CN115044706A - Dual-fluorescence PCR (polymerase chain reaction) detection primer and kit for African swine fever virus wild strain and CD2v gene deletion strain and application - Google Patents
Dual-fluorescence PCR (polymerase chain reaction) detection primer and kit for African swine fever virus wild strain and CD2v gene deletion strain and application Download PDFInfo
- Publication number
- CN115044706A CN115044706A CN202210499001.XA CN202210499001A CN115044706A CN 115044706 A CN115044706 A CN 115044706A CN 202210499001 A CN202210499001 A CN 202210499001A CN 115044706 A CN115044706 A CN 115044706A
- Authority
- CN
- China
- Prior art keywords
- gene
- cd2v
- fluorescence
- strain
- swine fever
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a dual fluorescent quantitative PCR detection primer for a wild strain of African swine fever virus and a CD2v gene deletion strain, and the real-time fluorescent PCR amplification primer for a p72 gene is as follows: the upstream primer p 72-F1: TGCGATGATGATTACCTTGC which is the sequence of SEQ ID No. 1; the downstream primer p 72-R1: GATACCACAAGATCAGCCGT, which is the sequence of SEQ ID NO. 2; real-time fluorescent PCR amplification primers for the CD2v gene are shown below: the upstream primer CD2 v-F1: ATGAAGAAGAACAATGTCAGCA which is the sequence of SEQ ID No. 3; the downstream primer CD2 v-R1: ACTGATAACGACTGTAAGGCT which is the sequence of SEQ ID NO. 4.
Description
Technical Field
The invention belongs to the field of virus molecular biology, and particularly relates to a dual fluorescence PCR (polymerase chain reaction) detection primer and a kit for a wild strain of an African swine fever virus and a CD2v gene deletion strain, and application of the dual fluorescence PCR detection primer and the kit.
Background
African Swine Fever (ASF) is an acute and severe Swine infectious disease caused by African Swine Fever Virus (ASFV), the disease has short disease process, the death rate of the most acute and acute infections is up to 100%, and the disease is a severe infectious disease with the most serious harm in the pig industry (Galindo and Alonso 2017). ASF is an animal epidemic disease required to be reported by the world animal health Organization (OIE), and ASFV belongs to a category of animal pathogenic microorganisms in the famous records of animal pathogenic microorganisms in China.
The ASFV belongs to African swine fever genus of African swine fever family, is a DNA virus with a regular icosahedral structure, is similar to iridovirus (Iridovirdae) in classification, the DNA structure and the replication mode of the ASFV are similar to those of poxviridae (Poxv iridae), the ASFV particles have an envelope, the diameter is 175-215 nm, and the nucleocapsid 20-hedral symmetry. The genome consists of single-molecule linear double-stranded DNA and has a size of 170 to 190 kbp. The African swine fever virus genome has genetic diversity, at least 24 genotypes (based on the sequence analysis of B646L gene) and 8 serogroups (based on the serological analysis of CD2v protein) exist at present, and strains epidemic in China and southeast Asia and strains epidemic in east Europe and Russia belong to genotype II. Research shows that 6 genes (MGF505-1R, MGF505-2R, MGF505-3R, MGF360, MGF360-12L, MGF360-13L, MGF360-14L) of MGF360 and MGF505 deleted from ASFV Georgia2007 strain can obviously weaken the virulence of the virus, and the ASFV SY18 strain separated in China deletes CD2v while deleting the MGF gene, so that the virulence of the gene deletion strain is obviously weakened, and the gene deletion strain has better safety and protection effect. Therefore, the ASFV gene deletion strain has good research and development and application prospects when being applied to vaccine development.
The disease symptoms of the ASF are similar to the symptoms of other pig diseases, the clinical differential diagnosis is difficult, and a laboratory diagnosis method is needed. After infection by African Swine Fever Virus (ASFV) is established, antibodies are generated after a certain period of infection, so early screening of the best choice is also for antigen detection. At present, four common methods for detecting ASFV antigens comprise PCR, fluorescent quantitative PCR, Direct Immunofluorescence (DIF) technology and erythrocyte adsorption test (HAD), but the existing detection methods are developed and established based on African swine fever wild virus infection, after the gene-deficient vaccine is put into use in the future, the existing detection methods cannot distinguish wild virus infection positivity and vaccine immunopositivity, and in order to identify African swine fever vaccine immunized animals and naturally infected animals, the identification and detection technology of wild strains and vaccine strains is necessary to be established.
Disclosure of Invention
The invention aims to provide a dual-fluorescence PCR detection primer, a kit and application of a wild strain of African swine fever virus and a CD2v gene-deleted strain, wherein a dual-fluorescence quantitative PCR detection method aiming at a p72 gene and a CD2v gene is established by adopting a TaqMan probe fluorescence quantitative detection method, so that wild virus infection and a vaccine strain containing CD2v gene deletion can be effectively distinguished, and the method has good specificity, sensitivity and repeatability and provides good technical support for differential diagnosis of the wild strain of the African swine fever virus and the vaccine strain.
The technical scheme of the invention is as follows:
the invention provides a dual fluorescent PCR detection primer for a wild strain of African swine fever virus and a CD2v gene deletion strain, and the real-time fluorescent PCR amplification primer for a p72 gene is shown as follows:
the upstream primer p 72-F1: TGCGATGATGATTACCTTGC, which is the sequence of SEQ ID NO. 1;
the downstream primer p 72-R1: GATACCACAAGATCAGCCGT, which is the sequence of SEQ ID NO. 2;
real-time fluorescent PCR amplification primers for the CD2v gene are shown below:
the upstream primer CD2 v-F1: ATGAAGAAGAACAATGTCAGCA which is the sequence of SEQ ID No. 3;
the downstream primer CD2 v-R1: ACTGATAACGACTGTAAGGCT which is the sequence of SEQ ID NO. 4.
The invention also provides a dual fluorescent quantitative PCR detection probe of a wild strain of African swine fever virus and a CD2v gene deletion strain, which is a fluorescent probe P72-P1 aiming at the P72 gene and is shown as follows:
probes P72-P1: FAM-TCTGGCCCTGCCCACCACGT-BHQ1, which is a sequence of SEQ ID NO.5, FAM is a fluorescence reporter gene, and BHQ1 is a fluorescence quenching gene;
the fluorescent probe CD2v-P1 for the CD2v gene is shown as follows:
probe CD2 v-P1: VIC-TCCACTTCCATACATGAACCATCTCCAGA-BHQ1, which is SEQ ID NO.6 sequence, VIC is fluorescence reporter gene, and BHQ1 is fluorescence quenching gene.
The invention also provides a dual fluorescence PCR detection kit for wild strains of African swine fever virus and CD2v gene-deleted strains, which comprises the amplification primer aiming at the P72 gene, the amplification primer aiming at the CD2v gene, a probe P72-P1 of the P72 gene, a probe CD2v-P1 of the CD2v gene, a probe fluorescence quantitative detection reagent, a positive control and a negative control.
Furthermore, the concentrations of the upstream primer P72-F1, the downstream primer P72-R1, the upstream primer CD2v-F1 and the downstream primer CD2v-R1 in the kit reaction system are respectively 0.1-1 mu M, and the concentrations of the probe P72-P1 and the probe CD2v-P1 are respectively 0.1-1 mu M.
The invention also provides a dual fluorescence PCR detection method of the African swine fever virus wild strain and the CD2v gene deletion strain, and the kit is used for detecting the African swine fever virus, so that the wild virus infection and the vaccine strain containing the CD2v gene deletion can be effectively distinguished.
Further, the dual fluorescence PCR detection method for the African swine fever virus wild strain and the CD2v gene deletion strain specifically comprises the following steps:
(1) sample treatment: when the sample to be detected is pig blood, spleen, lymph node, kidney, swab and other samples, the DNA can be directly extracted by adopting a full-automatic nucleic acid extraction kit or a DNA extraction kit to form the DNA to be detected for later use;
(2) preparing a reaction system: instantly centrifuging the ASFV Mix and the enzyme system reaction solution, transferring the ASFV Mix reaction solution into an enzyme system tube, shaking and uniformly mixing or reversing and uniformly mixing, instantly centrifuging after fully and uniformly mixing, and then subpackaging 15 mu L of each PCR reaction tube; wherein, the ASFV Mix reagent comprises an upstream primer and a downstream primer of p72 gene, an upstream primer and a downstream primer of CD2v gene, a fluorescent probe, buffer and filtered water;
(3) respectively adding 10 mu L of DNA to be detected, 10 mu L of negative control and 10 mu L of positive control into different PCR reaction tubes, tightly covering the PCR reaction tubes after the sample addition is finished, shaking or inverting and uniformly mixing, then performing instant centrifugation, placing the positive control and the negative control of which the volume of liquid in each PCR reaction tube is 25 mu L, completely melting the positive control and the negative control at room temperature, fully inverting and uniformly mixing, and then performing short centrifugation;
(4) PCR operation: placing the PCR reaction tube which is subjected to instantaneous centrifugation into a fluorescent PCR detector, and detecting after marking according to reaction setting; the positive controls under the FAM channel and the VIC channel simultaneously present typical amplification curves, the CT values are all less than 35, and the negative controls have no amplification curves or CT values, so that effective detection is realized;
(5) and (6) judging the result.
Further, the reaction in step (4) is set as follows: first stage, pre-denaturation at 95 ℃ for 3 min; second stage, denaturation at 95 ℃ for 10 seconds, extension at 60 ℃ for 30 seconds, for 45 cycles; fluorescence collection was performed at 60 ℃ extension for each cycle of the second phase; the p72 gene selects FAM fluorescence detection channel, and the CD2v gene selects VIC fluorescence detection channel.
Compared with the prior art, the invention has the beneficial effects that: the invention establishes a double fluorescence quantitative PCR detection method aiming at the p72 gene and the CD2v gene, can effectively distinguish the wild virus infection from the vaccine strain containing the CD2v gene deletion, has good specificity, sensitivity and repeatability, and provides good technical support for the differential diagnosis of the African swine fever wild virus and the vaccine virus.
Drawings
FIG. 1 is a standard curve diagram of TaqMan real-time fluorescent quantitative PCR in an embodiment of the present invention;
template concentration for the standard curve of p72 gene was 4.0X 10 6 copies/mL、4.0×10 5 copies/mL、 4.0×10 4 copies/mL、4.0×10 3 copies/mL、1.0×10 3 copies/mL；
Template concentration for the standard curve of CD2v gene was 4.0X 10 6 copies/mL、4.0×10 5 copies/mL、 4.0×10 4 copies/mL、4.0×10 3 copies/mL、1.0×10 3 copies/mL；
FIG. 2 is a sensitivity analysis curve of the dual fluorescent quantitative PCR detection method of the present invention;
FIG. 3 is a low concentration precision analysis curve of the dual fluorescent quantitative PCR detection method of the present invention;
FIG. 4 is a specific assay analysis curve of the dual fluorescent quantitative PCR detection method of the present invention.
Detailed Description
The invention is further described in connection with the preferred embodiments, and the endpoints of the ranges disclosed herein and any values are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values; for ranges of values, between the endpoints of each of the ranges and the individual points, and between the individual points may be combined with each other to give one or more new ranges of values, and these ranges of values should be considered as specifically disclosed herein.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified;
the experimental methods in the following examples are all conventional methods unless otherwise specified;
Example 1
According to the ASFV genome sequence published in NCBI GenBank data, p72 and CD2v gene sequences (table 1) of China epidemic strain Pig/HLJ/2018(Accession No. MK333180) are selected, and Primer3Plus (http:// www.primer3plus.com) software is used for designing primers and probes, wherein the real-time fluorescent PCR amplification primers and probes for African swine fever virus p72 gene are shown as follows:
the upstream primer p 72-F1: TGCGATGATGATTACCTTGC which is the sequence of SEQ ID No. 1;
the downstream primer p 72-R1: GATACCACAAGATCAGCCGT which is the sequence of SEQ ID No. 2;
probes P72-P1: FAM-TCTGGCCCTGCCCACCACGT-BHQ1, which is a sequence of SEQ ID NO.5, FAM is a fluorescence reporter gene, and BHQ1 is a fluorescence quenching gene;
real-time fluorescent PCR amplification primers and probes for African swine fever virus CD2v gene are shown below:
the upstream primer CD2 v-F1: ATGAAGAAGAACAATGTCAGCA which is the sequence of SEQ ID No. 3;
the downstream primer CD2 v-R1: ACTGATAACGACTGTAAGGCT which is the sequence of SEQ ID No. 4;
probe CD2 v-P1: VIC-TCCACTTCCATACATGAACCATCTCCAGA-BHQ1, which is SEQ ID NO.6 sequence, VIC is fluorescence reporter gene, and BHQ1 is fluorescence quenching gene.
Example 2
A wild strain of African swine fever virus and a CD2v gene-deleted strain double-fluorescence quantitative PCR detection kit comprises real-time fluorescence PCR amplification primers SEQ ID NO.1 and SEQ ID NO.2 of African swine fever virus p72 gene and amplification primers SEQ ID NO.3 and SEQ ID NO.4 of CD2v gene, and also comprises a fluorescence probe of African swine fever virus p72 gene, as shown by SEQ ID NO.5 sequence, and a fluorescence probe of CD2v gene, as shown by SEQ ID NO.6 sequence;
wherein the concentrations of the upstream primer P72-F1, the downstream primer P72-R1, the upstream primer CD2v-F1 and the downstream primer CD2v-R1 in the kit reaction system are respectively 0.1-1 mu M, and the concentrations of the probe P72-P1 and the probe CD2v-P1 are respectively 0.1-1 mu M.
Example 3
A dual fluorescence quantitative PCR detection method for detecting a wild strain of African swine fever virus and a CD2v gene deletion strain, which utilizes the kit to detect and distinguish the wild strain of the African swine fever virus and the CD2v gene deletion strain, and specifically comprises the following steps:
(1) sample treatment: when the sample to be detected is pig blood, spleen, lymph node, kidney, swab and other samples, the DNA can be directly extracted by adopting a full-automatic nucleic acid extraction kit or a DNA extraction kit to form the DNA to be detected for later use;
(2) preparing a reaction system: instantly centrifuging the ASFV Mix and the enzyme system reaction solution, transferring the ASFV Mix reaction solution into an enzyme system tube, shaking and uniformly mixing or reversing and uniformly mixing, instantly centrifuging after fully and uniformly mixing, and then subpackaging 15 mu L of each PCR reaction tube; wherein, the ASFV Mix comprises an upstream primer, a downstream primer, a fluorescent probe, a buffer and filtered water;
the reaction system of the kit comprises 5U/mu L of Taq DNA polymerase, 0.2mM dNTP, 1 XPCR buffer solution, 0.2 mu M upstream primer, 0.2 mu M downstream primer and 0.1 mu M fluorescent probe for detecting the African swine fever virus p72 gene, 0.4 mu M upstream primer, 0.2 mu M downstream primer and 0.2 mu M fluorescent probe for detecting the African swine fever virus CD2v gene;
the positive control comprises an artificially synthesized recombinant plasmid containing African swine fever virus target genes P72 and CD2 v; the negative control was DEPC water, ultrapure water prepared by Millipore water purifier, with a resistivity greater than 18.0M Ω cm.
(3) Respectively adding 10 mu L of DNA to be detected, 10 mu L of negative control and 10 mu L of positive control into different PCR reaction tubes, tightly covering the PCR reaction tubes after the sample addition is finished, shaking or inverting and uniformly mixing, then performing instant centrifugation, placing the positive control and the negative control of which the volume of liquid in each PCR reaction tube is 25 mu L, completely melting the positive control and the negative control at room temperature, fully inverting and uniformly mixing, and then performing short centrifugation;
(4) PCR operation: placing the PCR reaction tube which is subjected to instantaneous centrifugation into a fluorescent PCR detector, and detecting after marking according to reaction setting; positive controls under the FAM channel and the VIC channel simultaneously generate typical amplification curves, CT values are all less than 35, and negative controls have no amplification curves or CT values, so that effective detection is realized;
(5) and (4) judging a result:
the amplification result of the sample under the FAM channel has a typical amplification curve, and the African swine fever virus p72 gene is judged to be positive when the CT value is less than 35; when the amplification result of the sample has no CT value, judging that the African swine fever virus p72 gene is negative; the amplification result of the sample has a typical amplification curve, and when the CT value is more than or equal to 35, the African swine fever virus p72 gene is judged to be suspicious, and the African swine fever virus p72 gene is judged to be positive if the African swine fever virus p72 gene is still suspicious and needs to be sampled and detected again;
the amplification result of the sample under the VIC channel has a typical amplification curve, and the African swine fever virus CD2v gene is positive when the CT value is less than 35; when the amplification result of the sample has no CT value, the African swine fever virus CD2v gene is judged to be negative; the amplification result of the sample has a typical amplification curve, and when the CT value is more than or equal to 35, the African swine fever virus CD2v gene is judged to be suspicious, and the African swine fever virus CD2v gene is judged to be positive if the African swine fever virus CD2v gene is still suspicious and needs to be sampled and detected again;
detecting a p72 gene and a CD2v gene by using a double fluorescence quantitative PCR detection method of a wild strain of the African swine fever virus and a CD2v gene deletion strain, wherein if the detection results of the p72 gene and the CD2v gene are negative, the African swine fever virus does not exist; if the p72 gene is positive and the CD2v gene is negative, the African swine fever virus is a vaccine virus and is a strain generated after the swine is vaccinated; if the detection results of the p72 gene and the CD2v gene are positive, the African swine fever virus is a wild strain, is infectious and causes swine diseases.
Example 4 Performance testing
1. Establishment of fluorescent quantitative standard curve
Through preliminary screening, determining a reaction system of the double fluorescent quantitative PCR to be 25 mu L, instantly centrifuging the ASFV Mix and the enzyme system reaction liquid, completely transferring the ASFV Mix reaction liquid into an enzyme system tube, shaking and uniformly mixing or reversing and uniformly mixing, after fully and uniformly mixing, instantly centrifuging, then subpackaging 15 mu L of a mixture of standard plasmids pUC57-B646L and pUC57-MGF505-2R diluted by 10 times in each PCR reaction tube, and adding 10 mu L into the PCR reaction tubes, wherein the total system is 25 mu L;
the reaction conditions are as follows: first stage, pre-denaturation at 95 ℃ for 3 min; second stage, denaturation at 95 ℃ for 10 seconds, extension at 60 ℃ for 30 seconds, for 45 cycles; fluorescence collection was performed at 60 ℃ extension for each cycle of the second phase; carrying out fluorescent quantitative PCR detection by using a 7500Fast Real-Time PCR System, and generating a standard curve;
as shown in FIG. 1, when the template copy number is 10 7 -10 1 When the detection range is within the range, the established double-fluorescence quantitative PCR detection method can obtain a good amplification kinetic curve, the standard curve corresponding to the primer probe aiming at p72 is-3.3255 x +42.993, and R is 2 0.9594; the standard curve for the primer probe for CD2v gene was Y-3. 2694x +40.888, R 2 ＝0.9756。
2. Sensitivity test
Mixing the standard substance at a ratio of 1.0 × 10 5 、1.0×10 4 、1.0×10 3 、5.0×10 2 、1.0×10 1 、1.0×10 0 The copies/mu L are respectively diluted to carry out the fluorescent quantitative PCR reaction, as shown in the result of figure 2, the lowest detection quantity of the fluorescent quantitative PCR is 10 copies/mu L, therefore, the fluorescent quantitative PCR established by the invention has higher sensitivity.
3. Low precision of concentration
Extracting 200copies/ml kanchestan quality control product from multiple wells for determination, and calculating the CV value of each gene region, wherein the Ct value variation coefficients of the detection of P72 gene and CD2v gene are CV < 5%, which shows that the reagent has higher precision, as shown in figure 3 and table 1;
TABLE 1 Low concentration precision measurement
4. Specificity test
The positive samples of pig DNA, porcine pseudorabies virus, porcine circovirus 2, porcine parvovirus, bovine DNA and human DNA are used as templates, and meanwhile, a positive control with pUC57-p72 and pUC57-CD2v standard plasmids as templates is established, the primer and the probe provided by the invention are used for carrying out fluorescence quantitative PCR amplification, the result is shown in figure 4, the fluorescence quantitative PCR of African swine fever virus, porcine pseudorabies virus, porcine circovirus 2 and porcine parvovirus has no amplification curve, which shows that the TaqMan real-time fluorescence quantitative PCR detection method established by the experiment has good specificity.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications of equivalent structures and equivalent processes, which are made by the present specification, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.
Sequence listing
<110> Fujian Baiman medical science and technology Limited
<120> dual-fluorescence PCR detection primer and kit for African swine fever virus wild strain and CD2v gene deletion strain and application
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
actgataacg actgtaaggc t 21
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tccacttcca tacatgaacc atctccaga 29
Claims (7)
1. A dual fluorescence PCR detection primer for African swine fever virus wild strain and CD2v gene deletion strain is characterized in that the real-time fluorescence PCR amplification primer aiming at p72 gene is as follows:
the upstream primer p 72-F1: TGCGATGATGATTACCTTGC which is the sequence of SEQ ID No. 1;
the downstream primer p 72-R1: GATACCACAAGATCAGCCGT which is the sequence of SEQ ID No. 2;
real-time fluorescent PCR amplification primers for the CD2v gene are shown below:
the upstream primer CD2 v-F1: ATGAAGAAGAACAATGTCAGCA which is the sequence of SEQ ID No. 3;
the downstream primer CD2 v-R1: ACTGATAACGACTGTAAGGCT which is the sequence of SEQ ID NO. 4.
2. A dual fluorescence PCR detection probe for detecting wild strains of African swine fever viruses and CD2v gene deletion strains is characterized in that the dual fluorescence PCR detection probe is a fluorescence probe P72-P1 aiming at a P72 gene and is shown as follows:
probes P72-P1: FAM-TCTGGCCCTGCCCACCACGT-BHQ1, which is a sequence of SEQ ID NO.5, FAM is a fluorescence reporter gene, and BHQ1 is a fluorescence quenching gene;
the fluorescent probe CD2v-P1 for the CD2v gene is shown as follows:
probe CD2 v-P1: VIC-TCCACTTCCATACATGAACCATCTCCAGA-BHQ1, which is SEQ ID NO.6 sequence, VIC is a fluorescence reporter gene, and BHQ1 is a fluorescence quenching gene.
3. A dual fluorescence PCR detection kit for a wild strain of African swine fever virus and a CD2v gene deletion strain is characterized by comprising the amplification primer aiming at the P72 gene, the amplification primer aiming at the CD2v gene, a probe P72-P1 of the P72 gene, a probe CD2v-P1 of the CD2v gene, a probe fluorescence quantitative detection reagent, a positive control and a negative control.
4. The dual-fluorescence PCR detection kit for the wild strain of African swine fever virus and the CD2v gene-deleted strain, according to claim 3, wherein the concentrations of the upstream primer P72-F1, the downstream primer P72-R1, the upstream primer CD2v-F1 and the downstream primer CD2v-R1 in the reaction system of the kit are respectively 0.1-1 μ M, and the concentrations of the probe P72-P1 and the probe CD2v-P1 are respectively 0.1-1 μ M.
5. A dual fluorescence PCR detection method for African swine fever virus wild strain and CD2v gene deletion strain is characterized in that the kit of any claim 3 or 4 is used for detecting the African swine fever virus to distinguish the wild virus infection from the vaccine strain containing CD2v gene deletion.
6. The dual fluorescence PCR detection method for the African swine fever virus wild strain and the CD2v gene deletion strain as claimed in claim 5, which comprises the following steps:
(1) sample treatment: when the sample to be detected is pig blood, spleen, lymph node, kidney, swab and other samples, the DNA can be directly extracted by adopting a full-automatic nucleic acid extraction kit or a DNA extraction kit to form the DNA to be detected for later use;
(2) preparing a reaction system: instantly centrifuging the ASFV Mix and the enzyme system reaction solution, transferring the ASFV Mix reaction solution into an enzyme system tube, shaking and uniformly mixing or reversing and uniformly mixing, instantly centrifuging after fully and uniformly mixing, and then subpackaging 15 mu L of each PCR reaction tube; wherein, the ASFV Mix reagent comprises an upstream primer and a downstream primer of p72 gene, an upstream primer and a downstream primer of CD2v gene, a fluorescent probe, buffer and filtered water;
(3) respectively adding 10 mu L of DNA to be detected, 10 mu L of negative control and 10 mu L of positive control into different PCR reaction tubes, tightly covering the PCR reaction tubes after the sample addition is finished, shaking or inverting and uniformly mixing, then performing instant centrifugation, placing the positive control and the negative control of which the volume of liquid in each PCR reaction tube is 25 mu L, completely melting the positive control and the negative control at room temperature, fully inverting and uniformly mixing, and then performing short centrifugation;
(4) PCR operation: placing the PCR reaction tube which is subjected to instantaneous centrifugation into a fluorescent PCR detector, and detecting after the PCR reaction tube is marked according to reaction setting; positive controls under the FAM channel and the VIC channel simultaneously generate typical amplification curves, CT values are all less than 35, and negative controls have no amplification curves or CT values, so that effective detection is realized;
(5) and (6) judging the result.
7. The dual fluorescence PCR detection method for the wild strain of African swine fever virus and the strain with the CD2v gene deletion of claim 6, wherein the reaction setup in the step (4) is as follows: first stage, pre-denaturation at 95 ℃ for 3 min; second stage, denaturation at 95 ℃ for 10 seconds, extension at 60 ℃ for 30 seconds, for 45 cycles; fluorescence collection was performed at 60 ℃ extension for each cycle of the second phase; the p72 gene selects FAM fluorescence detection channel, and the CD2v gene selects VIC fluorescence detection channel.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210499001.XA CN115044706A (en) | 2022-05-09 | 2022-05-09 | Dual-fluorescence PCR (polymerase chain reaction) detection primer and kit for African swine fever virus wild strain and CD2v gene deletion strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210499001.XA CN115044706A (en) | 2022-05-09 | 2022-05-09 | Dual-fluorescence PCR (polymerase chain reaction) detection primer and kit for African swine fever virus wild strain and CD2v gene deletion strain and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115044706A true CN115044706A (en) | 2022-09-13 |
Family
ID=83157351
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210499001.XA Pending CN115044706A (en) | 2022-05-09 | 2022-05-09 | Dual-fluorescence PCR (polymerase chain reaction) detection primer and kit for African swine fever virus wild strain and CD2v gene deletion strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115044706A (en) |
-
2022
- 2022-05-09 CN CN202210499001.XA patent/CN115044706A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021174674A1 (en) | Composition, kit and method for detecting and typing coronaviruses | |
| CN108411036B (en) | Nucleic acid detection kit and method for rapidly detecting influenza A and influenza B viruses | |
| CN106957927B (en) | African swine fever fluorescent PCR detection reagent, African swine fever fluorescent PCR detection kit and application thereof | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN111733298B (en) | Composition, kit and method for detecting and typing polyoma virus and application thereof | |
| CN113604607A (en) | ERA nucleic acid test strip amplification kit for rapidly detecting feline herpesvirus, preparation method and detection method | |
| WO2023087868A1 (en) | Compositions, kits, methods for detecting and identifying pathogens that cause respiratory tract infections and use thereof | |
| WO2014079350A1 (en) | Cho cell dna detection method | |
| Zhang et al. | An isothermal molecular point of care testing for African swine fever virus using recombinase-aided amplification and lateral flow assay without the need to extract nucleic acids in blood | |
| CN108504774B (en) | Method for detecting rhinovirus typing and enterovirus | |
| CN111286559A (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN107574261B (en) | Detection primer, detection kit and detection method for detecting hantavirus | |
| CN110438260B (en) | African swine fever virus nucleic acid test strip detection kit | |
| CN108624713B (en) | Method and kit for identifying and detecting porcine pseudorabies vaccine virus and wild virus | |
| CN112921123B (en) | Method for rapidly detecting feline calicivirus, primer for detection and kit | |
| Akiyoshi et al. | Reevaluation of laboratory methods for diagnosis of measles | |
| CN108359743A (en) | A kind of HRM primer group for differentiating FPV and CPV, the kit containing the primer sets and its application | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| AU2021103861A4 (en) | Method and kit for differentially detecting porcine pseudorabies vaccine virus and wild virus | |
| CN114561490B (en) | Composition, kit and method for detecting SARS-CoV-2 mutation site and application thereof | |
| CN115044706A (en) | Dual-fluorescence PCR (polymerase chain reaction) detection primer and kit for African swine fever virus wild strain and CD2v gene deletion strain and application | |
| CN107699638A (en) | A kind of method for detecting feline calicivirus | |
| CN113897356A (en) | Fluorescent quantitative PCR kit and primers for detecting chicken infectious anemia virus | |
| CN112522446A (en) | Detection primer pair and kit for wild strain of porcine pseudorabies virus | |
| CN109517929B (en) | Primer group and kit for porcine circovirus detection and type2 typing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |