CN115028692A

CN115028692A - Bacillus subtilis antibacterial peptide BsR1 and application thereof

Info

Publication number: CN115028692A
Application number: CN202210714854.0A
Authority: CN
Inventors: 宋沛; 董五辈
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-06-22
Filing date: 2022-06-22
Publication date: 2022-09-09
Anticipated expiration: 2042-06-22
Also published as: CN115028692B

Abstract

The invention belongs to the field of biotechnology, and particularly discloses a bacillus subtilis antimicrobial peptide BsR1 and application thereofBacillus subtilis) 330-2 genome library, and finally obtaining the antibacterial peptide BsR1 through screening, bioinformatics prediction and modification. The applicant finds that the antibacterial peptide BsR1 has an inhibiting effect on the growth of rice bacterial blight bacteria (two physiological races), rice bacterial streak bacteria, xanthomonas campestris, various bacillus and the like, has strong thermal stability and ultraviolet stability, is harmless to mammals and people, has no hemolysis, can be applied to biological control of plant diseases and insect pests, or can be used as an antibacterial agent.

Description

Bacillus subtilis antibacterial peptide BsR1 and application thereof

Technical Field

The field belongs to the field of biotechnology, and particularly relates to a bacillus subtilis antimicrobial peptide BsR1 and application thereof.

Background

Bacillus subtilis belongs to Bacillus, gram-positive bacteria and periphytic flagellum, can move and form endogenous adversity-resistant spores, and is an aerobic bacterium. The bacillus subtilis is also a plant endophyte and plays an important role in plant health and disease resistance. Endogenous bacteria occur at a lower density than pathogens and do not normally cause any allergic reactions in the host, indicating that host plants do not regard them as pathogens (Hallmann, von quadrat et al.2011). Several endophytes and rhizobacteria have been reported to have beneficial effects on crop health (Wilhelm, Arthofer et al 1998, Santoyo, Moreno-Hagelsieb et al 2015, Goswami, Deka et al 2017, Walitang, Kim et al 2017). The bacterial genera reported as endophytes in different plants include Bacillus, Burkholderia, Cellulomonas, clavibacterium, Campylobacter, Bacillus, Pseudomonas, Rhizobium, Serratia, etc. (Recuenco and Vuurde 2000, Lodewayckx, Vangronsveld et al 2002, Zinniel, Lambrcht et al 2002). Most endophytes originate from the rhizosphere. However, it has also been reported that certain bacteria vertically spread through seeds (Truyens, Weyens et al 2014). Many endophytic bacteria exhibit antagonistic potential against fungal plant pathogens. Endophytes can also benefit from the production of a range of natural products which can be used in medicine, agriculture or industry (Ryan, germane et al 2008).

Antimicrobial peptides (AMPs), also known as host defense peptides, are short, usually positively charged peptides that are present in a variety of life forms from microorganisms to humans (Mahlapuu, Hakansson et al.2016). Usually less than 30-40 amino acids, and generally have antimicrobial activity. AMPs are diverse and can be subdivided into groups according to their source, composition and structure. However, they also share certain common structural features, such as (i) amino acid composition: the most abundant residues in AMP are cationic (arginine and lysine) and hydrophobic (tryptophan, phenylalanine, leucine, and isoleucine); (ii) net charge: most AMPs are positively charged at physiological pH, although a small subset includes anionic peptides; (iii) amphiphilicity: conferred by its amino acid composition and arrangement; (iv) structural and conformational diversity, including α -helices, β -sheets, unconventional structures, and even expanded conformations (the latter two are particularly abundant in short AMPs). Most of these structures are amphiphilic and are induced under specific experimental conditions, which also facilitates their interaction with the lipid bilayer. Indeed, biofilm-induced AMP amphiphilicity is a hallmark property associated with antibacterial activity (Marcos, Munoz et al 2008). By utilizing the basic characteristics of the antibacterial peptide and combining bioinformatics prediction and reasonable design, the antibacterial peptide BsR1 with broad-spectrum resistance is finally synthesized, and the antibacterial peptide BsR1 has good antibacterial activity and stability through in vitro antibacterial experiment determination and can be used as the basis of antibacterial agent research in the future.

Disclosure of Invention

The invention aims to provide a bacillus subtilis antibacterial peptide BsR1, wherein the amino acid sequence of the antibacterial peptide is shown in SEQ ID No. 1.

The invention also aims to provide application of the bacillus subtilis antibacterial peptide BsR1 in preparation of bacteriostatic agents.

In order to achieve the purpose, the invention adopts the following technical scheme:

the applicant constructs a high-quality bacillus subtilis 330-2 genome library, transforms fusarium graminearum 5035 strain by using a homologous recombination method, screens mutants with larger differences in phenotype, and detects an insert by PCR. Constructing the screened gene on a pBE-S vector, and expressing the gene by using an indicator bacterium built-in library technology. The polypeptide has antibacterial activity, leads to the death of host cells by lysis, predicts an active region by using a bioinformatics means and synthesizes a short peptide. The amino acid sequence of the antibacterial peptide is shown in SEQ ID NO. 1. The antibacterial peptide can be obtained by a mode of preparing protein in any field, including but not limited to prokaryotic expression, synthesis and the like.

The nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1 also belongs to the protection scope of the present invention.

The application of the antibacterial peptide BsR1 comprises preparing bacteriostatic agent and antibacterial drug by using the antibacterial peptide; as can be seen from electron microscope experiments, the bacteriostatic peptide provided by the invention achieves the bacteriostatic purpose by destroying bacterial cell membranes.

The bacteria that can be inhibited by the bacteriostatic agent include but are not limited to: bacillus subtilis (b), ralstonia solanacearum (r), Xanthomonas oryzae pathovar oryzae (pv. oryzicola), Xanthomonas oryzae pathovar graminis (c.fangii), Xanthomonas campestris pathovar campestris (xathomonas campestris pv. holcocola), and/or tomato canker germ (c.microganensis).

Compared with the prior art, the invention has the following advantages:

the antibacterial peptide BsR1 provided by the invention can effectively inhibit the normal growth of tested gram-positive bacteria and gram-negative bacteria, and has strong thermal stability and ultraviolet stability. Hemolysis experiment and toxicity experiment prove that the gene is harmless to mammals and human beings. The antibacterial peptide gene is obtained by screening from bacillus subtilis, and is expected to be used for biological control in important pest control on rice in later-stage research, or can be used as an antibacterial agent.

Drawings

FIG. 1 is a diagram of the results of the bacteriostatic test of the screened antibacterial peptide BsR1 double-layer plate;

in FIG. 1, A is Bacillus sp.A, B is Bacillus sp.K1, C is Rastonia solanaceum R21-5, D is Xanthomonas oryzae pv. oryzicola RH3, E is Xanthomonas oryzae pv. oryzae XG-25, F is Xanthomonas oryzae pv. oryzae Xoo, G is Clavibacter fangii strain, H is Xanthomonas campestris pv. holcola 1.153, and I is Clavibacter microorganisis YCK.

FIG. 2 is a Minimum Inhibitory Concentration (MIC) assay for the antimicrobial peptide BsR 1;

wherein the ordinate is the value of OD600 and the abscissa is the final concentration of the diluted antimicrobial peptide. The negative control was sterile water and the positive control was polymyxin b (polymyxin b).

FIG. 3 is a graph showing the results of the acid-base stability assay of antibacterial peptide BsR 1;

wherein, I is co-incubation treatment of antibacterial peptide BsR1 and HCl (pH 3) solution, II is co-incubation treatment of antibacterial peptide BsR1 and HCl (pH 4) solution, III is co-incubation treatment of antibacterial peptide BsR1 and HCl (pH 5) solution, IV is co-incubation treatment of antibacterial peptide BsR1 and NaOH (pH 8) solution, V is co-incubation treatment of antibacterial peptide BsR1 and NaOH (pH 9) solution, VI is co-incubation treatment of antibacterial peptide BsR1 and NaOH (pH 10) solution, VII is co-incubation treatment of antibacterial peptide BsR1 and H (pH 3) solution ₂ Co-incubation treatment with O (pH 6) solution.

FIG. 4 is a graph showing the results of measurement of the thermostability of the antibacterial peptide BsR 1;

wherein, I is the antibacterial peptide BSR1 treated in 50 ℃ water bath for 30min, II is the antibacterial peptide BSR1 treated in 60 ℃ water bath for 30min, III is the antibacterial peptide BSR1 treated in 70 ℃ water bath for 30min, IV is the antibacterial peptide BSR1 treated in 80 ℃ water bath for 30min, V is the antibacterial peptide BSR1 treated in 90 ℃ water bath for 30min, VI is the antibacterial peptide BSR1 treated in 100 ℃ water bath for 30min, and the antibacterial peptide BSR1 treated in 4 ℃ water bath for 30 min.

FIG. 5 is a graph showing the results of salt ion stability measurement of antibacterial peptide BsR 1;

CaCl is arranged from top to bottom ₂ ，KCl，MgSO ₄ NaCl treatment, from left to right, is indicator bacteria 1.153, RH3, Xoo, XG-25, respectively. The concentrations of the salt ions represented by the serial numbers are, in order: i: 1M; II: 0.5M; III: 0.25M; IV: 0.125M; v: 62.5 mM; VI: 31.25 mM; VII: 0M (+).

FIG. 6 is a diagram showing the results of UV stability measurement of antibacterial peptide BsR 1;

in FIG. 6, four indicator bacteria 1.153, RH3, Xoo, XG-25 are shown from left to right, and the UV treatment time represented by the reference numbers are: i: 20 min; II: 40 min; III: 1 h; IV: 1h and 20 min; v: 1h and 40 min; VI: 2 h; VII: 0min (CK).

FIG. 7 is a schematic representation of the hemolytic analysis of antimicrobial peptide BsR 1.

FIG. 8 is a graph showing the results of Scanning Electron Microscope (SEM) observation of the antibacterial peptide BsR1 after treating four pathogenic bacteria;

wherein A represents the strain 1.153, B represents the strain RH3, C represents the strain Xoo, and D represents the strain XG-25;

as shown by red arrows, the bacterial cells treated with the antibacterial peptide BsR1 were damaged, incised, and the cell surface was not intact and smooth.

Detailed Description

The technical scheme of the invention is the conventional technology in the field if not particularly stated; the reagents or materials, if not specifically mentioned, are commercially available.

Example 1:

obtaining a bacillus subtilis antibacterial peptide BsR 1:

the applicant constructs a high-quality bacillus subtilis 330-2 genome library, transforms fusarium graminearum 5035 strain by using a homologous recombination method, screens mutants with larger differences in phenotype, and detects an insert by PCR. Constructing the screened gene on a pBE-S vector, and expressing the gene by using an indicator bacterium built-in library technology. The polypeptide has antibacterial activity, leads to the death of host cells by lysis, predicts an active region by using a bioinformatics means and synthesizes a short peptide. The nucleotide sequence of the antibacterial peptide BsR1 is derived from a Bacillus subtilis 330-2 strain, the N end of a protein sequence is supplemented with a glycine, the C end of the protein sequence is supplemented with a cysteine, the sequence is GVCRYHRQKWRTRGREWLRRC (shown in SEQ ID NO. 1), and the nucleotide sequence can be obtained by encoding a polynucleotide tccgtatgtcggtatcaccgtcagaaatggcggacaagagggcgtgaatggctgcgccgttgt (shown in SEQ ID NO. 2).

Example 2:

bacillus subtilis antimicrobial peptide BsR1 plate bacteriostasis experiment:

and (3) indication bacteria to be detected:

bacillus subtilis a, bacillus subtilis K1, ralstonia solanacearum (r.solanacearum), Xanthomonas oryzae pathovar oryzae pv oryzae (RH 35 3), Xanthomonas oryzae pathovar oryzae (xghos oryzae pv. oryzae) XG-25, Xanthomonas oryzae pathovar alba pathovar oryzae (xghos monas moni pv. oryzae) Xoo, c.graminearum tritici (c.fangi) H, Xanthomonas campestris pathovar campestris (Xanthomonas campestris pv. holcocicola) 1.153, c.solani canker (c.solani).

Putting 600 μ l of indicator bacterium liquid into a 10mL bacterium shaking tube, mixing with 4mL warm semisolid LB culture medium, quickly mixing, quickly pouring into a solid LB plate, standing for 5min, and fully solidifying and airing the culture medium; dividing the culture dish into 4 areas, and placing a sterile filter paper sheet in the center of each area to ensure that the filter paper sheet is fully adhered to the culture medium; 120 mu l of antibacterial peptide BsR with the concentration of 1mg/mL is absorbed and slowly dripped on a filter paper sheet in one area to slowly and uniformly diffuse liquid, negative control sterile water, control peptide BsR2(GSGSFYPGSASTVPVKTFLPHHRC) and positive control polymyxin B are dripped on the filter paper sheet in the other area according to the same method, and the filter paper sheet is dried in a sterile workbench; the cells were cultured in 28 ℃ incubator, inverted, and observed after 12 hours. A total of 3 experiments were performed, with 3 replicates per experiment.

As shown in FIG. 1, the positive control (polymyxin B) was added dropwise to the upper filter paper sheet, BsR1 was added dropwise to the left filter paper sheet, the control peptide BsR2 was added dropwise to the right filter paper sheet, and sterile water was added dropwise to the lower filter paper sheet as a negative control. The periphery of the filter paper sheet containing the antibacterial peptide BsR1 shows a transparent inhibition zone, while the control part shows no inhibition zone. Antimicrobial peptide BsR1 pair a: bacillus subtilis a, B: bacillus subtilis K1, C: ralstonia solanacearum (r), D: xanthomonas oryzae morbid variety RH3, E: xanthomonas oryzae bacterial blight-causing variant XG-25, F: xanthomonas oryzae bacterial blight-causing variant Xoo), G: rhizoctonia cerealis (c.fangi), H: xanthomonas campestris inhabiting villous pathogenic variety 1.153, I: the tomato canker pathogen (c. michiganensis) exhibits broad-spectrum bacteriostatic activity.

Example 3:

antimicrobial peptide Minimum Inhibitory Concentration (MIC) assay

The Minimum Inhibitory Concentration (MIC) of the antimicrobial peptide was determined using A microtiter broth dilution method. After incubation of the inoculum in LB liquid medium at 28 ℃ to a logarithmic growth phase, the inoculum concentration was diluted to an OD value below 0.05 and added to a 96-well titer plate. Equal amounts of antimicrobial peptide solutions of different concentration gradients (340. mu.M, 170. mu.M, 85. mu.M, 42.5. mu.M, 21.25. mu.M, 10.625. mu.M) were then added and the 96-well plates were incubated at 28 ℃ for 24h and the absorbance at OD600 nm was measured in a microplate reader. If no bacteria grow at any of the above concentrations, the concentration is further diluted. As shown in the following table and FIG. 2, the MIC values for the antibacterial peptide BsR1 were low for all four indicator bacteria, with the MIC value for 1.153 being below 5. mu.M.

TABLE 1 minimum inhibitory concentrations (MIC: μ M) of the antibacterial peptides BsR1 and BsR1

Strain name	1.153	RH3	Xoo	XG-25
					MIC value (μ M)	≈5	≈20	≈10	≈20

Example 4:

stability experiments of antibacterial peptide BsR 1:

1. acid-base stability test of antibacterial peptide BsR1

1) 1M HCl and 1M NaOH are prepared, 0.22 μ M bacterial filters are filter sterilized for use, and the pH is adjusted to 3.0, 4.0, 5.0, 6.0, 8.0, 9.0 and 10.0.

2) The concentration of the antibacterial peptide BsR1 was adjusted to be miscible with the pH-adjusted solution, and the final concentration was adjusted to the MIC concentration corresponding to the indicator bacteria.

3) After incubating at 4 ℃ for 30min, the mixture was dropped into a 96-well plate.

4) The indicator was prepared as in example 3 by adding equal volume of indicator to 96-well plate and mixing.

5) After static culture at 28 ℃ for 24h, the OD600 value was measured with a microplate reader, and the data was analyzed with GraphPad Prism 8.

The result is shown in fig. 3, the filter paper sheet in CK is dripped with the pH solution, the lower row is the mixed solution after the pH solution + BsR1 treatment, and the pH is not significantly influenced in the bacteriostasis of BsR1 to 1.153 by the analysis of the treatment chart and the data; the BSR1 has larger influence on RH3, and loses antibacterial activity on RH3 strains under alkaline conditions; the inhibition effect on Xoo and XG-25 bacterial blight is reduced, but the bacterial inhibition effect is still achieved.

2. Experiment on the thermostability of antibacterial peptide BsR1

1) The concentration of the antimicrobial peptide BsR1 was adjusted to give a final concentration corresponding to the MIC concentration of the indicator bacterium.

2) The antibacterial peptide BsR is treated at the temperature of 4 ℃, 50 ℃, 60 ℃, 70 ℃, 80 ℃, 90 ℃ and 100 ℃ for 130 min and then dripped into a 96-well plate.

3) The indicator was prepared as in example 3 by adding equal volume of indicator to 96-well plate and mixing.

4) After static culture at 28 ℃ for 24h, the OD600 value was measured under a microplate reader, and the data was analyzed using GraphPad Prism 8.

The result is shown in fig. 4, the treatment at 4 ℃ is taken as a positive control, and the antibacterial effect of the antibacterial peptide BsR1 after the treatment at 50-100 ℃ is not changed too much through the analysis of the treatment chart and the data, which indicates that the antibacterial peptide BsR1 is insensitive to high temperature and has stronger thermal stability.

3. Antibacterial peptide BsR1 salt ion stability test

1) CaCl with the preparation concentrations of 1M, 0.5M, 0.25M, 0.125M, 62.5mM, 31.25mM and 0M (+) respectively ₂ ，KCl，MgSO ₄ And a NaCl solution.

2) The concentration of the antibacterial peptide BsR1 is adjusted, and after the antibacterial peptide BsR1 is mixed and dissolved with the salt ion solutions with different concentrations, the final concentration is the MIC concentration corresponding to the indicator bacteria.

5) After static culture at 28 ℃ for 24h, the OD600 value was measured under a microplate reader, and the data was analyzed using GraphPad Prism 8.

The results are shown in FIG. 5, where sterile water treatment was used as a positive control and from the treatment profile, we found that Ca was present as a divalent cation when analyzed in conjunction with the data ²⁺ And Mg ²⁺ The antibacterial activity of the treated antibacterial peptide BsR1 is greatly reduced, and the antibacterial activity of the treated antibacterial peptide BsR1 is greatly reduced by Na ⁺ And K ⁺ After treatment, the antibacterial activity of the antibacterial peptide BsR1 is not obviously changed.

4. Antibacterial peptide BsR1 ultraviolet stability test

1) The concentration of the antimicrobial peptide BsR1 was adjusted to give a final concentration corresponding to the MIC of the indicator bacterium.

2) Performing ultraviolet treatment on the antibacterial peptide BSR1 for 20min, 40min, 1h, 20min, 1h, 40min and 2h respectively; and 0min (CK), followed by dropping into 96-well plates.

The result is shown in fig. 6, after ultraviolet treatment for 20min-2h, the antibacterial activity of the antibacterial peptide BsR1 is hardly affected, which indicates that BsR1 has strong ultraviolet stability.

Example 5:

hemolysis experiment of antibacterial peptide BsR 1:

mammalian red blood cell toxicity tests were performed on the antimicrobial peptides BsR1 and BsR 1. The specific mode is as follows:

1. fresh pig blood 600. mu.l was centrifuged at 5000rpm at 4 ℃ for 10 min.

2. The supernatant was carefully discarded, and the pellet was resuspended 3 times in 0.2M PBS buffer (pH 7.2) and centrifuged at 4 ℃ and 3000rpm for 5min each time.

3. Erythrocytes were diluted to 0.5% or 1% with the same PBS buffer and antimicrobial peptides were adjusted to different concentrations.

4. Mu.l of the erythrocyte suspension and 50. mu.l of antimicrobial peptide at different concentrations were incubated in 96-well cell culture plates at 37 ℃ for 1h, with a positive control of 0.1% Triton-100x (complete hemolysis) and a negative control of the above-mentioned PBS buffer (no hemolysis).

5. After 1h incubation, the pellet was removed by centrifugation at 4000rpm for 10 min.

6. The absorbance (450 nm for pig blood red blood cells) was measured by taking 70. mu.l of the supernatant in a new 96-well cell culture plate.

7. Calculating the formula: hemolysis rate (%) - (experimental group a 450-negative control a 450)/(positive control a 450-negative control a450) × 100%.

As shown in FIG. 7, to evaluate the toxicity of the antibacterial peptide BsR1 to mammalian erythrocytes, we tested their hemolytic activity at 1 × MIC, 2 × MIC, 3 × MIC, 4 × MIC, 5 × MIC porcine erythrocytes. After 1h of co-incubation, the hemolytic activity was almost zero even at a concentration of 5 × MIC. The experimental result shows that the antibacterial peptide is safe to mammalian cells.

Example 6:

the morphological characteristics of the bacterial surface, such as the integrity of the cell wall, can be observed by Scanning Electron Microscopy (SEM). We performed SEM observations with reference to the previous study (Zheng et al 2017). The indicator strain was taken out of the freezer at-80 ℃ and streaked on LB solid medium (containing kana: 10mg/L) for activation and cultured at 37 ℃ for 12-16 hours. Single colonies on the culture medium are picked and cultured in 50mL LB liquid medium (containing kana: 10mg/L), at 37 ℃ and 170-180r/min with shaking for 12 h. After completion of the culture, the culture solution was transferred to a 2mL centrifuge tube, centrifuged at 4,000x g for 10min, and the cells were collected. The cells were resuspended and washed 3 times with 0.02mol/L PBS buffer, centrifuged at 5,000x g for 10min, and the supernatant discarded. Adding 2.5% glutaraldehyde fixing solution, resuspending thallus, fixing at room temperature for 2h, centrifuging for 10min at 5,000x g, and collecting thallus. The thalli is cleaned by 30 percent, 50 percent, 70 percent and 90 percent of ethanol in a gradient way, and finally dehydrated fully by absolute ethyl alcohol and placed in a workbench for air drying to remove the residual ethanol thoroughly. The dehydrated bacteria were placed in a freeze dryer, dried overnight and stored in a desiccant for a short period of time.

Before the observation by a lens, the adhesive with good conductivity is adhered to a round metal sample table in advance. Gently shaking the centrifugal tube, mashing the bacterium block with toothpick, rolling the toothpick on the adhesive to make the bacterium adhered on the toothpick adhere on the adhesive, aligning the ear washing ball with the metal sample table, blowing and sucking for several times, and removing the bacterium with weak adhesion. The sample is placed in a vacuum evaporator and a 50-300 angstrom thick metal film is sputtered to increase the conductivity and secondary electron yield of the sample, improve image quality, and prevent the sample from being damaged by heat and radiation. Observing thallus by JEOL JSM-7001F scanning electron microscope, and collecting image (note that if spraying metal by ion sputtering coating machine, uniform fine-particle thin metal coating can be obtained, and the quality of scanning electron image is improved).

As shown in FIG. 8, the surface of the strain (negative control) after the treatment with sterile water was still smooth and full, and the state of the cells was good and was not damaged; the bacterial surface of the indicator strain treated by the antibacterial peptide BsR1 has the phenomena of nicking and shrinkage, wherein the RH3 strain has the phenomenon of cracking, and the antibacterial peptide BsR1 is presumed to possibly exert the antibacterial activity by destroying the cell membrane of the bacteria.

Sequence listing

<110> university of agriculture in Huazhong

<120> Bacillus subtilis antibacterial peptide BsR1 and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Gly Val Cys Arg Tyr His Arg Gln Lys Trp Arg Thr Arg Gly Arg Glu

1 5 10 15

Trp Leu Arg Arg Cys

20

<210> 2

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tccgtatgtc ggtatcaccg tcagaaatgg cggacaagag ggcgtgaatg gctgcgccgt 60

tgt 63

<210> 3

<211> 24

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Gly Ser Gly Ser Phe Tyr Pro Gly Ser Ala Ser Thr Val Pro Val Lys

1 5 10 15

Thr Phe Leu Pro His His Arg Cys

20

Claims

1. An artificially synthesized antibacterial peptide, which is shown in SEQ ID NO. 1.

2. A gene encoding the antimicrobial peptide of claim 1.

3. Use of the antimicrobial peptide of claim 1 or the gene of claim 2 for the preparation of a bacteriostatic agent.

4. Use of the antimicrobial peptide of claim 1 or the gene of claim 2 for the preparation of an antimicrobial medicament.

5. The use of claim 3 or 4, wherein the bacteria in the bacteriostatic or antibacterial agent is Bacillus subtilis (Bacillus subtilis)B. subtilis) Bacterial wilt disease: (R. solanacearum) Xanthomonas oryzae morbid variety: (Xanthomonas oryzae pv.oryzicola), Rhizoctonia cerealis (C. fangii) Xanthomonas campestris-inhabiting villous pathogenic variety (A)Xanthomonas campestris pv. Holcocola) and/or canker bacteria of tomato (C.fruticosus) ((C.fruticosus)C. michiganensis)。