
Detailed Description
For further understanding of the present invention, the following examples of screening and preparation of human serum albumin nanobodies are provided to describe preferred embodiments of the present invention, but it should be understood that these descriptions are only intended to further illustrate features and advantages of the present invention, and are not intended to limit the scope of the claims of the present invention.
Example 1 alpaca immunization and purification of heavy chain antibodies
(1) Selecting 1 healthy alpaca of about 2 years old, reserving 10mL of anticoagulated peripheral blood of the alpaca before immunization as negative control, centrifuging to reserve plasma, preserving at-20 ℃, separating PBMC by a density gradient centrifugation method, and adding a proper amount of TRizol reagent to preserve at-80 ℃ for later use.
(2) Mixing human serum albumin and Freund's adjuvant at a ratio of 1: 1, emulsifying, injecting each alpaca subcutaneously at back with multiple spots at a dose of 6-7 μ g/kg, immunizing for 4 times, each time with an interval of 2 weeks, collecting 100mL of alpaca anticoagulated peripheral blood at the end of the immunization procedure, centrifuging to collect plasma, storing at-20 deg.C, separating PBMC by density gradient centrifugation, adding appropriate amount of TRizol reagent, and storing at-80 deg.C.
(3) The immunized alpaca plasma is diluted by 10 times by PBS and loaded on a protein A column.
(4) The protein A column was washed 1 time with 5 volumes of PBS, 3 volumes of 100mM glacial acetic acid/150 mM NaCl pH 3.5 solution were added, the flow-through was collected and immediately neutralized with 5ml 1M Tris-HCl, pH 8.0.
(5) The neutralized flow-through was dialyzed overnight at 4 ℃ in 100 volumes of PBS using a 30kDa dialysis bag.
(6) A small amount of dialyzed flow-through liquid is subjected to SDS-PAGE identification, and as shown in figure 1, the flow-through liquid mainly contains alpaca heavy chain antibody components.
Example 2 purification of human serum Albumin-specific heavy chain antibodies
(1) Crosslinking human serum albumin-cyanogen bromide activated agarose: 2mg of human serum albumin was added to the solution to 1mg/mL with a crosslinking buffer. 0.3mg of cyanogen bromide activated agarose was taken and soaked in 0.1M hydrochloric acid for 20 minutes to prepare cyanogen bromide activated agarose gel microspheres. And (3) washing the cyanogen bromide activated agarose gel microspheres with a crosslinking buffer solution for 3 times, mixing the human serum albumin solution with the agarose gel microspheres, and oscillating and incubating for 2 hours at room temperature. Cyanogen bromide activated Sepharose microspheres were washed alternately 3 times with cross-linking buffer and low pH acetic acid solution. The cyanogen bromide-activated Sepharose microspheres were resuspended in 1mL PBS and stored at 4 ℃ until use.
(2) The flow-through dialyzed in example 1 was diluted to 1mg/mL with PBS, mixed with 1% by volume of human serum albumin-cyanogen bromide-activated Sepharose microspheres, and incubated at 4 ℃ for 1 h.
(3) The incubated mixed solution was passed through a column, and the agarose gel microspheres were collected and washed 3 times with 5-fold PBS.
(4) Human serum albumin specific heavy chain antibodies were extracted sequentially with the following solutions: 1M MgCl 2 ，20mM HEPES，pH7.5；2M MgCl 2 ，20mM HEPES，pH7.5；3M MgCl 2 ，20mM HEPES，pH7.5；4.5M MgCl 2 ，20mM HEPES，pH7.5。
(5) The above eluate was dialyzed overnight at 4 ℃ in 100-fold volume of PBS using a 30kDa dialysis bag.
(6) The agarose gel beads were washed with 0.1M glycine, pH2.5 and SDS solutions, respectively.
(7) The above-mentioned fractions were subjected to SDS-PAGE and identified, as shown in FIG. 2, to reveal the heavy chain antibody specific to human serum albumin.
Example 3 preparation of human serum Albumin-specific Nanobody polypeptide library
(1) IdeS protease is added into the dialyzed human serum albumin specific heavy chain antibody according to the proportion of 1IU to 50 mu g of substrate, and the mixture is digested for 30min at 37 ℃.
(2) The digested antibody was run through SDS-PAGE, and as shown in FIG. 3, heavy chain antibody variable region (i.e., nanobody) bands were excised and subjected to in-gel enzymatic digestion.
(3) The adhesive tape was cut into small pieces and rinsed 2 times with distilled water.
(4) Adding appropriate amount of decolorized solution, placing in a constant temperature incubator at 37 deg.C, and decolorizing to colorless or light color for a certain time.
(5) Removing decolorized solution by suction, adding appropriate amount of acetonitrile for rinsing, removing acetonitrile by suction, adding acetonitrile, standing for 10min, sucking out acetonitrile, and dehydrating with vacuum centrifugal concentrator to dry the gel block. Acetonitrile can remove the water in the colloidal particles and dry the colloidal particles.
(6) To the dried gel mass, 25mM dithiothreitol solution was added, and the mixture was incubated at 55 ℃ for 45 min. Dithiothreitol opens the disulfide bond, allowing for sufficient trypsin digestion. This step must be followed immediately by the next iodoacetamide step, otherwise disulfide bonds may be formed again.
(7) Adding appropriate amount of acetonitrile for rinsing, sucking to dry, adding acetonitrile, sucking for 10min, and dehydrating with vacuum centrifugal concentrator to dry the gel block.
(8) Adding a proper amount of 55mM iodoacetamide solution, and reacting for 30min in a dark place. Iodoacetamide blocks free sulfhydryl groups, preventing disulfide bond reformation.
(9) Rinsing with acetonitrile, soaking in acetonitrile for 10min, and dehydrating with vacuum centrifugal concentrator to dry the gel block.
(10) Adding a proper amount of Trypsin, LysC and Glu protease mixed solution according to the proportion of 1IU of protein per 50 mu g, immersing colloidal particles, inversely placing in a 37 ℃ thermostat, and incubating for 12-16 h.
(11) The enzymatic reaction was stopped with 1. mu.L of 10% trifluoroacetic acid solution, centrifuged at low speed to separate the gel particles from the solution, the solution was aspirated and collected in a new centrifuge tube.
(12) Adding appropriate amount of extract (50% acetonitrile, 0.1% formic acid) into the colloidal particles, incubating at 37 deg.C for 30min, and mixing the supernatant with the previous supernatant. The extraction step was repeated twice.
(13) And (3) concentrating the supernatant in a vacuum centrifugal concentrator to obtain a dry peptide fragment, namely a human serum albumin specific nano antibody polypeptide library.
(14) The polypeptide library was reconstituted by adding 20. mu.L of 0.1% formic acid solution and added to a mass spectrometric loading vial, taking care that no air bubbles were present at the bottom of the vial, and assayed by liquid chromatography-tandem mass spectrometry. FIG. 4 shows a mass spectrum of CDR3 region of human serum albumin specific nanobody.
Example 4 screening of human serum Albumin-specific Nanobodies
(1) Total RNA was extracted from PBMC preserved in TRizol.
(2) Using One Step TB Green TM PrimeScript TM VHH fragments were amplified by the PLUS RT-PCR Kit one-step method using the sequences of the upstream and downstream primers GTCCTGGCTGCTCTTCTACAAGG and CAACGCCATCAAGGTACCAGTTGA. Preparing RT-PCR reaction solution according to the following components: 2XOne Step TB Green RT-PCR Buffer 10. mu.L, TaKaRa Ex Taq HS Mix 1.2. mu.L, PrimeScript PLUS RTase Mix 0.4. mu.L, PCR Forward Primer (10. mu.M) 0.8. mu.L, PCR Reverse Primer (10. mu.M) 0.8. mu.L, Total RNA 2. mu.L, RNase Free dH2O4.8. mu.L, Total volume 20. mu.L. The reaction conditions were as follows: reverse transcription reaction at 42 deg.c for 5min and 95 deg.c for 10 sec; PCR reaction at 95 deg.C for 5 seconds, 55 deg.C for 30 seconds, and 72 deg.C for 30 seconds for 40 cycles; extension, 10min at 72 ℃.
(3) And (4) performing second-generation sequencing on the PCR product to obtain a complete sequence library of the alpaca heavy chain antibody variable region.
(4) Uploading the peptide library sequence and heavy chain antibody variable region gene library obtained by mass spectrometry to Llama Magic (http://www.llamamagic.org/) And (4) comparing and matching to obtain the whole gene sequence of the human serum albumin specific nano antibody. FIG. 5 shows the whole gene sequence analysis of more than 1000 obtained human serum albumin specific nano-antibodies.
Claims (7)
1. A preparation method of an antigen specificity nanometer antibody polypeptide library is characterized by comprising the following steps and technical scheme:
(1) immunizing alpaca with specific antigen to obtain immunized Peripheral Blood Mononuclear Cells (PBMC) and immune plasma
(2) And (3) passing the immune plasma through a protein A column, and washing, eluting, dialyzing and the like to obtain the alpaca heavy chain antibody.
(3) Preparing antigen cross-linked cyanogen bromide activated agarose gel microspheres, mixing and incubating with the alpaca heavy chain antibody obtained in the step (2), passing through a column, washing, eluting, dialyzing and the like to obtain the antigen specific heavy chain antibody.
(4) And (3) carrying out enzymolysis on the antigen-specific heavy chain antibody obtained in the step (3) by IdeS protease, running SDS-PAGE gel, and cutting a heavy chain antibody variable region (namely a nano antibody) strip.
(5) And (3) carrying out in-gel enzymolysis on the nano antibody adhesive tape cut in the step (4), adding a proper amount of Trypsin, LysC and Glu protease mixed solution according to the proportion of 1IU of protein per 50 mu g, and incubating for 12-16h at 37 ℃.
(6) And (5) terminating the enzymolysis reaction in the step (5), extracting the polypeptide in the colloidal particles, and performing vacuum centrifugal concentration to obtain a dry peptide fragment, namely the antigen-specific nano antibody polypeptide library.
(7) And (4) identifying and analyzing the polypeptide library obtained in the step (6) by using liquid chromatography-tandem mass spectrometry.
2. The method of claim 1, wherein the method comprises the steps of: the protein A column in step (2) was washed with PBS, eluted with 3 volumes of 100mM glacial acetic acid/150 mM NaClpH 3.5 solution, and the flow-through was collected and immediately neutralized.
3. The method of claim 1, wherein the method comprises the steps of: and (3) mixing the antigen-crosslinked cyanogen bromide-activated sepharose microspheres in the step (3) with alpaca heavy chain antibodies, incubating for 1h at 4 ℃, passing through a column, collecting the sepharose microspheres, washing with PBS, eluting with 20mM HEPES (high efficiency particulate reagent) containing 1M, 2M, 3M and 4.5M MgCl2 and pH7.5 solution in sequence, mixing the eluates, and dialyzing in PBS overnight to obtain the antigen-specific heavy chain antibodies.
4. The method of claim 1, wherein the method comprises the steps of: adding IdeS protease into the antigen-specific heavy chain antibody in the step (4) according to the ratio of 1IU to 50 mu g of substrate, incubating for 30min at 37 ℃, running SDS-PAGE gel, and cutting a heavy chain antibody variable region (namely a nano antibody) strip.
5. The method of claim 1, wherein the method comprises the steps of: and (3) carrying out in-gel enzymolysis on the nano antibody adhesive tape in the step (5), adding a proper amount of Trypsin, LysC and Glu protease mixed solution according to the proportion of 1IU of protein per 50 mu g, immersing the adhesive tape, inversely placing the adhesive tape in a 37 ℃ thermostat, and incubating for 12-16 h.
6. The method of claim 1, wherein the method comprises the steps of: the enzymolysis system in the step (6) uses 1 mu L of 10% trifluoroacetic acid solution to terminate the enzymolysis reaction, and the mixture is centrifuged at low speed to separate colloidal particles from the solution, and the solution is sucked out and collected into a new centrifuge tube; adding appropriate amount of extract (50% acetonitrile, 0.1% formic acid) into the colloidal particles, incubating at 37 deg.C for 30min, and mixing the supernatant with the previous supernatant. The extraction step is repeated twice; and (3) concentrating the supernatant in a vacuum centrifugal concentrator to obtain a dry peptide fragment, namely a human serum albumin specific nano antibody polypeptide library.
7. The use of the method of claim 1 for the preparation of an antigen-specific nanobody polypeptide library for nanobody screening.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210717633.9A CN115044983A (en) | 2022-06-23 | 2022-06-23 | Preparation method and application of antigen-specific nano antibody polypeptide library |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210717633.9A CN115044983A (en) | 2022-06-23 | 2022-06-23 | Preparation method and application of antigen-specific nano antibody polypeptide library |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115044983A true CN115044983A (en) | 2022-09-13 |
Family
ID=83164046
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210717633.9A Pending CN115044983A (en) | 2022-06-23 | 2022-06-23 | Preparation method and application of antigen-specific nano antibody polypeptide library |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115044983A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115636879A (en) * | 2022-09-30 | 2023-01-24 | 南京集思慧远生物科技有限公司 | Nano antibody production based on next generation sequencing and proteomics and application method thereof |
-
2022
- 2022-06-23 CN CN202210717633.9A patent/CN115044983A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115636879A (en) * | 2022-09-30 | 2023-01-24 | 南京集思慧远生物科技有限公司 | Nano antibody production based on next generation sequencing and proteomics and application method thereof |
| CN115636879B (en) * | 2022-09-30 | 2024-01-05 | 南京集思慧远生物科技有限公司 | Nanometer antibody production and application method based on second-generation sequencing and proteomics |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA1162848A (en) | Method for enzyme immunoassay and peptide-enzyme conjugate and antibody therefor | |
| Order et al. | Immunotherapy of ovarian carcinoma. An experimental model | |
| CN111533805B (en) | High-affinity nano antibody for resisting carcinoembryonic antigen and application thereof | |
| CN110407938B (en) | anti-TIM-3 monoclonal antibody, expression vector and application thereof | |
| CN115044983A (en) | Preparation method and application of antigen-specific nano antibody polypeptide library | |
| CN113447658B (en) | Kit for detecting anti-peroxiredoxin-1-IgG antibody | |
| CN115917061A (en) | Rapid single step gradient method for generating nanobodies | |
| CA2499926A1 (en) | Antibody against von willebrand factor cleaving enzyme and assay system using the same | |
| CN110964101A (en) | Preparation method of nano antibody | |
| CN1786298A (en) | Preparation method of anticell or tissue protein mono clone antibody stock | |
| CN110396128B (en) | Preparation of anti-CD 19 nano antibody | |
| CN102221586B (en) | Preparation method of membrane protein polypeptides for improving detection rate of membrane proteins | |
| KR101465231B1 (en) | A Bio Probe for Detecting Classical Swine Fever Virus and Method for Diagnosing Classical Swine Fever Virus Using the Same | |
| CN115960238A (en) | Nano antibody capable of specifically binding PCSK9 antigen and preparation method thereof | |
| EP3336172B1 (en) | Method for producing antigen specific monoclonal antibody | |
| JP2021505191A5 (en) | ||
| CN113105546A (en) | Anti-recombinant human basic fibroblast growth factor nano antibody and application thereof | |
| CN112250765A (en) | Nano antibody aiming at HER2 and application thereof | |
| CN106854246B (en) | Nano antibody aiming at PI3K and clinical application thereof | |
| CN116813783B (en) | Anti-human CD28 engineering antibody and application thereof | |
| Bruce‐Tagoe et al. | Bioreceptors for Affinity Binding in Theranostic Development | |
| CN116023499B (en) | Bispecific antibody for CD3 and CD20 | |
| US20120070907A1 (en) | Method to deplete monoclonal antibodies in a biological sample | |
| DE502004008729D1 (en) | Antibodies directed against the prothrombin fragment F1 + 2, their preparation and use | |
| US20220146518A1 (en) | Tag for labeling biomolecules |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |