CN115044652A - Nucleic acid detection kit based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application - Google Patents
Nucleic acid detection kit based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application Download PDFInfo
- Publication number
- CN115044652A CN115044652A CN202110253881.8A CN202110253881A CN115044652A CN 115044652 A CN115044652 A CN 115044652A CN 202110253881 A CN202110253881 A CN 202110253881A CN 115044652 A CN115044652 A CN 115044652A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- lys
- sequence
- crispr
- glu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a nucleic acid detection kit based on a CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application thereof. The invention provides a kit provided by the invention, which comprises the following components: 1) UCP immunochromatography test paper; 2) a CRISPR reaction system; the CRISPR reaction system comprises crRNA, Cas protein, probes with two ends labeled with biotin and FAM, and recombinase polymerase amplification primers; the invention combines the property of CRISPR/Cas12a specificity recognition target nucleic acid sequence with UCP immunochromatographic test paper, establishes a nucleic acid detection method based on the combination of CRISPR/Cas12a system and UCP immunochromatographic technology, and uses UCP immunochromatographic and a biosensor to interpret the CRISPR/Cas nucleic acid detection result. The method has the characteristics of low background, small interference and capability of realizing quantitative detection.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a nucleic acid detection kit based on a CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application thereof.
Background
Pathogen nucleic acid detection is of great significance for the rapid diagnosis of infectious diseases. The conventional detection method needs a professional to carry out detection work in a laboratory by using special detection equipment, such as a PCR (polymerase chain reaction) instrument, an electrophoresis apparatus, an imager and the like, and has higher requirements on personnel, environment and equipment. In the actual detection work of pathogens, the nucleic acid rapid detection which is sensitive, rapid, has small equipment dependence and can be realized without the operation of professional detection personnel is needed.
The CRISPR-Cas (Clustered regulated interstitial Short Palindromic repeat-CRISPR associated protein) system is an acquired immune system which is widely present in archaea and bacteria and can clear invasion of foreign invasive genetic materials. The system mainly comprises Cas effector protein and clustered short palindromic spacer sequences, wherein during the action, CRISPR loci are used for transcribing and processing tracrRNA and crRNA with special structures, mature crRNA and Cas effector protein are combined to form a protein-nucleic acid complex, the spacer sequences identify foreign invasive genetic substances through base pairing, guide the Cas protein to be positioned on specific target nucleic acid sites, and the Cas protein plays the role of endonuclease to cut the target nucleic acid so as to achieve the effect of eliminating the invasion of the foreign genetic substances. CRISPR/Cas systems can be divided into two broad classes, 6 classes and 32 subtypes, depending on the class of Cas effector proteins. The CRISPR system of the two types can realize the recognition and the cutting of specific nucleic acid sequences only by the cooperation of a single Cas protein and crRNA or tracRNA, thereby being very favorable for developing a tool for gene editing. In recent years, some Cas effector proteins are found to activate trans-nuclease activity for non-specific cleavage of ssDNA or ssRNA after recognizing and cleaving a specific nucleic acid target, such as Cas12, Cas13, Cas14, and other proteins. Using the non-specific nuclease activity of Cas proteins, researchers have developed Cas12 protein-based nucleic acid detection systems detect, HOLMES; the SHERLLOCK system based on the Cas13 protein can realize sensitive and rapid pathogen nucleic acid detection. Researchers have combined a Cas detection system with an immune colloidal gold test strip to prepare an immunochromatographic test strip, thereby further expanding the application prospect of the CRISPR/Cas nucleic acid detection technology in the field of rapid detection.
An Up-conversion luminescent material (UCP) is a rare earth metal compound capable of Up-Converting energy, i.e., the UCP material can absorb infrared light with low energy but emits visible light with high energy, so that the UCP material has the characteristics of low background, small interference and high sensitivity. The UCP nano-particle surface is subjected to a series of chemical modification, activation and antigen-antibody labeling and is combined with an immunochromatography technology, so that the sensitivity and stability of immunochromatography rapid detection can be further improved.
Disclosure of Invention
The invention aims to provide a pathogen nucleic acid detection kit.
The kit provided by the invention comprises the following components:
1) UCP immunochromatography test paper;
the immunochromatographic test paper sequentially comprises a sample combination pad containing UCP particle labeled antibodies, an NC membrane containing a T line and a C line and a water absorption pad according to the sample flowing direction;
the T line is formed by streptavidin;
the C-line is formed by a secondary antibody of the UCP particle-labeled antibody;
2) a CRISPR reaction system;
the CRISPR reaction system comprises crRNA, Cas protein, probes with two ends labeled with biotin and FAM, and recombinase polymerase amplification primers;
the Cas protein is a Cas protein in a second type V or VI CRISPR system;
two ends of the probe are respectively marked with biotin and a group capable of being combined with the UCP particle marked antibody;
the crRNA comprises a target sequence of a pathogen nucleic acid;
the recombinase polymerase amplification primer is a recombinase polymerase amplification primer capable of amplifying a target sequence.
In the kit, the Cas protein is Cas12a protein.
In the kit, the two ends of the nucleotide probe of the probe are respectively marked with biotin and fluorescein.
In the kit, the UCP particle labeled antibody is an anti-FAM antibody.
In the kit, the pathogen nucleic acid is plague bacillus nucleic acid;
the crRNA is specifically combined with the pla gene of the plague bacillus nucleic acid, specifically combined with the lcrV gene of the plague bacillus nucleic acid and/or specifically combined with the ymt gene of the plague bacillus nucleic acid.
In the kit, the recombinase polymerase amplification primer is a primer capable of specifically amplifying the full length or part of the pla gene of the plague bacillus nucleic acid, a primer capable of specifically amplifying the full length or part of the lcrV gene of the plague bacillus nucleic acid and/or a primer capable of specifically amplifying the full length or part of the ymt gene of the plague bacillus nucleic acid.
In the kit, the nucleotide sequence of the crRNA is a sequence 1, a sequence 2 or a sequence 3 in a sequence table;
or, the recombinase polymerase amplification primer consists of a single-stranded DNA molecule shown in a sequence 4 and a single-stranded DNA molecule shown in a sequence 5;
or, the recombinase polymerase amplification primer consists of a single-stranded DNA molecule shown in a sequence 6 and a single-stranded DNA molecule shown in a sequence 7;
or the recombinase polymerase amplification primer consists of a single-stranded DNA molecule shown in a sequence 8 and a single-stranded DNA molecule shown in a sequence 9;
or the nucleotide sequence of the probe with two ends labeled with biotin and FAM consists of 5C, one end of the probe is labeled with FAM, and the other end is labeled with biotin.
The application of the kit in the preparation of products with at least one function of the following 1) to 4) is also within the protection scope of the invention:
1) detecting whether the target nucleic acid is a pathogen nucleic acid;
2) detecting whether a sample to be detected contains pathogen nucleic acid or not;
3) detecting whether the bacteria to be detected are plague bacteria or not;
4) and detecting whether the sample to be detected contains the plague bacillus.
In the above application, the pathogen nucleic acid is plague bacillus nucleic acid.
The sample to be detected can be serum or plague bacillus, and only nucleic acid is extracted as a template.
The invention combines the property of CRISPR/Cas12a specificity recognition target nucleic acid sequence with UCP immunochromatographic test paper, establishes a nucleic acid detection method based on the combination of CRISPR/Cas12a system and UCP immunochromatographic technology, and uses UCP immunochromatographic and biosensor to interpret the CRISPR/Cas nucleic acid detection result. The method has the characteristics of low background, small interference and capability of realizing quantitative detection. The method will now be described by taking the nucleic acid detection of Yersinia pestis (Yersinia pestis, hereinafter abbreviated as Yersinia pestis) as an example. The detection method established by the invention can be widely applied to nucleic acid molecular diagnosis such as infectious disease etiology diagnosis, genetic disease screening, tumor diagnosis and the like. The method can realize sensitive and specific quantitative detection of the plague bacillus nucleic acid in the specimen, and the lowest detection limit can reach the Eimeria level.
Drawings
FIG. 1 shows the results of crRNA-optimized assay.
FIG. 2 shows the result of validation of the specificity of Cas12 a-fluorescent detection system.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The following examples describe the strains of plague 201 in the following references: tongWang, et al, Applied and Environmental Microbiology,2019,85(12): e 00097-19; publicly available from the applicant.
Yersinia pseudotuberculosis Pa3606 strain (pYV) + ) Are described in the following documents: johnson SL, et al genome announc.2015, Apr 30; e 00148-15; publicly available from the applicant.
In the following examples, PBS was used as a PBS solution having a concentration of 0.1M, pH and a value of 7.4, unless otherwise specified.
Example 1 establishment of Cas12a-UCP immunochromatography nucleic acid detection method based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography
Preparation of nucleic acid detection reagent based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography
1. Establishment of CRISPR/Cas12a reaction system
1) Preparation of crRNA
The target genes (pla, lcrV and ymt) of the plague bacteria are respectively located on 3 plasmids of the plague bacteria for coding virulence factors, and positive results can be respectively used for indicating that the strains to be detected have corresponding plasmids.
Design and preparation of crRNA sequence for target gene (pla, lcrV, ymt) of plague.
Single-stranded DNA carrying the T7 promoter was synthesized, annealed, and transcribed in vitro using the TranscriptAID T7 High Yield Transcription Kit. After transcription was complete, purification was performed using M5 HiPerRNAclean Mini kit, and the purified RNA was used as crRNA and the crRNA product was obtained by in vitro transcription. At least 3 crRNA sequences are designed for each target gene, and optimal sequences are screened through experiments.
2) Preparation of Cas12a protein
Plasmid pMBP-LbCas12a is transformed into Escherichia coli BL21, inoculated containing pMBP-LbCas12a plasmid of Escherichia coli BL21 in LB medium culture. The density of the bacterial liquid reaches OD 600nm Induction was performed with 0.5mM IPTG when the concentration was 0.6. Placing the triangular flask containing the bacterial liquid in a shaking table, setting the temperature at 16 ℃, rotating speed at 200rpm, and performing shake culture for 12 hours. After the culture is finished, the thalli is collected by centrifugation at 4000rpm, the thalli is broken by ultrasound, and the supernatant of a thalli lysate containing the recombinant Cas12a protein is collected by centrifugation. The protein was purified by nickel column affinity chromatography. The harvested Cas12a protein is dialyzed overnight with PBS solution, incubated for 1h at 30 ℃ with TEV enzyme digestion system, a nickel column is used for capturing an MBP protein label with a His label, the unlabeled Cas12a protein effluent is collected, the concentration is determined after concentration, the purity reaches more than 95% by running SDS-PAGE electrophoresis check, and the protein solution is frozen and stored at-80 ℃ for later use to obtain the Cas12a protein solution with the concentration of 0.5mg/ml and the solvent of PBS solution with the concentration of 0.1M, pH value of 7.4.
The amino acid sequence of the Cas12a protein is Cas12a protein derived from Lachnospiraceae bacterium ND2006 strain (Zetsche, B.et al.2015, Cell,163, 759-771, amino acid sequence 10).
3)FAM-C5-biotin
A FAM-C5-biotin probe was synthesized with the following nucleotide sequence: 5 '-CCCCCC-3', and one end of the probe is marked with FAM and the other end is marked with biotin.
4) Recombinase Polymerase Amplification (RPA) primers
3 pairs of RPA upstream and downstream primers for synthesizing target genes pla, lcrV and ymt are designed, and the optimal primer pair for each target gene is determined through system optimization pairing screening. The Twist AMPbasic reagent is used for carrying out RPA amplification on the 3 target genes respectively, and all the components are added according to the kit instruction.
The final primer pair sequences for each target gene were as follows:
pla-F: ATATAGTTATAATAATGGAGCTTATACCGGAAACT (3-f) (SEQ ID NO: 4)
pla-R: TATTCTTATCAATGGTCTGAGTACCTCCTTTG (2-R) (SEQ ID NO: 5)
lcrV-F: TGCGAGGGCAAATTATTTAATATGATTAGAGCCTA (4-f) (SEQ ID NO: 6)
lcrV-R: ACGCCCGCAATTCCCATTGTGTATTCGGCGATGAT (3-r) (SEQ ID NO: 7)
ymt-F: TGTATCCTGATTTCCCACCAATCAACGATACAAGA (1-f) (SEQ ID NO: 8)
ymt-R: TTTCATGCAAGTTGAGTAGGTCCTCTTGCCGTTGC (1-r) (SEQ ID NO: 9)
2. Preparation of up-conversion luminescent particle immunochromatographic test paper (UCP immunochromatographic test paper)
The UCP immunochromatographic test strip comprises a sample combination pad, an analysis membrane, a water absorption pad and an adhesive bottom lining; the operation can be carried out according to the method in patent CN 101788559A:
1) UCP particles were coated with mouse anti-6-FAM antibody and sample conjugate pads were prepared.
anti-6-FAM antibody was purchased from Shanghai Rui platinum Sp.
UCP particles mark anti-6-FAM antibody: each 0.5mg of UCP particles and 50 mug of anti-6-FAM antibody are coated in the coating solution for 1 h. Centrifuging at 12000rpm, and resuspending the particles with 100 μ LUCP preservative solution to obtain UCP particle-labeled anti-6-FAM antibody solution.
mu.L of diluent (phosphate buffer solution with pH of 7.2 and concentration of 0.03mol/L, containing 0.5% -2% of sucrose and 0.5% -3% of BSA) is added into 100 mu.L of UCP particle-labeled anti-6-FAM antibody solution and sprayed on the sample pad to obtain a sample binding pad, and the coating concentration of the UCP particle-labeled anti-6-FAM antibody is 2 mg/ml.
2) Preparation of analytical membranes containing T-line and C-line
Preparing a strip with a certain specification by taking a nitrocellulose membrane as an analysis membrane solid phase material, respectively spraying bioactive molecules streptavidin and goat anti-mouse IgG at different positions on the strip to respectively prepare a detection band and a quality control band, and drying the strip for later use.
Streptavidin solution, solute is streptavidin (Solebao, S9170-10mg), solvent is phosphate coating buffer solution (each 100mL contains 0.8g NaCl, 0.58g Na 2 HPO 4 ·12H 2 O，0.06gNaH 2 PO 4 ·2H 2 O) at a concentration of 2 mg/mL.
Goat anti-rabbit IgG solution, solute is goat anti-rabbit IgG (Samerfei, N24916), solvent is phosphate coating buffer solution with concentration of 0.01M, pH value of 7.4, concentration is 1 mg/mL.
Spraying 30 mu L of streptavidin solution on an NC membrane to form a T line, wherein the coating concentration is 2 mg/mL;
and spraying 30 mu L of goat anti-rabbit IgG solution on a nitrocellulose membrane (NC membrane) to form a C line, wherein the coating concentration is 1mg/mL, and thus obtaining the analysis membrane containing the T line and the C line.
3) Immunochromatographic test strip
And (3) assembling the sample combination pad obtained in the step (1), the analysis membrane containing the T line and the C line and the water absorption pad obtained in the step (2) on a plastic back plate in sequence according to the chromatography direction, and assembling the analysis membrane and the water absorption pad with a plastic shell to form the immunochromatography test strip.
3. Preparation of nucleic acid detection kit based on CRISPR detection principle
And (3) independently packaging the up-conversion luminescent particle immunochromatographic test paper prepared in the step (2) and the CRISPR reaction system prepared in the step (1) to construct a nucleic acid detection kit based on the CRISPR/Cas12a system and up-conversion luminescent particle immunochromatographic assay.
Second, establishment of method
1. Amplification of nucleic acids of interest
The nucleic acid to be detected from a sample to be detected or the nucleic acid to be detected is used as a template to carry out RPA amplification (a sequence shown in 4 of a primer is one) on any one of 3 target genes pla, lcrV and ymt by using a Twist AmpPbasic reagent (TwistdX, UK, catalog number: TABAS03), and each component is added into a reaction system according to the instruction of a kit and amplified for 15min at 37 ℃ to obtain an RPA product of the pla gene, an RPA product of the lcrV gene or an RPA product of ymt gene.
2. Substrate recognition and probe cleavage by Cas12a
1) Selection of crRNA
A detection system for Cas12a shown in table 1 below was configured, where the crrnas are different crrnas corresponding to different target genes shown in table 2, and the RPA products are RPA products of corresponding target genes obtained in table 1 above.
The detection system of Cas12a is incubated for 40min at 37 ℃, the time required by a strong positive sample can be shortened to 10min, and CRISPR reaction products (pla-1, pla-2 and pla-3) of pla genes corresponding to different crRNAs, Cas12a detection reaction products (lcrV-1, lcrV-2, lcrV-3, lcrV-4 and lcrV-5) of lcrV genes corresponding to different crRNAs or Cas12a detection reaction products (ymt-1, ymt-2, ymt-3, ymt-4 and ymt-5) of ymt genes corresponding to different crRNAs are obtained.
Table 1 shows detection system for Cas12a
Table 2 shows the crRNA sequences
And reading fluorescent signals by using a fluorescent plate reader for the CRISPR reaction products of the pla genes corresponding to different crRNAs, the Cas12a detection reaction products of the lcrV genes corresponding to different crRNAs and the Cas12a detection reaction products of the ymt genes corresponding to different crRNAs.
As shown in FIG. 1, pla-2 and pla-3 are CRISPR reaction products of pla genes corresponding to pla-crRNA-1, pla-crRNA-2 and pla-crRNA-3, respectively, lcrV-1, lcrV-2, lcrV-3, lcrV-4 and lcrV-5 are CRISPR reaction products of lcrV genes corresponding to lcrV-crRNA-1, lcrV-crRNA-2, lcrV-crRNA-3, lcrV-crRNA-4 and lcrV-crRNA-5, ymt-1, ymt-2, ymt-3, ymt-4 and ymt-5 are CRISPR reaction products of ymt-crRNA-1, ymt-crRNA-2, ymt-crRNA-3, ymt-crRNA-4 and ymt-crRNA-5, respectively, and ymt gene reaction products corresponding to the highest CRISPR signal is selected for subsequent detection, the crRNA sequences of the corresponding genes were selected as lcrV-2 (SEQ ID NO: 2), pla-3 (SEQ ID NO: 3) and ymt-2 (SEQ ID NO: 1), respectively.
2) Specific detection of crRNA
Amplification of the nucleic acid of interest: culturing of plague bacterium 201 (pMT 1) + ,pCD1 + ,and pPCP1 + ) Yersinia pseudotuberculosis strain Pa3606 (pYV) + ) And enterocolitis bacteria ATCC9610 strain (pYV) - ) Resuspending 3 strains of bacteria in PBS solution with pH of 7.2 and concentration of 0.01M to obtain 3 strains of 10 8 CFU/mL of bacterial suspension. Collecting 1mL of bacterial suspension 2400g, centrifuging for 10min, adding 200 μ L ddH 2 And O, boiling for 10min in a boiling water bath, centrifuging for 10min at 138000g, and collecting supernatant to obtain the genome DNA of the 3 strains.
Recognition of substrate and probe cleavage by Cas12 a: respectively taking 10 mu L of DNA of 3 strains as a template to perform RPA amplification (4 of a first primer) to obtain RPA products of the 3 strains;
the RPA products in the system shown in the table 1 were replaced with the RPA products of 3 strains, respectively, and the crRNA sequences of different target genes selected from 1) (SEQ ID NO: 2), pla NO: 3 (SEQ ID NO: 3), and ymt NO: 2 (SEQ ID NO: 1) were used, incubated at 37 ℃ for 40min, and the fluorescent signals were read with a fluorescence plate reader. Since the specificity of detection is determined only by crRNA and probe, the specificity is evaluated by screening only by fluorescence.
The results are shown in FIG. 2, which represents the detection of the strain of plague 201 (Y. pestis), the strain of Yersinia pseudotuberculosis Pa3606 (Y. pseudotuberculosis) and the strain of enterocolitis ATCC9610 (pYV) with three primer pairs - ) (y. enterocolitica) genomic DNA; the plague bacillus has 3 pathogenic gene encoding plasmids which are pCD1, pMT1 and pPCP1 respectively, wherein pCD1 is common to the three bacteria (the plasmid is called pYV in enterocolitis bacteria and Yersinia pseudotuberculosis bacteria) - ) pMT1 and pPCP1 are plasmids special for plague bacteria; as can be seen, only 3 kinds of gene detection of plague bacteria can obtain positive results, only the false tuberculosis bacteria can obtain positive results, the false tuberculosis bacteria only obtain positive results of the lcrV gene detection, and the enterocolitis bacteria ATCC9610 strain (pYV) - ) Due to the lack of corresponding plasmids, all gene detections are negative, which indicates that the Cas12a detection system of the invention has good specificity and can distinguish the near-source strains of plague bacteria.
3. Test paper detection
Mixing the CRISPR reaction product with a proper amount of sample treatment solution (containing 1% BSA, 0.5% SDS,0.25M NaCl, 0.3M PBS with pH 7.20) to make the total volume be 500 mu L, obtaining a sample loading solution, adding 80 mu L of the sample loading solution into a sample binding pad of a test strip, and carrying out chromatography development at room temperature for 15 min.
Under the condition that the target nucleic acid sequence exists in the sample liquid, the sample liquid flows through the sample combination pad, and the UCP particle labeled anti-6-FAM antibody is combined with FAM-C5-Biotin in the sample liquid to obtain a UCP particle-FAM antibody-FAM-C5-Biotin complex; cas12a non-specific nuclease activity activation, Cas12a cuts UCP particle-FAM antibody-FAM-C5-Biotin complex (different degrees according to different degrees of Cas12a enzyme activation) to obtain C5-Biotin and UCP particle-FAM antibody-FAM, when flowing through an analysis membrane, C5-Biotin separated from FAM is captured by streptavidin on a detection line of the analysis membrane and fixed on the detection line, UCP particle-FAM antibody-FAM is continuously chromatographed to the top of a test strip, and when chromatography reaches a quality control line, UCP particle-FAM antibody-FAM is captured by goat anti-mouse IgG on the quality control line and fixed on the quality control line.
Under the condition that the target nucleic acid sequence does not exist in the sample liquid, enabling the sample liquid to flow through the sample combination pad, combining the UCP particle labeled anti-6-FAM antibody with FAM-C5-Biotin in the sample liquid to obtain a UCP particle-FAM antibody-FAM-C5-Biotin complex; the activity of non-specific nuclease of Cas12a is not activated, when the complex flows through the analysis membrane, UCP particles-FAM antibody-FAM-C5-Biotin complex is captured by streptavidin on the detection line of the analysis membrane and is fixed on the detection line, and can not be captured by goat anti-mouse IgG on the quality control line.
Test paper obtained without adding nucleic acid to be detected is used as a blank control.
And (4) judging a qualitative result:
detecting phosphorescence signals of a T line and a C line of the nucleic acid detection test paper to be detected by a UPT sensor (UPT-3A type biosensor, Beijing Hot scene Biotechnology Co., Ltd.), judging according to the signal value ratio T/C of the T line and the C line, subtracting 3 times of standard deviation from the T/C value of blank control to set the standard deviation as a cutoff value,
if the sample with the T/C value of the nucleic acid to be detected being less than the cutoff value is positive, the sample to be detected contains or is candidate to contain the plague bacillus nucleic acid;
and if the sample with the T/C value of the nucleic acid to be detected being more than or equal to the cutoff value is negative, the nucleic acid to be detected does not contain or is candidate to contain the nucleic acid of the plague bacteria.
The detection can be directly judged by using the pla target gene, and can also be comprehensively analyzed by combining the detection results of the lcrV and ymt as the target genes, 3 genes are positive, and the detection accuracy is higher.
And (4) judging a quantitative result:
1) a standard curve is prepared, and the standard curve,
preparing a standard curve by using a plague bacterium PBS suspension with a standard substance concentration and a T-line fluorescence signal ratio T/C of a standard substance detected by a UPT sensor;
the concentration of the standard substance can be the concentration of plague bacteria or the concentration of plague bacteria nucleic acid;
the standard substance is plague bacteria or plague bacteria nucleic acid;
2) and detecting fluorescence signal values of a test strip T line and a test strip C line of the sample to be detected through the UPT sensor, calculating a ratio T/C, and substituting the ratio T/C into a standard curve to obtain the concentration of the plague bacteria or the nucleic acid concentration of the plague bacteria in the sample to be detected.
Example 2 Cas12a-UPT Immunochromatographic detection of plague bacteria
The target gene pla is used to detect plague bacillus DNA.
1. Amplification of nucleic acids of interest
Extracting the genome DNA of the plague bacterium 201 strain.
The above plague bacterium DNA was diluted with PBS solution to different concentrations (10) as shown in Table 3 -2 -10 3 aM) as templates, performing RPA amplification on the target gene pla by using a Twist AmpBasic reagent (the primer is pla-F/pla-R), and adding the components into a reaction system according to the kit instructions.
Amplifying at 37 deg.c for 15min to obtain the RPA product of pla gene.
2. Substrate recognition and probe cleavage by Cas12a
Adding the RPA product of the pla gene into a system (the crRNA is pla-crRNA-3) shown in the table 1, and incubating at 37 ℃ for 40min to obtain a CRISPR reaction product of the pla gene.
3. Test paper detection
The CRISPR reaction product of the pla gene was mixed with an appropriate amount of sample treatment solution (0.03M PBS containing 1% BSA, 0.5% SDS,0.25M NaCl, pH 7.20) to make the total volume 500. mu.L, to obtain a sample loading solution, 80. mu.L of the sample loading solution was added to a sample-bound pad of an upconversion luminescent particle immunochromatographic test strip, and developed by chromatography at room temperature for 15 min.
Detecting phosphorescence signals of a T line and a C line of the nucleic acid detection test paper to be detected by a UPT sensor, judging according to the signal value ratio T/C of the T line and the C line, subtracting 3 times of standard deviation from the T/C value of a blank control to set the standard deviation as a cutoff value,
if the sample with the T/C value of the nucleic acid to be detected being less than the cutoff value is positive, the nucleic acid to be detected contains or is candidate to contain the nucleic acid of the plague bacteria;
and if the sample with the T/C value of the nucleic acid to be detected being more than or equal to the cutoff value is negative, the nucleic acid to be detected does not contain or is candidate to contain the nucleic acid of the plague bacteria.
The Cutoff value of this test was 1.72.
The results are shown in Table 3.
Table 3 shows the results of the ratio T/C of the signal of the detection band (T) to the signal of the quality control band (C) obtained by scanning the test strip by the UCP sensor
The results show that 3aM plague DNA in the sample can be detected by this method.
Example 3 Cas12a-UCP immunochromatography for detection of plague bacteria in mock blood samples
1. Amplification of nucleic acids of interest
Mouse serum (Beijing Baiolaibo, C1201) 100. mu.L was added to a solution containing 10 1 -10 7 The PBS solution of the 201 strain of the CFU plague bacterium is prepared into a simulated mouse blood sample, 8 samples are prepared for each concentration gradient, and 56 simulated positive blood samples are prepared.
In addition, 100. mu.L of mouse serum was added to 100. mu.L of LPBS to prepare 64 specimens simulating negative blood.
And extracting genome DNA in each sample, and performing RPA amplification on the target gene pla by using the extracted DNA as a template and a twist AmpBasic reagent to obtain RPA products of the pla gene in the plague bacilli with different concentrations.
2. Recognition of substrate and probe cleavage by Cas12a
The same as the two methods of the embodiment 1, the system shown in the table 1 (the crRNA is pla-crRNA-3) is added with the RPA product of the pla gene in the plague bacteria with different concentrations, and the incubation is carried out for 40min at 37 ℃, the time required by the strong positive sample can be shortened to 10min, and the CRISPR reaction product of the pla gene of the plague bacteria with different concentrations is obtained.
3. Test paper detection
The CRISPR reaction product is respectively mixed with a proper amount of sample treatment solution (containing 1% BSA, 0.5% SDS,0.25M NaCl and 0.03M PBS with pH 7.20) to make the total volume be 500 mu L, so as to obtain a sample loading solution, 80 mu L of the sample loading solution is added into a sample binding pad of a test strip, and the sample binding pad is subjected to room temperature chromatography development for 15 min.
Detecting phosphorescent signals of a T line and a C line of the nucleic acid detection test paper to be detected through a UPT sensor, judging according to the signal value ratio T/C of the T line and the C line, subtracting 3 times of standard deviation from the T/C value of a blank control to set the standard deviation as a cutoff value, and if a sample with the T/C value of the nucleic acid to be detected smaller than the cutoff value is positive, determining that the nucleic acid to be detected contains or is candidate for containing the nucleic acid of plague bacteria;
and if the sample with the T/C value of the nucleic acid to be detected being more than or equal to the cutoff value is negative, the nucleic acid to be detected does not contain or is candidate to contain the nucleic acid of the plague bacteria.
The cutoff value measured in this experiment was 0.27.
Results are shown in Table 4, with a minimum detection limit of Cas12a-UPT of 100 CFU/100. mu.L blood samples.
The results of detection of 48 positive mock specimens and 64 negative mock specimens above the detection limit are shown in Table 5, with a detection sensitivity of 93.75% (45/48) and a specificity of 90.63% (58/64).
Table 4 shows the results of the signal ratio T/C of the detection zone (T) and the quality control zone (C) obtained by scanning the test strip by the UCP sensor in the simulated blood sample detection
| T/C value | |||||||
| Repetition of | 10 1 |
10 2 |
10 3 |
10 4 |
10 5 |
10 6 |
10 7 |
| 1 | 0.508 | 0.31 | 0.211 | 0.175 | 0.185 | 0.161 | 0.127 |
| 2 | 0.473 | 0.21 | 0.169 | 0.093 | 0.168 | 0.102 | 0.106 |
| 3 | 0.281 | 0.144 | 0.166 | 0.098 | 0.12 | 0.104 | 0.095 |
| 4 | 1.528 | 0.16 | 0.225 | 0.055 | 0.014 | 0.027 | 0.037 |
| 5 | 0.948 | 0.391 | 0.135 | 0.026 | 0.022 | 0.02 | 0.064 |
| 6 | 0.622 | 0.161 | 0.107 | 0.081 | 0.038 | 0.108 | 0.016 |
| 7 | 0.456 | 0.095 | 0.08 | 0.164 | 0.158 | 0.085 | 0.13 |
| 8 | 0.161 | 1.133 | 0.168 | 0.403 | 0.122 | 0.034 | 0.021 |
| MEAN | 0.622 | 0.326 | 0.158 | 0.137 | 0.103 | 0.080 | 0.075 |
Table 5 is a statistical table for the test results of the simulated blood samples
| Group of | Number of samples | Cas12-UPT test result positive | Cas12-UPT assay resultsNegative of |
| Positive specimen | 48 | 45 | 3 |
| Negative specimen | 64 | 6 | 58 |
SEQUENCE LISTING
<110> military medical research institute of military science institute of the people's liberation army of China
<120> nucleic acid detection kit based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application
<160> 10
<170>PatentIn version 3.5
<210> 1
<211> 41
<212>DNA/RNA
<213>Artificial sequence
<400> 1
uaauuucuacuaaguguagaugtaaatctgaattacatga c 41
<210> 2
<211> 41
<212>DNA/RNA
<213>Artificial sequence
<400> 2
uaauuucuacuaaguguagauatggaaatatctatatttt t 41
<210> 3
<211> 41
<212>DNA/RNA
<213>Artificial sequence
<400> 3
uaauuucuacuaaguguagaucuguauguaaauuccgcaa a 41
<210> 4
<211> 35
<212> DNA
<213>Artificial sequence
<400> 4
<210> 5
<211> 32
<212> DNA
<213>Artificial sequence
<400> 5
tattcttatcaatggtctgagtacctcctttg 32
<210> 6
<211> 35
<212> DNA
<213>Artificial sequence
<400> 6
<210> 7
<211> 35
<212> DNA
<213>Artificial sequence
<400> 7
<210> 8
<211> 35
<212> DNA
<213>Artificial sequence
<400> 8
<210> 9
<211> 35
<212> DNA
<213>Artificial sequence
<400> 9
<210> 10
<211> 1228
<212> PRT
<213>Artificial sequence
<400> 10
Met Ser Lys Leu Glu Lys PheThrAsnCys Tyr Ser Leu Ser Lys Thr
1 5 10 15
Leu ArgPhe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn Ile Asp
20 25 30
Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp Tyr Lys
35 40 45
Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile Asn Asp
50 55 60
Val Leu His Ser Ile Lys Leu Lys Asn Leu AsnAsn Tyr Ile Ser Leu
65 70 75 80
PheArg Lys LysThrArgThr Glu Lys Glu Asn Lys Glu Leu Glu Asn
85 90 95
Leu Glu Ile Asn Leu Arg Lys Glu Ile Ala Lys Ala Phe Lys GlyAsn
100 105 110
Glu Gly Tyr Lys Ser Leu Phe Lys Lys Asp Ile Ile Glu Thr Ile Leu
115 120 125
Pro Glu Phe Leu Asp Asp Lys Asp Glu Ile Ala Leu Val Asn Ser Phe
130 135 140
AsnGlyPheThrThr Ala PheThrGlyPhePhe Asp AsnArg Glu Asn
145 150 155 160
Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala PheArgCys Ile
165 170 175
Asn Glu Asn Leu ThrArg Tyr Ile Ser Asn Met Asp Ile Phe Glu Lys
180 185 190
Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu Ile Lys Glu Lys
195 200 205
Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp PhePhe Glu Gly Glu Phe
210 215 220
PheAsnPhe Val Leu Thr Gln Glu Gly Ile Asp Val Tyr Asn Ala Ile
225 230 235 240
Ile GlyGlyPhe Val Thr Glu Ser Gly Glu Lys Ile Lys Gly Leu Asn
245 250 255
Glu Tyr Ile Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu Pro Lys
260 265 270
Phe Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser Leu Ser
275 280 285
Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu Val Phe
290 295 300
ArgAsnThr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser Ile Lys Lys
305 310 315 320
Leu Glu Lys Leu Phe Lys AsnPhe Asp Glu Tyr Ser Ser Ala Gly Ile
325 330 335
Phe Val Lys AsnGly Pro Ala Ile Ser Thr Ile Ser Lys Asp Ile Phe
340 345 350
Gly Glu TrpAsn Val Ile Arg Asp Lys TrpAsn Ala Glu Tyr Asp Asp
355 360 365
Ile His Leu Lys LysLys Ala Val ValThr Glu Lys Tyr Glu Asp Asp
370 375 380
ArgArg Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu Gln Leu
385 390 395 400
Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu Lys Glu
405 410 415
Ile IleIle Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly Ser Ser
420 425 430
Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser Leu Lys Lys
435 440 445
Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu Leu Asp Ser Val Lys
450 455 460
Ser Phe Glu Asn Tyr Ile Lys Ala PhePheGly Glu Gly Lys Glu Thr
465 470 475 480
AsnArg Asp Glu Ser Phe Tyr Gly Asp Phe Val Leu Ala Tyr Asp Ile
485 490 495
Leu Leu Lys Val Asp His Ile Tyr Asp Ala Ile ArgAsn Tyr Val Thr
500 505 510
Gln Lys Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln Asn Pro
515 520 525
Gln Phe Met GlyGlyTrp Asp Lys Asp Lys Glu Thr Asp Tyr Arg Ala
530 535 540
Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met Asp Lys
545 550 555 560
Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp Asp Val AsnGly
565 570 575
Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu Pro Gly Pro Asn Lys Met
580 585 590
Leu Pro Lys Val PhePhe Ser Lys LysTrp Met Ala Tyr TyrAsn Pro
595 600 605
Ser Glu Asp Ile Gln Lys Ile Tyr Lys AsnGlyThrPhe Lys LysGly
610 615 620
Asp Met PheAsn Leu Asn Asp Cys His Lys Leu Ile Asp PhePhe Lys
625 630 635 640
Asp Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp PheAsn
645 650 655
Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala GlyPhe Tyr Arg Glu
660 665 670
Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser Lys Lys
675 680 685
Glu Val Asp Lys Leu Val Glu GluGly Lys Leu Tyr Met Phe Gln Ile
690 695 700
Tyr Asn Lys Asp Phe Ser Asp Lys Ser His GlyThr Pro Asn Leu His
705 710 715 720
Thr Met Tyr Phe Lys Leu LeuPhe Asp Glu AsnAsn His Gly Gln Ile
725 730 735
Arg Leu Ser GlyGly Ala Glu Leu Phe Met ArgArg Ala Ser Leu Lys
740 745 750
Lys Glu Glu Leu Val Val His Pro Ala Asn Ser Pro Ile Ala Asn Lys
755 760 765
Asn Pro Asp Asn Pro Lys LysThrThrThr Leu Ser Tyr Asp Val Tyr
770 775 780
Lys Asp Lys ArgPhe Ser Glu Asp Gln Tyr Glu Leu His Ile Pro Ile
785 790 795 800
Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile AsnThr Glu Val
805 810 815
Arg Val Leu Leu Lys His Asp AspAsn Pro Tyr Val Ile Gly Ile Asp
820 825 830
ArgGly Glu ArgAsn Leu Leu Tyr Ile Val ValVal Asp Gly Lys Gly
835 840 845
Asn Ile Val Glu Gln Tyr Ser Leu Asn Glu Ile IleAsnAsnPheAsn
850 855 860
Gly Ile Arg Ile Lys Thr Asp Tyr His Ser Leu Leu Asp Lys Lys Glu
865 870 875 880
Lys Glu ArgPhe Glu Ala Arg Gln AsnTrpThr Ser Ile Glu Asn Ile
885 890 895
Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys Ile Cys
900 905 910
Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Glu Asp Leu Asn
915 920 925
Ser GlyPhe Lys Asn Ser Arg Val Lys Val Glu Lys Gln Val Tyr Gln
930 935 940
Lys Phe Glu Lys Met Leu Ile Asp Lys Leu Asn Tyr Met Val Asp Lys
945 950 955 960
Lys Ser Asn Pro Cys Ala ThrGlyGly Ala Leu Lys Gly Tyr Gln Ile
965 970 975
ThrAsn Lys Phe Glu Ser Phe Lys Ser Met Ser Thr Gln AsnGlyPhe
980 985 990
Ile Phe Tyr Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp Pro Ser Thr
995 1000 1005
GlyPhe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser Ile Ala Asp
1010 1015 1020
Ser Lys LysPhe Ile Ser SerPhe Asp Arg Ile Met Tyr Val Pro
1025 1030 1035
Glu Glu Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys AsnPhe Ser
1040 1045 1050
ArgThr Asp Ala Asp Tyr Ile Lys LysTrp Lys Leu Tyr Ser Tyr
1055 1060 1065
GlyAsnArg Ile Arg Ile PheArgAsn Pro Lys LysAsnAsn Val
1070 1075 1080
Phe Asp Trp Glu Glu Val Cys Leu Thr Ser Ala Tyr Lys Glu Leu
1085 1090 1095
PheAsn Lys Tyr Gly Ile Asn Tyr Gln GlnGly Asp Ile Arg Ala
1100 1105 1110
Leu LeuCys Glu Gln Ser Asp Lys Ala Phe Tyr Ser SerPhe Met
1115 1120 1125
Ala Leu Met Ser Leu Met Leu Gln Met ArgAsn Ser Ile ThrGly
1130 1135 1140
ArgThr Asp Val Asp Phe Leu Ile Ser Pro Val Lys Asn Ser Asp
1145 1150 1155
Gly Ile Phe Tyr Asp Ser ArgAsn Tyr Glu Ala Gln Glu Asn Ala
1160 1165 1170
Ile Leu Pro Lys Asn Ala Asp Ala AsnGly Ala Tyr Asn Ile Ala
1175 1180 1185
Arg Lys Val Leu Trp Ala Ile Gly Gln Phe Lys Lys Ala Glu Asp
1190 1195 1200
Glu Lys Leu Asp Lys Val Lys Ile Ala Ile Ser Asn Lys Glu Trp
1205 1210 1215
Leu Glu Tyr Ala Gln Thr Ser Val Lys His
1220 1225
Claims (9)
1. A pathogen nucleic acid detection kit comprising:
1) UCP immunochromatography test paper;
the immunochromatographic test paper sequentially comprises a sample combination pad containing UCP particle labeled antibodies, an NC membrane containing a T line and a C line and a water absorption pad according to the sample flowing direction;
the T-line is formed from streptavidin;
the C-line is formed by a secondary antibody of the UCP particle-labeled antibody;
2) a CRISPR reaction system;
the CRISPR reaction system comprises crRNA, Cas protein, probes of two-end labeled biotin and FAM, and recombinase polymerase amplification primers;
the Cas protein is a Cas protein in a second type V or VI CRISPR system;
two ends of the probe are respectively marked with biotin and a group capable of being combined with the UCP particle marked antibody;
the crRNA comprises a target sequence of a pathogen nucleic acid;
the recombinase polymerase amplification primer is a recombinase polymerase amplification primer capable of amplifying a target sequence.
2. The kit of claim 1, wherein: the Cas protein is a Cas12a protein.
3. The kit according to claim 1 or 2, characterized in that: the two ends of the nucleotide probe of the probe are respectively marked with biotin and fluorescein.
4. The kit according to any one of claims 1 to 3, wherein: the UCP particle labeled antibody is an anti-FAM antibody.
5. The kit according to any one of claims 1 to 4, wherein:
the pathogen is plague bacillus;
the crRNA is specifically combined with the pla gene of the plague bacillus nucleic acid, specifically combined with the lcrV gene of the plague bacillus nucleic acid and/or specifically combined with the ymt gene of the plague bacillus nucleic acid.
6. The kit of claim 5, wherein:
the recombinase polymerase amplification primer is a primer capable of specifically amplifying the pla gene full length or part of the plague bacillus nucleic acid, a primer capable of specifically amplifying the lcrV gene full length or part of the plague bacillus nucleic acid and/or a primer capable of specifically amplifying the ymt gene full length or part of the plague bacillus nucleic acid.
7. The kit according to any one of claims 1 to 6, wherein:
the nucleotide sequence of the crRNA is sequence 1, sequence 2 or sequence 3 in the sequence table;
or, the recombinase polymerase amplification primer consists of a single-stranded DNA molecule shown in a sequence 4 and a single-stranded DNA molecule shown in a sequence 5;
or, the recombinase polymerase amplification primer consists of a single-stranded DNA molecule shown in a sequence 6 and a single-stranded DNA molecule shown in a sequence 7;
or, the recombinase polymerase amplification primer consists of a single-stranded DNA molecule shown in a sequence 8 and a single-stranded DNA molecule shown in a sequence 9;
or the nucleotide sequence of the probe with two ends labeled with biotin and FAM is composed of 5C.
8. Use of a kit according to any one of claims 1 to 7 for the preparation of a product having at least one of the following functions 1) to 4):
1) detecting whether the target nucleic acid is a pathogen nucleic acid;
2) detecting whether a sample to be detected contains pathogen nucleic acid or not;
3) detecting whether the bacteria to be detected are plague bacteria or not;
4) and detecting whether the sample to be detected contains the plague bacillus.
9. Use according to claim 8, characterized in that: the pathogen nucleic acid is plague bacillus nucleic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110253881.8A CN115044652A (en) | 2021-03-09 | 2021-03-09 | Nucleic acid detection kit based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110253881.8A CN115044652A (en) | 2021-03-09 | 2021-03-09 | Nucleic acid detection kit based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115044652A true CN115044652A (en) | 2022-09-13 |
Family
ID=83156665
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110253881.8A Pending CN115044652A (en) | 2021-03-09 | 2021-03-09 | Nucleic acid detection kit based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115044652A (en) |
-
2021
- 2021-03-09 CN CN202110253881.8A patent/CN115044652A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111778357B (en) | CRISPR/Cas12 a-based respiratory syncytial virus nucleic acid rapid detection kit and detection method thereof | |
| Böhm et al. | Real‐time quantitative PCR: DNA determination in isolated spores of the mycorrhizal fungus Glomus mosseae and monitoring of Phytophthora infestans and Phytophthora citricola in their respective host plants | |
| CN111187804A (en) | Rapid detection kit and detection method for mycoplasma pneumoniae nucleic acid based on CRISPR/Cas12a | |
| CN102373273A (en) | Kit for detecting nucleic acid of mycobacterium tuberculosis and method thereof | |
| CN111812066A (en) | Biosensor based on CRISPR/Cas12a system, kit and application of biosensor in small molecule detection | |
| JungehÜLsing et al. | Analysis of genetic diversity in Claviceps purpurea by RAPD markers | |
| Sadler et al. | Ultra-high throughput functional enrichment of large monoamine oxidase (MAO-N) libraries by fluorescence activated cell sorting | |
| CN111521781B (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
| Mustafakulov et al. | Prospects of aptamer application in diagnostics of bacterial infections | |
| CN103725686A (en) | Aptamer AFB1-20 of aflatoxin B1 and application thereof | |
| Jiang et al. | Simple and rapid detection Aspergillus fumigatus by loop‐mediated isothermal amplification coupled with lateral flow biosensor assay | |
| EP3108007B1 (en) | A method of detecting a microorganism in a sample by a fluorescence based detection method using somamers | |
| WO2005083114A1 (en) | Method, kit and system for enhanced nested pcr | |
| Stark et al. | Immunomagnetic separation and solid-phase detection of Bordetella pertussis | |
| Jiang et al. | A dual-labeled fluorescence quenching lateral flow assay based on one-pot enzyme-free isothermal cascade amplification for the rapid and sensitive detection of pathogens | |
| CN112680550A (en) | Immunochromatography method for detecting SARS-CoV-2N gene mediated by dcas9 | |
| CN115044652A (en) | Nucleic acid detection kit based on CRISPR/Cas12a system and up-conversion luminescent particle immunochromatography and application | |
| CN110551623A (en) | Paper microfluid chip, device and kit for nucleic acid detection and application thereof | |
| KR102108855B1 (en) | Method for quantification of nucleic acids wherein stable isotope-labelled nucleic acids are used as internal standards and uses thereof | |
| US20220090174A1 (en) | Detection method for a target nucleic acid and kit | |
| Xu et al. | Sandwich capture ultrasensitive sensor based on biohybrid interface for the detection of Cronobacter sakazakii | |
| Wang et al. | Rapid visual nucleic acid detection of Vibrio alginolyticus by recombinase polymerase amplification combined with CRISPR/Cas13a | |
| CN112779346A (en) | Immunochromatography method for detecting mycobacterium tuberculosis under mediation of dcas9 | |
| Pohanka et al. | Current and emerging assays for Francisella tularensis detection: a review | |
| Williams et al. | Immunoelectrophoretic analysis of cytoplasmic proteins of Neurospora crassa |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |