CN115039612A - Method for identifying Spodoptera frugiperda strain and verification method - Google Patents

Method for identifying Spodoptera frugiperda strain and verification method Download PDF

Info

Publication number
CN115039612A
CN115039612A CN202210684764.1A CN202210684764A CN115039612A CN 115039612 A CN115039612 A CN 115039612A CN 202210684764 A CN202210684764 A CN 202210684764A CN 115039612 A CN115039612 A CN 115039612A
Authority
CN
China
Prior art keywords
spodoptera frugiperda
identifying
color
rice
mtcoi
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210684764.1A
Other languages
Chinese (zh)
Inventor
萧玉涛
李洪冉
韩秀
梁馨月
朱经云
彭炎
王鹏
靳明辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agricultural Genomics Institute at Shenzhen of CAAS
Original Assignee
Agricultural Genomics Institute at Shenzhen of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agricultural Genomics Institute at Shenzhen of CAAS filed Critical Agricultural Genomics Institute at Shenzhen of CAAS
Priority to CN202210684764.1A priority Critical patent/CN115039612A/en
Publication of CN115039612A publication Critical patent/CN115039612A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G13/00—Protecting plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Environmental Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)

Abstract

The invention provides a method for identifying Spodoptera frugiperda strain and a verification method, and relates to the technical field of agricultural biology. The inventor successfully screens and establishes rice type spodoptera frugiperda and maize type spodoptera frugiperda population indoors through mtCOI gene, finds through research that the egg color of two above strains has very big difference, and rice type egg piece color is brown promptly, and maize type egg piece color is green, can be fast audio-visual according to the egg piece color realize the differentiation to rice type spodoptera frugiperda and maize type spodoptera frugiperda. The method for identifying the Spodoptera frugiperda strain is simple and convenient, saves time and labor, saves experimental cost and greatly improves the population establishment efficiency. The verification method provided by the invention can effectively verify the accuracy of the method for identifying the Spodoptera frugiperda strain.

Description

Method for identifying Spodoptera frugiperda strain and verification method
Technical Field
The invention relates to the technical field of agricultural biology, in particular to a method for identifying Spodoptera frugiperda strain and a verification method.
Background
Spodoptera frugiperda is mainly divided into two biological types, namely Rice type (Rice strain) and Corn type (Corn strain), wherein the Rice type mainly eats crops such as Rice, alfalfa and pasture, and the Corn type mainly eats Corn, sorghum and cotton. Both of them are morphologically indistinguishable and have identical sex pheromone components, and can even be crossed to produce fertile offspring. Currently, cytochrome C oxidase subunit I gene (COI) of mitochondria and glyceraldehyde phosphate isomerase gene (Tpi) located on Z chromosome are the most commonly used and mature molecular marker genes for identifying different biotypes of spodoptera frugiperda.
The traditional method for identifying Spodoptera frugiperda rice type and corn type by utilizing mitochondrion COI gene (mtCOI gene) is time-consuming and labor-consuming, has high cost, and is not beneficial to large-scale rapid identification of Spodoptera frugiperda. In addition, a rapid and visual identification method is urgently needed for the problems of establishment of indoor spodoptera frugiperda biotype populations, population purity detection in a long-term feeding process and the like.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first purpose of the invention is to provide a method for identifying Spodoptera frugiperda strains, which is simple and convenient, and can quickly and intuitively identify the Spodoptera frugiperda strains so as to solve at least one of the problems.
A second object of the present invention is to provide a verification method.
In a first aspect, the invention provides a method for identifying Spodoptera frugiperda strains, which is used for identifying the Spodoptera frugiperda strains according to the color of Spodoptera frugiperda egg masses;
the Spodoptera frugiperda strain comprises rice Spodoptera frugiperda and corn Spodoptera frugiperda;
the color of the rice spodoptera frugiperda egg mass is brown, and the color of the corn spodoptera frugiperda egg mass is green.
As a further technical scheme, the color of the rice type spodoptera frugiperda egg masses is grayish brown.
As a further technical scheme, the color of the spodoptera frugiperda egg masses is green.
As a further technical scheme, the egg mass is within 2 days after delivery.
As a further technical scheme, the sequence of the mtCOI gene of the rice spodoptera frugiperda is shown as SEQ ID NO. 1.
As a further technical scheme, the sequence of the mtCOI gene of the Spodoptera frugiperda is shown as SEQ ID NO. 2.
In a second aspect, the present invention provides a method for verifying the accuracy of a method for identifying spodoptera frugiperda strains, comprising the steps of:
obtaining a sequence of an mtCOI gene of spodoptera frugiperda to be detected, and verifying the accuracy of the method for identifying the spodoptera frugiperda strain according to the sequence of the mtCOI gene;
the sequence of the mtCOI gene of the rice spodoptera frugiperda is shown as SEQ ID NO. 1;
the sequence of the mtCOI gene of the maize spodoptera frugiperda is shown as SEQ ID NO. 2.
As a further technical scheme, the method for obtaining the sequence of the mtCOI gene of the Spodoptera frugiperda to be detected comprises gene sequencing.
As a further technical scheme, the step of obtaining the sequence of the mtCOI gene of the Spodoptera frugiperda to be detected comprises the following steps: and extracting DNA of spodoptera frugiperda to be detected, amplifying the mtCOI gene, and sequencing the amplification product to obtain the sequence of the mtCOI gene of the spodoptera frugiperda to be detected.
As a further technical scheme, the sequences of the primers for amplifying the Spodoptera frugiperda mtCOI gene are shown as SEQ ID NO.3 and SEQ ID NO. 4.
Compared with the prior art, the invention has the following beneficial effects:
the inventor successfully screens and establishes rice type spodoptera frugiperda and maize type spodoptera frugiperda population indoors through mtCOI gene, finds through research that the egg color of two above strains has very big difference, and rice type egg piece color is brown promptly, and maize type egg piece color is green, can be fast audio-visual according to the egg piece color realize the differentiation to rice type spodoptera frugiperda and maize type spodoptera frugiperda. The method for identifying the Spodoptera frugiperda strain is simple and convenient, saves time and labor, saves experimental cost and greatly improves the population establishment efficiency.
The verification method provided by the invention can effectively verify the accuracy of the method for identifying the Spodoptera frugiperda strain.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 shows the results of agarose electrophoresis;
FIG. 2 is a graph showing the difference in rice type and maize type Spodoptera frugiperda mitochondrial COI gene sequences;
FIG. 3 is a plot of rice and maize spodoptera frugiperda egg mass color;
FIG. 4 is a Spodoptera frugiperda egg mass provided in example 2;
FIG. 5 is the sequence differences of spodoptera frugiperda egg masses provided in example 2;
FIG. 6 is an egg mass of Spodoptera frugiperda as provided in example 3;
FIG. 7 is the sequence differences for spodoptera frugiperda egg masses provided in example 3.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to embodiments and examples, but those skilled in the art will understand that the following embodiments and examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Those who do not specify the conditions are performed according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
In a first aspect, the invention provides a method for identifying Spodoptera frugiperda strains, which is used for identifying the Spodoptera frugiperda strains according to the color of Spodoptera frugiperda egg masses;
the spodoptera frugiperda strain comprises rice type spodoptera frugiperda and corn type spodoptera frugiperda;
the color of the rice spodoptera frugiperda egg mass is brown, and the color of the corn spodoptera frugiperda egg mass is green.
The inventor successfully screens and establishes rice type spodoptera frugiperda and maize type spodoptera frugiperda population indoors through mtCOI gene, finds through research that the egg color of two above strains has very big difference, and rice type egg piece color is brown promptly, and maize type egg piece color is green, can be fast audio-visual according to the egg piece color realize the differentiation to rice type spodoptera frugiperda and maize type spodoptera frugiperda. The method for identifying the Spodoptera frugiperda strain is simple and convenient, saves time and labor, saves experimental cost and greatly improves the population establishment efficiency.
In some preferred embodiments, the rice spodoptera frugiperda egg mass is a grayish brown color.
The inventor finds that the color of the rice spodoptera frugiperda egg masses is concentrated and shows a grayish brown color.
In some preferred embodiments, the corn spodoptera frugiperda egg mass is turquoise in color.
The inventor researches and discovers that the color of the spodoptera frugiperda egg masses is concentrated and appears greenish.
In some preferred embodiments, the egg mass is within 2 days of post partum.
Spodoptera frugiperda usually hatches as larvae the third day after egg laying, and therefore, identification is required before hatching.
In some preferred embodiments, the sequence of the mtCOI gene of Spodoptera frugiperda is shown in SEQ ID No. 1.
TTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAATAATATAAGTTTTTGACTTTTACCCCCATCTTTAACTTTATTAATTTCTAGTAGCATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCCCTCTCCTCTAATATTGCTCATGGTGGTAGTTCAGTAGATTTAGCTATTTTCTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACCACTATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACCGCATTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATCTAAATACATCATTTTTCGATCCTGCAGGAGGAGGTGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTATATATTTTAATTTTACCGGGATTTGGTATAATTTCTCACATTATTTCTCAAGAAAGAGGTAAAAAGGAAACATTTGGATGTTTAGGTATAATTTATGCTATATTAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACACGAGCA(SEQ ID NO.1)。
In some preferred embodiments, the mtCOI gene of Spodoptera frugiperda has the sequence shown in SEQ ID No. 2.
TTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGTATAAATAATATAAGTTTTTGACTTTTACCCCCATCTTTAACTTTATTAATTTCTAGTAGCATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCCCTCTCCTCTAATATTGCTCATGGTGGTAGTTCAGTAGATTTAGCTATTTTCTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACTACTATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACTGCATTCTTATTATTATTATCTTTACCTGTTTTAGCCGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACATCATTTTTCGATCCTGCAGGTGGAGGTGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTATATATTTTAATTTTACCAGGATTTGGTATAATTTCTCATATTATTTCCCAAGAAAGAGGTAAAAAGGAAACATTCGGGTGTTTAGGTATAATTTACGCTATACTAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACACGAGCA(SEQ ID NO.2)。
The inventor discovers that the rice type has the sequence GAGCTC at the position of 105-111bp and the maize type has the sequence GAGCCC at the corresponding position by analyzing the rice type and maize type mtCOI sequences (1-752 bp). Through further research, the egg masses of Spodoptera frugiperda rice type and corn type strains have very large differences in color, and the egg masses have heritability in color, and correspond to the rice type and the corn type one by one.
In a second aspect, the present invention provides a method for verifying the accuracy of a method for identifying spodoptera frugiperda strains, comprising the steps of:
obtaining a sequence of an mtCOI gene of spodoptera frugiperda to be detected, and verifying the accuracy of the method for identifying the spodoptera frugiperda strain according to the sequence of the mtCOI gene;
the sequence of the mtCOI gene of the rice spodoptera frugiperda is shown as SEQ ID NO. 1;
the sequence of the mtCOI gene of the maize spodoptera frugiperda is shown as SEQ ID NO. 2.
The verification method provided by the invention can accurately distinguish the Spodoptera frugiperda and the Spodoptera zeae according to the sequences of the mtCOI genes of the two genes, and compare the verification result with the identification result, thereby verifying the accuracy of the identification method.
In some preferred embodiments, the method of obtaining the sequence of the mtCOI gene of spodoptera frugiperda to be tested comprises gene sequencing.
In some preferred embodiments, the step of obtaining the sequence of the mtCOI gene of spodoptera frugiperda to be tested comprises: and extracting DNA of spodoptera frugiperda to be detected, amplifying the mtCOI gene, and sequencing the amplification product to obtain the sequence of the mtCOI gene of the spodoptera frugiperda to be detected.
In some preferred embodiments, the sequences of the primers for amplifying the Spodoptera frugiperda mtCOI gene are shown as SEQ ID NO.3 and SEQ ID NO. 4.
The upstream primer COI-F: 5'-TTCGAGCTGAATTAGGGACTC-3' (SEQ ID NO. 3);
downstream primer Hap-R: 5'-GATGTAAAATATGCTCGTGT-3' (SEQ ID NO. 4).
The primer has strong specificity, and can specifically realize amplification of the mtCOI gene.
The invention is further illustrated by the following specific examples and comparative examples, but it should be understood that these examples are for purposes of illustration only and are not to be construed as limiting the invention in any way.
Example 1
Firstly, a large number of spodoptera frugiperda larvae of 3-5 th instar are collected in the third city of Hainan province, the spodoptera frugiperda larvae are taken back to a laboratory to be raised, after the spodoptera frugiperda larvae are eclosized into adults, a single male and female pair is continuously raised in a plastic cup, and 50 repetitions are arranged in total. After the egg is laid, the biotypes of parents and offspring (a few eggs are randomly selected) are detected through mtCOI genes, and the repetition of the detection of the same biotype is mixed together to establish RICE type (RICE) and CORN type (CORN) line populations.
The specific identification method for Spodoptera frugiperda mitochondrial rice type and maize type is as follows:
the primer for amplification of the mtCOI gene has an upstream primer nucleic acid sequence shown as SEQ ID NO.3 and a downstream primer nucleic acid sequence shown as SEQ ID NO. 4.
The upstream primer COI-F: 5'-TTCGAGCTGAATTAGGGACTC-3' (SEQ ID NO. 3);
downstream primer Hap-R: 5'-GATGTAAAATATGCTCGTGT-3' (SEQ ID NO. 4).
The method comprises the following steps:
(1) extracting genomic DNA of spodoptera littoralis to prepare a genomic DNA solution;
(2) performing PCR amplification on a mitochondrial COI gene in the genomic DNA by using the genomic DNA prepared in the step (1) as a template and using the primer to prepare a PCR amplification product;
(3) the PCR amplification product is directly and bidirectionally sequenced.
Wherein, the amplification system of the PCR amplification in the step (2) is as follows:
1 mu L of genome DNA solution, 1 mu L of each forward primer and reverse primer of 10 mu M, and 22 mu L of gold medal Mix (Beijing Optimalaceae, New Biotechnology Co., Ltd.);
the amplification conditions for PCR amplification in step (2) are as follows:
pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 48 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, and 35 cycles; extension at 72 ℃ for 5 minutes. After the PCR amplification is finished, the amplification result is detected by using 1% agarose electrophoresis (figure 1), and a single-fragment PCR product with the same length as the target fragment is selected and sent to the company Limited in the biological engineering (Shanghai) for gel cutting and sequencing.
(4) The rice type and maize type mtCOI sequences (1-752bp) are analyzed to find that the rice type has a sequence of GAGCTC at the position of 105-111bp and the maize type has a sequence of GAGCCC at the corresponding position, as shown in FIG. 2.
Further studies found that the spodoptera frugiperda rice type and corn type lines had very different egg masses in color, and the egg masses were heritable in color, corresponding one-to-one to the rice type and corn type (fig. 3). Based on the technical scheme, two types of eggs are distinguished according to the color of the egg mass.
Example 2
Spodoptera frugiperda is collected in Nanning City of Guangxi province, brought back to a laboratory for feeding, and after the Spodoptera frugiperda lays eggs (figure 4), No. 1-10 is preliminarily identified as rice type and No. 11-20 is maize type strain according to the color of egg masses.
And (3) verifying the identification result: the two biotypes were verified with reference to the method and procedure for identifying Spodoptera frugiperda mitochondrial rice type and maize type in example 1, and the types of Spodoptera frugiperda eggs No. 1-20 were obtained based on the sequence differences at 111bp between the rice type and maize type 105-. The result shows that the identification result of the identification method provided by the invention is consistent with the identification result of the mitochondrial COI gene, and the identification method provided by the invention can be used for identifying two biotypes of spodoptera frugiperda.
Example 3
Spodoptera frugiperda is collected in Jiangcheng county of Yunnan province, brought back to a laboratory for feeding, and after the Spodoptera frugiperda lays eggs (figure 6), No. 1-6 is preliminarily identified as rice type and No. 7-12 is corn type strain according to the color of egg masses.
And (3) verifying the identification result: with reference to the method and procedure for identifying Spodoptera frugiperda mitochondrial rice type and maize type in example 1, the two biotypes were verified, and the types of Spodoptera frugiperda eggs No. 1-12 were obtained based on the sequence differences at 111bp between the rice type and maize type (FIG. 7). The result shows that the identification result of the identification method provided by the invention is consistent with the identification result of the mitochondrial COI gene, and the identification method provided by the invention can be used for identifying two biotypes of spodoptera frugiperda.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Shenzhen agricultural genome institute of Chinese agricultural science institute
<120> method for identifying Spodoptera frugiperda strain and verification method
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 752
<212> DNA
<213> Spodoptera frugiperda (Spodoptera frugiperda)
<400> 1
tttataatac tattgtaaca gcccatgctt ttattataat tttttttata gttataccaa 60
ttataattgg aggatttgga aattgacttg tacctttaat attaggagct cctgatatag 120
ctttcccacg tataaataat ataagttttt gacttttacc cccatcttta actttattaa 180
tttctagtag cattgtagaa aatggagcag gaactggatg aacagtttac ccccccctct 240
cctctaatat tgctcatggt ggtagttcag tagatttagc tattttctca cttcatttag 300
ctggaatttc atctatttta ggagctatta actttattac cactattatt aatatacgat 360
taaataattt atcatttgat caaatacctt tatttatttg agctgtaggt attaccgcat 420
ttttattatt attatcttta cctgttttag ctggagctat tactatatta cttactgatc 480
gaaatctaaa tacatcattt ttcgatcctg caggaggagg tgatcctatt ctttatcaac 540
atttattttg attttttgga catcctgaag tatatatttt aattttaccg ggatttggta 600
taatttctca cattatttct caagaaagag gtaaaaagga aacatttgga tgtttaggta 660
taatttatgc tatattagca attggtttat taggatttat tgtttgagct catcatatat 720
ttactgtagg aatagatatt gatacacgag ca 752
<210> 2
<211> 752
<212> DNA
<213> Spodoptera frugiperda (Spodoptera frugiperda)
<400> 2
tttataatac tattgtaaca gctcatgctt ttattataat tttttttata gttataccta 60
ttataattgg aggatttgga aattgacttg tacctttaat attaggagcc cctgatatag 120
ctttcccacg tataaataat ataagttttt gacttttacc cccatcttta actttattaa 180
tttctagtag cattgtagaa aatggagcag gaactggatg aacagtttac ccccccctct 240
cctctaatat tgctcatggt ggtagttcag tagatttagc tattttctca cttcatttag 300
ctggaatttc atctatttta ggagctatta actttattac tactattatt aatatacgat 360
taaataattt atcatttgat caaatacctt tatttatttg agctgtaggt attactgcat 420
tcttattatt attatcttta cctgttttag ccggagctat tactatatta cttactgatc 480
gaaatttaaa tacatcattt ttcgatcctg caggtggagg tgatcctatt ctttatcaac 540
atttattttg attttttgga catcctgaag tatatatttt aattttacca ggatttggta 600
taatttctca tattatttcc caagaaagag gtaaaaagga aacattcggg tgtttaggta 660
taatttacgc tatactagca attggtttat taggatttat tgtttgagct catcatatat 720
ttactgtagg aatagatatt gatacacgag ca 752
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<400> 3
ttcgagctga attagggact c 21
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
gatgtaaaat atgctcgtgt 20

Claims (10)

1. A method for identifying Spodoptera frugiperda strains is characterized in that the Spodoptera frugiperda strains are identified according to the color of Spodoptera frugiperda egg masses;
the Spodoptera frugiperda strain comprises rice Spodoptera frugiperda and corn Spodoptera frugiperda;
the color of the rice spodoptera frugiperda egg mass is brown, and the color of the corn spodoptera frugiperda egg mass is green.
2. The method of identifying spodoptera frugiperda strains of claim 1, wherein the rice spodoptera frugiperda egg mass is grayish brown in color.
3. The method of identifying a spodoptera frugiperda strain of claim 1, wherein the corn-type spodoptera frugiperda egg masses are turquoise in color.
4. The method of identifying a spodoptera frugiperda strain of claim 1, wherein the egg mass is an egg mass within 2 days post-partum.
5. The method for identifying Spodoptera frugiperda strains according to claim 1, wherein the mtCOI gene sequence of the rice Spodoptera frugiperda is shown as SEQ ID No. 1.
6. The method for identifying Spodoptera frugiperda lines as claimed in claim 1, wherein the mtCOI gene sequence of the maize-type Spodoptera frugiperda is shown in SEQ ID No. 2.
7. A verification method for verifying the accuracy of the method of claims 1-6, comprising the steps of:
obtaining an mtCOI gene sequence of spodoptera frugiperda to be detected, and verifying the accuracy of the method according to the mtCOI gene sequence in claims 1-6;
the mtCOI gene sequence of the rice spodoptera frugiperda is shown as SEQ ID NO. 1;
the mtCOI gene sequence of the maize spodoptera frugiperda is shown as SEQ ID NO. 2.
8. The validation method of claim 7, wherein the method of obtaining the mtCOI gene sequence of Spodoptera frugiperda to be tested comprises gene sequencing.
9. The assay method of claim 7, wherein the step of obtaining the mtCOI gene sequence of Spodoptera frugiperda to be tested comprises: and extracting DNA of spodoptera frugiperda to be detected, amplifying the mtCOI gene, and sequencing the amplification product to obtain the mtCOI gene sequence of the spodoptera frugiperda to be detected.
10. The method according to claim 9, wherein the primer for amplifying the spodoptera frugiperda mtCOI gene has a sequence shown in SEQ ID No.3 and SEQ ID No. 4.
CN202210684764.1A 2022-06-16 2022-06-16 Method for identifying Spodoptera frugiperda strain and verification method Pending CN115039612A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210684764.1A CN115039612A (en) 2022-06-16 2022-06-16 Method for identifying Spodoptera frugiperda strain and verification method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210684764.1A CN115039612A (en) 2022-06-16 2022-06-16 Method for identifying Spodoptera frugiperda strain and verification method

Publications (1)

Publication Number Publication Date
CN115039612A true CN115039612A (en) 2022-09-13

Family

ID=83161601

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210684764.1A Pending CN115039612A (en) 2022-06-16 2022-06-16 Method for identifying Spodoptera frugiperda strain and verification method

Country Status (1)

Country Link
CN (1) CN115039612A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117089632A (en) * 2023-10-19 2023-11-21 中国热带农业科学院三亚研究院 Sequence combination for rapidly detecting spodoptera frugiperda based on CRISPR/Cas12a-RPA and application thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117089632A (en) * 2023-10-19 2023-11-21 中国热带农业科学院三亚研究院 Sequence combination for rapidly detecting spodoptera frugiperda based on CRISPR/Cas12a-RPA and application thereof

Similar Documents

Publication Publication Date Title
Wang et al. Identification of circular RNAs in kiwifruit and their species-specific response to bacterial canker pathogen invasion
CN106086013B (en) A kind of probe and design method for nucleic acid enriching capture
CN111363783B (en) T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on specific recognition sequence
CN106868226A (en) A kind of primer and probe of the detection of duck New-type adenovirus real-time fluorescence quantitative PCR
CN115039612A (en) Method for identifying Spodoptera frugiperda strain and verification method
CN110628943A (en) Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit
CN109988847B (en) Method for detecting CNV (CNV) marker of ShE gene of Tekaka sheep and application of CNV marker
KR100753676B1 (en) TRIM-Br1 and TRIM-Br2 DNA marker system using the same and classification method using the same
CN112746116B (en) Litopenaeus vannamei female DNA label sequence, primer and application thereof in sex identification
CN108517368B (en) Method and system for analyzing interaction relation of LncRNA Pto-CRTG and target gene Pto-CAD5 of Chinese white poplar by using epistasis
CN110396558B (en) Multiplex nested PCR (polymerase chain reaction) amplification primer and kit for simultaneously detecting five typical pathogens of cultured prawns
CN107988418B (en) Primer group, kit and method for pure heterozygous identification of transgenic papaya YK16-0-1 transformant
CN113265483B (en) Method for rapidly identifying 4St chromosome of Elytrigia intermedium
KR20170045848A (en) Molecular marker for validating seed size of watermelon and use thereof
CN109266723A (en) Rare mutation detection method, its kit and application
CN108866232B (en) Detection primer and kit for cytoplasmic male sterility restoring gene Rf (DW)11 of Dongfu-type rice, application and detection method
CN110714093B (en) SCAR molecular marker related to banana wilt resistance and detection method and application thereof
CN108950050B (en) Detection primer and kit for cytoplasmic male sterility restoring gene Rf (DW)10 of Dongfu-type rice, application and detection method
CN108384886B (en) Detection primer group and kit for alfalfa bean SSR marker, application of detection primer group and kit and screening method for alfalfa bean self-compatibility genotype
CN107099590B (en) Codominant functional molecular marker Pi9InDel2 of rice blast resistance Pi9 gene and application thereof
KR101716029B1 (en) Sequence Characterized Amplified Region Molecular Marker Related to WMV and ZYMV resistance Characteristic in Squash and use thereof
CN108866231B (en) Detection primer and kit for cytoplasmic male sterility restoring gene Rf (DW)8 of Dongfu-type rice, application and detection method
CN116891853B (en) Carp genetic sex identification method and sex marker
CN117535392B (en) RPA primer and kit for identifying sex of swan and application
CN108728903A (en) The banking process of thalassemia large sample screening is used for based on high-flux sequence

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination