CN115011691B - Application of DUSP22 in preparation of NASH and HCC markers and medicines - Google Patents

Abstract

The invention belongs to the field of biological medicine, and in particular relates to application of DUSP22 in preparing non-alcoholic steatohepatitis (NASH), hepatocellular carcinoma (HCC) markers and medicines. The invention provides application of DUSP22 in preparing NASH and HCC markers, and application of DUSP22 in preparing NASH and HCC markers singly or jointly by FAK; also provided is a combination factor pair which is a hepatocyte-derived DUSP22 and FAK, which are inversely related in content, and can be used for preparing NASH, HCC markers and medicines.

Description

Application of DUSP22 in preparation of NASH and HCC markers and medicines

Technical Field

The invention belongs to the field of biological medicine, and particularly relates to DUSP22 and application thereof in preparation of NASH, HCC markers and medicines.

Background

Nonalcoholic steatohepatitis (NASH) is a very dangerous liver injury that can lead to liver fibrosis, cirrhosis and advanced liver disease (such as hepatocellular carcinoma HCC and liver failure), and therefore has a high morbidity and mortality. NASH is becoming a major causative factor in end-stage liver disease, the onset of which is characterized by liver steatosis, ballooning lesions of the liver cells, lobular inflammation and fibrosis. Furthermore, NASH is often accompanied by metabolic abnormalities, including hyperglycemia, obesity, and type 2 diabetes (T2D). However, there is no approved effective drug for NASH treatment, due in large part to its complex pathogenesis. Currently, in vivo and in vitro gene therapy has become a focus of attention in this field, especially in experimental therapeutic strategies at the clinical stage, and gene therapy is considered one of the safest strategies. Thus, there is an urgent need to better explore the pathogenesis of NASH and to identify its critical therapeutic targets.

When the body is subjected to metabolic stress, related molecules that cause liver steatosis are activated, such as nuclear factor κb (NF- κb) and mitogen-activated protein kinase (MAPK) signaling molecules, which exhibit multiple functions in cell survival and death, glucose and lipid metabolism, and meta-inflammation. Bispecific phosphatases (DUSPs), including MAPK phosphatases, mediate the activation of various downstream kinases by serine, threonine or tyrosine dephosphorylation. DUSP22 (also known as JKAP or JSP-1) as an atypical DUSP has a typical Protein Tyrosine Phosphatase (PTP) characteristic motif HCXXGXXR at residues 87-94. DUSP22 may modulate MAPK signaling and be expressed in various tissues and cells, suggesting that DUSP22 may modulate several important biological events such as inflammatory responses and tumor cell proliferation. DUSP22 has been shown to upregulate JNK activation in mammalian cells and is specific. Mouse embryonic fibroblasts lacking DUSP22 are not able to mediate JNK activation and are upregulated following TNF- α or TGF treatment. More and more studies report that DUSP22 also modulates many substrates in other signaling cascades. For example, DUSP22 may dephosphorylate tyrosine phosphatases. In addition, DUSP22 directly dephosphorylates and inactivates Lck at residue Y394, inhibiting T cell immune responses, inflammation and autoimmune diseases. Because of the broad impact of DUSP22 on MAPKs activation, inflammation and fibrosis-related diseases or responses, we speculate that DUSP22 may have a potential function in MAPKs activation, inflammation and fibrosis-related diseases or responses, involved in the development of NASH and its associated HCC. However, the specific molecular mechanisms by which DUSP22 is involved in NASH regulation are not yet known.

Currently, there are no approved NASH therapeutics other than lifestyle interventions, and the molecular mechanisms that promote NASH-induced HCC development remain unclear. Therefore, finding key regulatory targets for pathogenic pathways is key to developing effective therapeutic strategies for NASH. Recent studies on the interaction of fatty liver genes with environmental factors have shown that metabolic disorders can significantly exacerbate the effect of gene mutations on NASH, from steatosis to hepatitis and cirrhosis. Preliminary clinical trials have shown that NASH patients with specific genetic variations respond differently to lifestyle and drug intervention. Therefore, there is an urgent need to put more research into NASH of specific genetic variation, providing new strategies for personalized medicine treatment.

Disclosure of Invention

In the present invention we have found that expression of DUSP22 is significantly reduced in liver and tumour tissue of NASH patients as well as NAFLD-HCC patients compared to normal human liver tissue. Hepatocyte-specific DUSP22 gene knockout significantly aggravates the development of NASH and HCC in multiple mouse models by promoting liver steatosis, inflammation and fibrosis. However, overexpression of DUSP22 in hepatocytes significantly alleviates the progression of mouse NASH and related HCC. On molecular mechanisms, we demonstrate that DUSP22 interacts directly with FAK, mediating dephosphorylation of its tyrosine residues Y397 and y576+y577, thereby inhibiting the overactivation of ERK1/2 and NF- κb signaling pathways. These results indicate that DUSP22 is a potential inhibitor in NASH and HCC development. Thus, promotion of liver DUSP22 expression may be a new strategy for preparing NASH and fatty liver-related liver cancer drugs.

One of the purposes of the invention is to provide an application of DUSP22 in preparing a marker of NASH and HCC.

The DUSP22 includes the sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, and a polypeptide having the amino acid sequence shown in 2.

The nucleic acid sequence encoding the DUSP22 comprises the sequence set forth in SEQ ID NO:5 or SEQ ID NO: 6.

The invention also aims at providing an application of DUSP22 combined with FAK in co-preparing NASH and HCC markers.

The DUSP22 comprises the amino acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:2, and a polypeptide having the amino acid sequence shown in 2.

It is a further object of the present invention to provide a combination factor pair.

The combination factor pair is DUSP22 and FAK of hepatocyte origin; the DUSP22 comprises the amino acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:2, and a polypeptide sequence represented by the following formula (2); the FAK comprises the amino acid sequence as set forth in SEQ ID NO:3 or SEQ ID NO:4, and a polypeptide having the amino acid sequence shown in (a) and (b).

The nucleic acid sequence encoding the FAK comprises the sequence set forth in SEQ ID NO:7 or SEQ ID NO: 8.

Further, the DUSP22 is inversely related in content to the FAK.

The invention aims at providing an application of a DUSP22 accelerator and/or an FAK inhibitor in preparing medicaments for treating NASH and HCC.

Further, the promoter is applied to the preparation of the serum pro-inflammatory factor reducing medicine.

Further, the serum pro-inflammatory factors include TNF-alpha, IL-1β, IL-6, MCP-1.

Further, the promoter and/or inhibitor includes small molecule compounds, nucleic acid molecules, proteins, polypeptides, herbal extracts, and combinations thereof.

Further, the small molecule compounds, nucleic acid molecules, proteins, polypeptides, traditional Chinese medicine extracts and combinations thereof include one or more of the following:

1) Alkaloids: berberine, magnolol, harmine, jatrorrhizine, leonurine, tetrandrine, dichrone, thunberg fritillary bulb alkali, colchicine, piperine, uncaria, camptothecine, tetrahydropalmatine, jatrorrhizine, chelidonine, lycorine, acronycine, matrine, oxymatrine;

2) Flavonoids: quercetin, dihydroquercetin, fisetin, luteolin, morin, phellinum, apigenin, geraniin, chrysin, alfalfa, puerarin, anthocyanin, procyanidins, daidzein, apigenin, baicalin, scutellarin, chrysin, wogonin, procyanidins, silymarin, silybin, daidzein, genistein, homocurcumin, kaempferol, isorhamnetin, myricetin, hesperetin, naringenin, liquorice, catechin, epicatechin, gallocatechin, cyanidin, delphinidin, flower sunflower element, erigeron, afusin, rutin, luteolin, baicalin, apigenin, jugloin;

3) Polyphenols: chlorogenic acid, cynara acid, cynaroside, cynaropicrin, tea polyphenol, resveratrol, punica granatum polyphenol, curcumin, ferulic acid, ellagic acid, vitamin C, gallic acid;

4) Amine compound: penicillamine, pomalidomide, lenalidomide, thalidomide;

5) Extract of traditional Chinese medicine: astragalus root, pilose asiabell root, red sage root, chinese angelica, chinese yam, pseudo-ginseng, schisandra fruit, sealwort, lucid ganoderma, coriolus versicolor, artichoke, herba Cephalanoploris, silybum marianum, kudzuvine root, coptis chinensis, amur corktree bark, turmeric, honeysuckle flower, hovenia dulcis thunb, dried orange peel, mulberry leaf, ginkgo leaf, lily bulb, bear gall, pig gall, oriental wormwood, bitter orange, liquorice, giant knotweed, pagodatree flower bud, tree peony bark, sedum sarmentosum, cape jasmine fruit, medlar, white peony root, szechuan lovage rhizome, peach kernel, rhubarb, chrysanthemum, rabdosia, oldenlandia diffusa, stephania tetrandra, cogongrass rhizome, barbed skullcap herb, bupleurum root, poria cocos, chinese yam, emblic leafflower fruit, cassia seed, largehead atractylodes rhizome, sharpleaf galangal fruit and oriental waterplantain rhizome;

6) Glycyrrhizic acid, glycyrrhizin, adenomethionine, ursodeoxycholic acid, tauroursodeoxycholic acid, chenodeoxycholic acid, taurochenodeoxycholic acid, bicyclic alcohol, bifendate, sorafenib, regorafenib, lenvatinib, betalain, metformin, carminic acid, N-acetylcysteine, glutathione, emodin, schisandrin.

The fifth object of the present invention is to provide a gene interference system for improving expression of DUSP 22.

Further, the gene interference system comprises DNA and an expression system packaged into adenovirus, and is characterized in that the DNA comprises a nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6, and a nucleic acid sequence shown in SEQ ID NO. 6.

The sixth object of the present invention is to provide a kit.

The kit comprises reagents for detecting NASH, HCC markers according to any one of claims 1-2.

The invention has the advantages that:

1) The invention discovers that the expression of DUSP22 in the liver of patients with NASH and HCC is obviously reduced for the first time, and the expression level of the DUSP22 has obvious negative correlation with the severity of NASH. Thus, DUSP22 has new application in preparing NASH and HCC markers.

2) The present invention for the first time found that overexpression of DUSP22 significantly improved liver inflammatory response, steatosis and fibrosis in diet-induced NASH mice. The DUSP22 promoter has new application in preparing NASH and HCC medicines.

3) The invention discovers that the DUSP22 directly interacts with FAK, mainly inhibits FAK phosphorylation activation, obviously relieves liver inflammatory reaction, steatosis and fibrosis of a diet-induced NASH mouse, and inhibits the development progress of NASH to HCC. Therefore, the DUSP22 combined with FAK has new application in the joint preparation of NASH and HCC markers.

4) The medicament for treating NASH and NASH prepared from the DUSP22 promoter and/or FAK inhibitor can effectively improve the pathological phenotype of NASH and the development progress of the NASH to HCC.

Drawings

FIG. 1 shows the mRNA expression levels of DUSP22 in liver tissue of NASH patients and non-steatodenatured subjects.

FIG. 2 is a graph showing the trend of DUSP22 protein expression levels in liver tissue of NASH patients and non-steatodenatured subjects in relation to each of the markers.

FIG. 3 shows the correlation of liver DUSP22 protein expression with the severity of NASH.

FIG. 4 shows HFHC feeding and ob/ob mouse liver DUSP22 mRNA and protein expression levels.

FIG. 5 shows expression of DUSP22 in PO-treated mouse primary hepatocytes.

FIG. 6 is a graph showing the relationship of TG, proinflammatory cytokines, and chemokines to DUSP22 expression.

FIG. 7 shows the gene expression of a pro-inflammatory molecule in L02 cells when DUSP22 gene expression is inhibited.

FIG. 8 shows the gene expression of a pro-inflammatory molecule in L02 cells when the DUSP22 gene is overexpressed.

FIG. 9 shows the relationship between TGF-. Beta.1 and DUSP22 expression.

FIG. 10 shows the expression of fibrosis markers in LX2 cells under DUSP22 expression inhibition and over-expression.

FIG. 11 shows NAC vs. HFHC induced liver ROS, MDA, H ₂ O ₂ And the effect of SOD activity.

FIG. 12 is a graph showing that NAC upregulates HFHC inhibited DUSP22 expression levels.

FIG. 13 shows DUSP22 expression and H in mouse liver ₂ O ₂ Correlation of content.

FIG. 14 is H ₂ O ₂ And effects of NAC intervention on DUSP22 expression after PO treatment.

FIG. 15 is a 24 week post-NCD diet DUSP22 ^HepKO Biochemical indicators and associated inflammatory factor levels in mice.

FIG. 16 is a DUSP22 after HFHC feeding ^HepKO Various indexes of the mice change.

FIG. 17 shows DUSP22 after HFHC feeding ^HepKO Staining results and NAS scores of mouse liver tissue.

FIG. 18 shows DUSP22 after HFHC feeding ^flox And DUSP22 ^HepKO Comparison of the liver indexes of mice.

FIG. 19 is a graph showing the release of pro-inflammatory cytokines by primary hepatocytes and L02 cells from mice lacking DUSP22 expression after PO stimulation.

FIG. 20 is lipid metabolism of primary hepatocytes and L02 cells of mice lacking DUSP22 expression after PO stimulation.

FIG. 21 is a PO-stimulated DUSP22 ^HepKO CM culture of hepatocytes induces expression of fibrosis-associated molecules in LX2 cells.

FIG. 22 is DUSP22 ^HepOE Mice were unable to spontaneously develop NASH-related hepatopathological phenotypes 24 weeks after NCD diet.

FIG. 23 is the effect of DUSP22 overexpression on insulin levels, HOMA-IR values and glucose tolerance in the air after 24 weeks of HFHC feeding.

Figure 24 is the effect of DUSP22 overexpression on serum ALT and AST levels after 24 weeks of HFHC feeding.

FIG. 25 is DUSP22 after 24 weeks of HFHC feeding ^HepOE Staining quantification results of mouse liver sections.

FIG. 26 is a DUSP22 after HFHC feeding ^HepOE Mouse liver steatosis and lipid metabolism related gene expression.

FIG. 27 is a DUSP22 after HFHC feeding ^HepOE Mouse serum, liver markers and expression of fibrosis related genes.

FIG. 28HFHC post-feeding DUSP22 ^HepOE HTqPCR results of mouse liver inflammation, lipid metabolism, and fibrosis.

FIG. 29 shows lipid and its metabolism-related gene expression in mouse and human hepatocytes over-expressed by DUSP22 under PO stimulation.

Figure 30 is inflammatory factor levels in mouse and human hepatocytes over-expressed by DUSP22 under PO stimulation.

FIG. 31 is a DUSP22 under PO stimulation ^HepOE Expression of fibrosis-associated genes in liver cell CM cultured LX2 cells.

FIG. 32 DUSP22 under HFMCD stimulation ^flox And DUSP22 ^HepKO NASH histologic lesions in mice.

FIG. 33 is an improvement of murine NASH histologic lesions by DUSP22 overexpression under HFMCD stimulation.

FIG. 34 is a DUSP22 under HFMCD stimulation ^HepKO And DUSP22 ^HepOE Mice ALT, AST, TG, TC, NEFA content comparison.

FIG. 35 DUSP22 under HFMCD stimulation ^HepKO And DUSP22 ^HepOE Mouse liver fibrosis and inflammatory factor levels were compared.

FIG. 36 is a graph showing that DUSP22 modulates activation of NF- κB and FAK signaling pathways in the liver of HFHC-fed mice.

FIG. 37 is an interaction between DUSP22 and FAK.

FIG. 38 is a correlation of expression of DUSP22 and activation of FAK in livers of HFHC-fed mice.

Fig. 39 is a graph of DUSP22 interacting directly with FAK and inhibiting FAK activation.

FIG. 40 is a graph showing the effect of C88S mutations on DUSP22 in alleviating liver steatosis and inflammatory response.

FIG. 41 is a graph showing the effect of C88S mutations on DUSP22 in alleviating hepatic lipid metabolism and fibrosis.

FIG. 42 FAK deficiency vs. DUSP22 after HFHC feeding ^HepKO The deterioration of various biochemical indexes of the liver of the mice has obvious improvement effect.

FIG. 43 shows FAK deficiency vs. DUSP22 after HFHC feeding ^HepKO Effect of mouse liver staining results and NAS score.

Figure 44 is the effect of FAK deficiency on biochemical markers and pro-inflammatory factor levels after HFHC feeding.

FIG. 45 is a graph showing the effect of FAK deletion on increased lipid deposition, intracellular TG production, and p-IκBα and p-NF- κB expression by Ad-shDUSP 22.

FIG. 46 is a graph showing the effect of FAK deficiency on DUSP22 to alleviate the effect of NASH.

FIG. 47 shows various biochemical markers of reduced HFHC up-regulation by gene therapy in vitro (LV-DUSP 22).

FIG. 48 shows that in vitro gene therapy (LV-DUSP 22) reduces lipid deposition, fibrosis, inflammatory factor levels in the liver of NASH mice.

FIG. 49 shows that in vitro gene therapy (LV-DUSP 22) reduces the phosphorylation levels of FAK, IκBα and NF- κB in NASH mice and the expression of genes related to fibrosis, inflammation and lipid metabolism.

FIG. 50 shows the expression levels of DUSP22 in HCC patients and DEN/HFHC-induced mouse tumor tissues.

FIG. 51 shows the expression levels of DUSP22 in HCC tumor and liver cancer cell lines (Hep 3B, hepG2 and SMMC-7721) of DEN-induced mice.

FIG. 52 shows the DEN/HFHC post-treatment and DUSP22 ^HepKO Compared with DUSP22 in mice ^HepOE Various physiological and biochemical index conditions of mice.

FIG. 53 is a DEN/HFHC post-treatment DUSP22 ^HepOE Histological features of mice, inflammatory factors, fibrosis, and FAK phosphorylation.

FIG. 54 is a graph showing the effect of DUSP22 overexpression in HepG2 and SMMC-7721 cells on liver cancer cell growth and signaling pathway phosphorylation levels.

FIG. 55 shows that DUSP22 inhibits the development of NASH-HCC by blocking FAK signaling.

Detailed Description

Hereinafter, preferred embodiments of the present invention will be described in detail. Experimental methods without specific conditions noted in the preferred embodiments, the present invention is better illustrated by the examples according to the conventional conditions, but the present invention is not limited to the examples. Those skilled in the art will appreciate that various modifications and adaptations of the embodiments described above are possible in light of the above teachings and are intended to be within the scope of the invention.

Antibodies and reagents used in the examples of the present invention were GAPDH (# 2118), p-JNK# (4668), JNK (# 9258), p38 (# 8690), p-p38 (# 4511), p-IκBα (# 4814) were all purchased from CST company (CST, beverly, USA). Antibodies IKKK alpha (# ab 32041), MEK1/2 (# ab 178876), p-MEK1/2 (# ab 278564), ERK1/2 (# ab 184699), p-ERK1/2 (# ab 201015), NF- κB (# ab 16502), p-NF- κB (# ab 86299), TGF- β1 (# ab 179695), TAK1 (# ab 109526), p-TBK1 (# ab 109272), TBK1 (# ab 40676), HA (# ab 18181), flag (# ab 205606), CD11B (# ab 133357), DUSP22 (# ab70124, # ab 150565), DUSP3 (# ab 248113), EGFP (# ab 184601), HNF4 alpha (# ab 201460), CK19 (# ab 52625), alpha-SMA (# 124964) were all purchased from Abcam (Cambridge, MA, USA). The DUSP22 antibody (#H 00056940-B01P) was purchased from Novus Biologicals (USA). Diethylnitrosamine (DEN; cat#55-18-5), palmitate (PA; cat#P 9767), oleic acid (OA; cat#O1008), active oxygen scavenger N-acetylcysteine (NAC; cat#A7250), lipopolysaccharide (LPS; from E.coli (055: B5); cat#L2880) was purchased from Sigma (St. Louis, USA). Human recombinant protein IL-6 (Cat#206-IL-050/CF), TNF- α (Cat#210-TA-020/CF), TGF-. Beta.1 (Cat#240-B-002) were all purchased from R & D (Minneapolis, USA).

The human liver tissue samples used in the examples of the present invention were painless collected from adult non-alcoholic fatty liver patients who received liver transplantation or liver biopsy, and control liver tissue samples were taken from volunteer donors who were not available for liver transplantation for non-liver reasons. In this study we collected non-steatosis liver tissue (n=16), NASH liver tissue (n=20). Specimens with NASH Activity Score (NAS) of 0 were classified as non-steatosis, NAS.gtoreq.5 or NAS 3-4 but samples showing fibrosis were included in the NASH group. Fatty liver samples from patients meeting any of the following criteria were excluded from the study: overdrinking (greater than 140 grams per week in men and greater than 70 grams per week in women), drug abuse or viral infection (including hepatitis b virus or hepatitis c virus infection). Human HCC tumor tissue and adjacent normal tissue associated with NAFLD were obtained from patients with biopsy confirmed as NAFLD-HCC (n=8).

In this study we focused on male mice, as NAFLD/NASH is more prevalent in humans in male than in female mice. Mice were allowed to acclimate to the living environment for one week before all experiments began. All animals were kept in cages with constant temperature, constant humidity (Central air Condition control in China, # GMV-Pd 250W/NaB-N1) and pathogen free control environment (23.+ -. 25 ℃, 50-60%) with standard 12 hour light/12 hour dark cycle inside the cages with sufficient water and food (pathogen free).

All male, normal wild-type (WT) C57BL/6N mice (6-8 weeks old; 22-25g body weight) used in the examples of the present invention were purchased from Beijing Vitolihua laboratory animal technologies Co., ltd (China, beijing). Male ob/ob mice (#N 000103) of 6-8 weeks old were purchased from Nanjing biomedical research institute at Nanjing university.

To generate mice with conditional knockout allele DUSP22, a CRISPR/Cas9 regulated genome engineering system was used to construct DUSP22 with C57BL/6N background ^flox/flox And (3) a mouse. Exon 3 of DUSP22 was selected as the conditional knockout region (cKO). Two loxP sites flanking the selected exon of DUSP22, two single-targeting RNAs (gRNA 1# and gRNA2 #) were designed for the DUSP22 intron. Targeting vector grrna1# and grrna2# and Cas9 were co-injected into fertilized eggs to produce cKO mice using targeting vector containing DUSP22 exon 3 as template, flanked by two loxP sites and two homology arms. The mice obtained have two loxP sites on either side of exon 3 of one allele for the establishment of DUSP22 ^flox/flox And (3) a mouse. Hepatocyte-specific DUSP22 deletion (DUSP 22) ^HepKO ) The mice were DUSP22 ^flox/flox Mice were combined with albumin-Cre (Alb-Cre) mice (Jackson Laboratory,bar Harbor, maine, USA). In the embodiment of the invention, DUSP22 is used ^flox/flox (flox) mouse littermates as obtained DUSP22 ^HepKO Control of mice.

To obtain mice conditionally knocked-in DUSP22, a RosaDUSP22 mouse with a C57BL/6N background was constructed using the DUSP22 conditional knockin of the mouse Rosa26 site by CRISPR/Cas regulated genome engineering system. Briefly, the Rosa26-pCAG-loxp-STOP-loxp-mDUSP22-pA cassette was cloned into intron 1 of Rosa 26. In addition, to design targeting vectors, homology arms were constructed by PCR using BAC clones as templates. Thereafter, the targeting vector gRNA and Cas9 were co-injected into fertilized eggs to produce RosaDUSP22 mice. In the indicated experiments, hepatocytes were induced by intravenous injection of adenovirus serotype 8 (AAV 8) -thyroxine-binding globulin (TBG) promoter Cre recombinase vector (AAV 8 TBG Cre) (DUSP 22 ^HEPOE ) Conditional overexpression of DUSP22 was then determined using immunoblot analysis. The littermate RosaDUSP22 mice without AAV injection in the examples of the invention were used as the Dusp22 obtained ^Hepoe Control of mice.

Hepatocyte-specific FAK knockdown with deletion of FAK exon 4 (FAK ^HepKO ) The mice were similarly established with DUSP22 ^flox/flox Mice and DUSP22 ^HepKO Prepared by the method of mice. Briefly, FAK ^flox/flox Mice were designed and constructed by CRISPR/Cas mediated genome engineering systems, selecting exon 4 of the FAK gene as the conditional knockout region. To design a targeting vector, the homology arms and cKO region were generated by PCR using BAC clones in the C57BL/6N library as templates. Cas9 and gRNA are then co-injected with a targeting vector into fertilized eggs for mouse production. Then, FAK is carried out ^flox/flox Mice were hybridized with Alb-Cre mice, resulting in hepatocyte-specific FAK deficient mice (FAK ^HepKO ). In the embodiment of the invention, the FAK knockout mouse littermates are used as the obtained FAK ^HepKO Control of mice. DUSP22 ^flox/flox Mice and FAK ^HepKO Hybridization of mice to produce hepatocyte-specific DUSP22 (DUSP 22) ^HepKO ) And FAK (FAK) ^HepKO ) Double deletion (HepDKO) mice. To obtainOffspring mice not expressing the DUSP22 and FAK proteins were identified, validated and screened by western blotting analysis and used for further in vivo experiments.

Establishment of NASH mouse model

1) High fat high cholesterol diet (HFHC) for inducing NASH model

Male mice were fed HFHC diet (42% saturated fat, 14% protein, 44% carbohydrate, and 0.2% cholesterol w/w) for 24 weeks, and a first mouse model with the NASH phenotype was established. Control (NCD) mice eat normal diet (20% protein, 10% fat and 70% carbohydrate, # D12450H; new Brunswick, NJ, USA) for 24 weeks.

2) High fat diet and methionine choline deficiency diet (HFMCD) are used for inducing NASH model

Male mice were fed HFMCD diet (HFMCD, A06071301B, study diet) for 8 weeks, and a second mouse model with a NASH phenotype was established. Control mice received the corresponding normal diet (NCD, special diet).

Design of animal experiment

Animal experiment design 1#: WT male mice of 6-8 weeks of age were fed HFHC feed for 24 weeks to induce NASH phenotype, and WT mice fed normal NCD for 24 weeks were defined as control group (NCD). The ob/ob mice of 6-8 weeks of age were used as another fatty liver model and fed NCD. At the end of the experiment, liver samples were collected from all mice for further analysis.

Animal experiment design # 2: to study the effect of ROS on DUSP22 expression during NASH progression, 6-8 week old WT male mice were fed HFHC diet for 24 weeks. NAC (150 mg/kg) was intraperitoneally injected into mice twice a week to eliminate HFHC-induced ROS produced in mice. Control mice received the same volume is injected into the abdominal cavity with physiological saline.

Animal experiment design 3#: hepatocyte-specific DUSP22 deletion (DUSP 22) ^HepKO ) Male mice were fed an HFHC diet for 24 weeks to induce NASH phenotype. To obtain conditional DUSP22 function-enhancing (GOF) mice, HFHC diet-fed RosaDUSP22 mice were injected with 1.5X104 genome copy (gc) doses of AAV8-TBG-Cre vector by tail vein injection Induction of hepatocyte-specific DUSP22 overexpression (DUSP 22) ^HepOE HFHC). RosaDUSP22 mice given an equivalent amount of AAV Empty Vector (EV) served as controls (DUSP 22 ^HEPRosa /HFHC)。

Animal experiment design No. 4: to investigate the role of DUSP22 in HFHC diet-induced NASH pathology, in 8 week HFHC fed pre-treated WT male mice, in vitro mediated DUSP22 gene therapeutic intervention was performed by lentiviral packaged full length DUSP22 sequence (LV-DUSP 22) or shRNA targeting DUSP22 (LV-shDUSP 22) transduction and transplantation. From our previous study, a detailed protocol for in vitro therapeutic experiments was developed. At the end of the in vitro therapeutic intervention, mice were fasted for 8 hours, then eyeball blood and liver samples were collected, weighed, and stored at-80 ℃ for further animal study. The rest of liver tissue was subjected to histological and biochemical analysis.

Animal experiment design 5#: to obtain another NASH diet-induced steatohepatitis, DUSP22 ^HepKO And DUSP22 ^HepOE Male mice were fed HFMCD diet for 8 weeks to induce the NASH phenotype. Dusp22 ^HepKO And Dusp22 ^HepOE The mice were generated as described previously. DUSP22 ^flox And DUSP22 ^Rosa Mice served as controls, respectively. All mice received either HFMCD or NCD diet feeding for 8 weeks.

Animal experiment design 6#: to further explore the role of DUSP22 in NASH progression, full-length mouse DUSP22 sequences or a PTP motif domain deleted mouse DUSP22 sequences were loaded into AAV8 vectors to create AAV-TBG-DUSP22 or AAV-TBG-DUSP22 (Δptp motif) vectors. And then to DUSP22 ^HepKO Mice were injected with 1.5X104 genome copies (gc) doses of the corresponding vector to generate DUSP22 functional Gain (GOF) male mice. These mice were then fed a 24-week HFHC diet to trigger the NASH phenotype (HepUSP 22GOF/HFHC, hepUSP 22-. DELTA.PTP motifGOF/HFHC). Mice injected with the blank corresponding vector served as controls.

Animal experiment design # 7: male DUSP22 ^HepKO Mouse, FAK ^HepKO Mice, hep-DKO mice and Flox mice were fed HFHC for 24 weeks to develop NASH phenotype and explore pathological changes.

Animal experiment design 8#: the protective effect of DUSP22 on NASH progression was further investigated. In HFHC dietary feeding (FAK ^HepKO HFHC) 24 weeks ago or halfway through HFHC feeding, to male FAK via portal vein ^HepKO Mice and FAK ^flox The mice were injected/not injected with LV-shDUSP22 vector to establish hepatocyte-specific DUSP22-FAK loss-of-function mice or hepatocyte-specific DUSP22 loss-of-function mice (FAK ^HepKO /LV-shDUSP22/HFHC，FAK ^flox /LV-shDUSP22/HFHC)。

Animal experiment design # 9: to investigate the role of DUSP22 expression and FAK activation in NASH-related hepatocellular carcinoma, NASH-HCC animal models were established. Male wild type C57BL/6N mice, DUSP22, established as described previously ^flox 、DUSP22 ^HepKO 、DUSP22 ^HepRosa 、DUSP22 ^HepOE 、FAK ^HepKO And hepatocyte-specific double knockout DUSP22 and FAK (Hep-DKO) mice were intraperitoneally injected with a single dose of DEN (25 mg/kg) at 2 weeks of age and fed HFHC diet starting at 8 weeks of age. NASH-HCC was established by intraperitoneal injection of a single dose of DEN (25 mg/kg) at 2 weeks of age in ob/ob mice, followed by NCD diet. Mice were sacrificed 24 weeks after HFHC feeding, and serum and liver tissue samples were collected. The number of tumors on the liver surface and the tumor size were measured and analyzed.

Cell culture

All cell lines used in the examples of the invention were passaged no more than 30 times, and the cell lines involved in the experiments required PCR analysis and detection, confirming no mycoplasma contamination. Human normal hepatocyte line L02 was purchased from China center for type culture Collection (Shanghai, china) and was cultured at 37℃with 5% CO ₂ Is cultured in a humidified incubator (Thermo Fisher Scientific) with the addition of 10% fetal bovine serum (FBS; #10100147,) And 1% penicillin streptomycin (SV 30010; hyclone) from the American type culture Collection (ATCC; marassus, virginia, U.S.A.) were purchased with DMEM medium containing 10% FBS and 1% penicillin streptomycin, 5% CO at 37 ℃C ₂ In the incubatorCulturing. The primary hepatocytes of mice used in the study were isolated from the corresponding group of indicator mice using liver perfusion. Briefly, the abdominal cavity of the mice was opened under painless anesthesia and liver tissue was carefully perfused with 1 Xliver perfusate (# 17701-038, gibco) ^TM ) And 1 Xliver digestion Medium (# 17703-034, gibco) ^TM ) Through the portal vein; subsequently, the liver samples were digested by grinding and filtration using a 100 μm steel mesh; the mouse primary hepatocytes were then collected by centrifuging the filtrate at 800rpm at 4℃for 5 minutes and further purified using 50% isotonic cell separation solution (# 17-0891-01,GE Healthcare Life Sciences). The obtained hepatocytes were stored in DMEM medium containing 10% fbs and 1% penicillin streptomycin at 37 ℃,5% co ₂ Is cultured in a cell culture incubator. To mimic liver lipid deposition and steatosis in vivo, cells were incubated with prescribed doses of PO (0.4 mM PA and 0.8mM OA), TNF- α, IL-6, LPS or TGF- β1, as shown, to study DUSP22 function in vitro experiments.

Construction of Gene knockout cell lines

The FAK-deficient L02 cell line was generated and the protocol was as described previously. Briefly, FAK-deleted L02 cell lines were generated by the CRISPR/Cas9 gene editing system. Small molecule guide RNAs (sgrnas) targeting the human FAK gene were prepared and cloned into the LentinCRISPRV2 vector to produce a Cas9 sgRNA lentivirus, the oligonucleotide sequences used to generate the sgRNA expression vector were shown as: sgFAK-1#:5'-ACTGGTATGGAACGTTCC-3'; sgFAK-2#:5'-TGAGCTTAGTACTCGAATT-3'. The encapsulation carrier pMD2. Using Lipofectamine ^TM CRISPRMAX ^TM Transfection of G and psPAX2 and corresponding sgRNA expression vectors into HEK293T cells, cas9 or respectively6 transfection for 42 hours. The resulting lentivirus-containing supernatant was then used to transduce L02 cells to construct a targeted gene-deficient cell line. Cell clones with target gene knockouts were screened by immunoblot analysis.

Vector construction and transfection

For over-expression of DUSP22, a human full-length DUSP22 expression vector was generated by cDNA-based PCR amplification, and cloned into a3 XFlag-tagged pcDNA3.1 vector and a3 XHA-tagged pcDNA3.1 vector (Invitrogen), respectively. Truncated human DUSP22 and FAK fragment expression plasmids including FAK-HA, DUSP22-Flag, DUSP22 (1-144) -Flag, DUSP22 (145-184) -Flag, FAK (1-400) -HA, FAK (1-693) -HA, FAK (401-904) -HA, FAK (694-1052) -HA and FAK (905-1052) -HA were prepared using standard PCR methods and then cloned into the corresponding vectors. Flag-FAK WT expression plasmid was constructed based on pcDNA3.1. Furthermore, FAK and corresponding derivatives, including FAK, FAK kinase and FAK-FRNK, with the only complete amino acid residue being FAK-FERM, were packaged into Flag-tagged pcdna3.1 vector (sameifeishier technologies). Lipofectamine is used according to the instruction ^TM 3000 transfection reagents the resulting vector was carefully transfected into L02 or FAK knocked-out L02 cells. Furthermore, to explore the role of DUSP22 in vitro experiments, we constructed adenovirus-packaged targeted gene expression vectors. Human or mouse full-length DUSP22 sequence and specific short hairpin RNA oligonucleotide sequence for human or mouse DUSP22 (shDUSP 22) (shRNA sequence RNAi #1:5' -TACCTGCATCCAGCAG-3'; 2:5' -ACACACTGTAGCAGCAGCATACA-3' for human; RNAi # 1:CAGGATTGAGAGAAGAAGAAGAGAGAGAAGAA; RNAi #2:5' -CCCTTGAGGAGGAGGAGGAGGAGGAGGAGGAGAAGAAGAAGAAGAAGAAGAAGAAGAAG, human WT DUSP22 sequence with C88S mutation [ DUSP22 (C88S), cys→Ser substitution by Easy adenovirus vector System kit (# 240009, agilent technology) ]23 and targeting human or mouse obtained from Sigma-Aldrich (SHCLND-NM-153831, SHCLND-NM-007982)shRNA plasmid DNA FAK (shFAK) was packaged into adenoviruses (Ad-DUSP 22, ad-DUSP22 (C88S), ad-shDUSP22 and Ad-shFAK), respectively. Ad-GFP and Ad-shRNA (disordered RNA) served as controls, respectively. Recombinant adenovirus was purified and titrated to 5 x 1010 Plaque Forming Units (PFU). Verification of the virus is based on DNA analysis of the virus, a plaque virus purified by restriction enzymes. To generate LV-DUSP22 or LV-shDUSP22 vectors, the mouse DUSP22 cDNA sequence or targetshRNA of the mouse DUSP22 sequence was packaged into pLenti RFP Puro CMV or pLenti-U6-EGFP to down-regulate or up-regulate the expression of DUSP22 for in vivo experiments.

Liver function index and lipid content determination

Serum alanine Aminotransferase (ALT) (# MAK052, sigma-Aldrich), aspartate Aminotransferase (AST) (# MAK055, sigma-Aldrich), alkaline phosphatase (AKP) (# ab83369, abcam), serum insulin (ab 277390) (# ab277390, abcam) and liver Triglyceride (TG) (# MAK266, sigma-Aldrich), total Cholesterol (TC) (# ab65359, abcam), non-esterified free fatty acid (NEFA) (# E-BC-K014, elbascience, inc., houston, USA) concentrations were measured according to the instructions of the corresponding commercial test kit.

Co-immunoprecipitation (Co-IP) analysis

In this study we performed immunoprecipitation assays according to previous methods. Homogenizing cells or liver tissue with IP-specific lysis solution at 4deg.C (# 87787, pierce) ^TM IP lysis buffer (Thermo Scientific Pierce) was then centrifuged at 13000rpm for 20 minutes. Cell lysates were then collected and incubated with protein a/G magnetic agarose beads (# 78609,Thermo Scientific Pierce) at room temperature for 1-2 hours at room temperature followed by co-incubation with antibodies overnight at 4 ℃. After washing with a kit containing immunoprecipitation wash buffer, the immunocomplexes were collected and subjected to immunoblotting analysis with primary antibodies and corresponding secondary antibodies.

Glutathione S-transferase (GST) pull-Down assay

The direct protein interaction between DUSP22 and FAK was performed using the GST pull-down assay in the previous assay protocol. Rapid Pierce ^TM GST protein interaction pull-down kit (# 21516, siemens Feishmania technologies) was used to detect protein binding. Rosetta (DE 3) E.coli (E.coli) cells were transformed with plasmid pGEX-4T-1-GST-DUSP22 or pGEX-4T-1-GST-FAK and then induced for expression by incubation with 0.5mM isopropyl beta-D-thiogalactoside (IPTG) (I5502, sigma-Aldrich). The E.coli-lysed extract was mixed with the corresponding GST beads for 1 hour at 4 ℃. GST beads were then incubated for 4 hours with Flag-tagged DUSP22 or FAK At this time, the interacted proteins were eluted in elution buffer and immunoblotted with anti-Flag antibodies. Coli expressing only the GST tag served as a negative control.

RNA extraction, quality control and high throughput quantitative PCR (HT-qPCR)

Using Trizol ^TM Reagent (# 15596-018, zemoeimeric technologies) extracts total RNA from liver samples or cells according to the instructions of use. 1. Mu.g of total RNA was reverse transcribed using the M-MLV-RT system (Invitrogen) which was run at 42℃for 1 hour and the reverse transcription was terminated by inactivating the enzyme at 70℃for 10 minutes. Subsequently, PCR was performed on the ABI PRISM 7900HT system (Applied Biosystems, USA) using SYBR Green (Bio-Rad). Specific primer sequences were produced by Invitrogen or general Biotech (Shanghai, china). According to 2 ^(-ΔΔCt) The expression calculates a fold induction value. Delta Ct represents the difference in the number of cycle threshold values between the target gene and GAPDH, delta Ct represents the relative change in the difference between the control and treatment groups.

For high throughput quantitative PCR (HTqPCR), a microfluidic card with 384 wells was used according to the instructions of useThe low density array (P/N4342259,TLDA cards,ABI,Hilden,Germany) performed comparative analysis of gene expression. The TLDA card used in this study was custom made by ABI corporation according to the requirements of this experiment. The cards obtained were based on TaqMan chemistry, in which gene expression of 128 genes was analyzed 1 time. In addition, TLDA cards were preloaded with a TaqMan gene expression assay targeted for 87 inflammation-related genes, 25 lipid metabolism-related genes, and 16 pro-fibrosis-related genes, and 6 normal control groups were designed. The obtained gene expression changes were normalized to the average of 5 out of 6 control groups (GAPDH, beta-actin, beta-tubulin, B2M, HPRT 1) of the same sample (Δct), and selected for their stability. Randomly selected data of any one group is defined as an etalon (deltact), data normalization for all other groups. The gene expression level was finally expressed as relative expression (calculated by the fold method (2-. DELTA.CT)). Expression of Master Mix (P/N4369510, ap) using TaqMan Gene in the operation of HT-qPCR ply Biosystems). The data were analyzed and quantified using the ABI Prism SDS 2.1 software attached to the ABI Prism 7900HT system, and the resulting final data and results were presented in the form of a heatmap image.

Western immunoblotting

The cell or liver samples were homogenized into RIPA lysis and extraction buffer (# 89900, sammer feichi technologies) to obtain homogenates. The final liquid supernatant was centrifuged at 13500rpm at 4℃for 30 minutes. Protein concentration was measured using the PierceTM Rapid Gold BCA Protein Assay kit using BSA as standard according to the manufacturer's instructions. The total protein extract samples were then subjected to western blot analysis. An equal amount of the obtained total protein (20-50. Mu.g) was subjected to 10% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a 0.45. Mu.M PVDF membrane (# 10600023,Amersham Hybond,GE Healthcare Life Science,Germany). Subsequently, PVDF membranes were blocked with 5% skim milk (DifcoTM Skim Milk, BD, USA) in 1×tbst buffer (#t1080, beijing soleba, china) containing 0.1% tween-20 (#abs 9152, abin, china) (TBST) for 1 hour and mixed with primary antibodies (diluted 1:1000 or 1:500) at 4 ℃ overnight. Thereafter, the PVDF membrane was washed 3 times with 1 XTBST, and then incubated with horseradish peroxidase (HRP) -conjugated anti-rabbit antibody (#ab 6721) or anti-mouse antibody (#ab 6789) secondary antibody (Abcam, dilution 1:8000) at room temperature for 1.5 hours. Using Pierce ^TM ECL plus Western blotting substrate (# 32134, simer Feichi technologies) the Western blotting band was observed and exposed to X-ray film from Kodak (Eastman Kodak Company, USA). The corresponding protein expression levels were determined by software for grey values (Version 1.52v,Image J,National Institutes of Health,USA), normalized to housekeeping Gene (GAPDH), and expressed as controls.

Metabolic index and serum cytokine parameter assessment

GTT was performed on mice fasted for 8 hours. Mice were intraperitoneally injected with glucose (2 g +. kg body weight) (# 158968, sigma-Aldrich). Then, a commercial blood glucose test strip (ACCU-Roche Diabetes Care GmbH, shanghai, china) measures tail vein blood glucose concentrations at 0 minutes, 15 minutes, 30 minutes, 60 minutes, and 120 minutes after glucose injection. Finally, steady state model assessment of insulin resistance (HOMA-IR) was calculated using fasting insulin and fasting blood glucose levels. The following equation is used to calculate the HOMA-IR value: blood glucose (mg/dL). Times.serum insulin (μU/mL)/405. For mice, cytokine or chemokine levels in serum were detected according to the corresponding instructions for use of commercial enzyme-linked immunosorbent assay (ELISA) kits, including mouse TNF- α (#MTA00B), IL-1β (#MLB00C), IL-6 (#M6000B), IL-10 (#M1000B) and MCP-1 (# MJE B), which were purchased from R &D system. The corresponding serum was carefully stored in a-80℃refrigerator. For human samples, the samples were tested according to the corresponding human ELISA kit (R&D system), serum levels of TNF- α (#DTA00D), IL-18 (#DY318-05), IL-6 (#D6050), MCP-1 (#DCP00) and TGF- β1 (#DY240) were measured.

Intracellular TG and inflammatory cytokine assays

The intracellular triglyceride content was measured according to the instructions using a commercial triglyceride quantitative analysis kit (#ab 65336, abcam). For the primary hepatocytes of mice, cytokines in the medium, including TNF-. Alpha. (#MTA00B), IL-1β (#MLB00C) and IL-6 (#M6000B) were calculated using corresponding commercial ELISA kits according to the instructions, all available from R & D systems. For L02 cells, the amounts of TNF-. Alpha. (#DTA00D), IL-1β (#QLB 00B) and IL-6 (#D6050) in the medium were determined by collection using the corresponding ELISA kits (R & D systems), all available from R & D systems, according to the instructions of use.

Histopathological and immunohistochemical staining

To explore mouse histopathology and immunohistochemical changes, liver tissue was treated with 4% formaldehyde tissue fixative (#R 37814, image-iT) ^TM ，Invitrogen ^TM ) Fixed, embedded in paraffin (#YA0010, beijing Soy Bao life technologies, inc. of China) and then sectioned laterally (5 μm thick). With hematoxylin and eosin (H &E)(#ab245880，H&E staining kit, abcam) staining liver tissue sections to observe liver lipidsAccumulation and inflammatory changes. H&The NAS score after E analysis is the sum of the scores of three components, including steatosis (0-3), lobular inflammation (0-3) and hepatocyte spheroidization (0-2). To further show lipid accumulation in the liver, sections were frozen at Tissue Tek optimal cleavage temperature (o.c.t.) (# 4583, tissue-Tek, sakura Finetek, USA), then stained with oil red O staining kit (# ab150678, abcam) for 10 min, then washed with 60% isopropanol (# I9030, sigma-Aldrich), and liver sections were counterstained with hematoxylin. In addition, in order to examine collagen accumulation in liver tissue, sections were stained with Masson trichromatic staining (#g1346, masson staining kit, soribao life technologies) and Sirius red staining (#ab 150681, picro-Sirius staining kit, abcam). For immunohistochemical analysis, paraffin sections of liver tissue were deparaffinized and the antigen recovered by heating with sodium citrate by adding 30% H ₂ O ₂ Endogenous peroxidases are removed. A circle was drawn around the tissue using an immunohistochemical pen, and 5% goat serum (#C0265, shanghai Biyundian, china) was added for sealing. The sections were then incubated with primary antibodies CD11b (#ab 133357, abcam, dilution 1:200) and DUSP22 (# 70R-16956, fitzgerald, USA; dilution 1:200) overnight in the indicated groups at 4 ℃. The following day sections were washed three times with PBS for 3 minutes each and then incubated with anti-rabbit IgG (HRP) secondary antibody (#ab 97080, abcam, dilution 1:200) for 1 hour at room temperature. Immunohistochemical staining was observed using 3,3' -Diaminobenzidine (DAB) substrate kit (#ab 64238, abcam) and counterstained with hematoxylin. All images were observed using an optical microscope (Fitzgerald, USA). The positively stained areas were analyzed and quantified using Image Pro Plus software (version 6.0) and the results were expressed as a percentage (%) of the total area of the high power field of view (HPF).

Immunofluorescent staining

For immunofluorescence microscopy, frozen sections of liver (5 μm thick) were left at room temperature for 20 minutes and then washed three times with PBS. Liver sections were blocked with 0.3% Triton X-100 (#ST797, biyun) 10% goat serum (#C0265, biyun) for 1H at room temperature and diluted 1:200) with DUSP22 (#H 00056940-B01P, # Tyr576+577)PA5-37706, dilution 1:100), p-FAK (Tyr 397) (# 44-624G, dilution 1:100), F4/80 (# 41-4801-82, dilution 1:200) and Ki-67 (#PA 5-19462, dilution 1:200) were incubated overnight at 4 ℃. The following day the sections were washed three times with PBS. Preparation of anti-Rabbit IgG H&L(Alexa594 (#ab 150080) and anti-mouse IgG H&L(Alexa/>488 (#ab 150113) secondary fluorescent antibody (Abcam, dilution 1:300), sections were incubated at room temperature for 1 hour in the dark. After washing with PBS, the nuclei were stained with 2- (4-aminophenyl) -6-indolecabine dihydrochloride solution (DAPI; #C1006, biyun day) for 5 minutes, and then washed with PBS. The image was observed and captured under a fluorescence microscope (Olympus, japan).

Measurement of oxidative stress related parameters

Liver tissue was washed with pre-chilled PBS solution and then homogenized on ice. After centrifugation at 1000 Xg for 15 minutes at 4℃the supernatant was collected. The SOD activity of the antioxidant enzyme was evaluated using a commercial kit (#A001-3-2), the results being expressed in units of SOD per milligram (mg) of protein. The lipid peroxidation status of the liver, expressed in nmol/mg, was measured by detecting MDA (#A003-1-2, institute of biological engineering, nanjing, china) levels and was performed as indicated by the kit. The liver tissue was lysed using lysis buffer and then centrifuged at 12000 Xg for 5 min at 4 ℃. Liquid supernatant was collected to calculate liver H ₂ O ₂ (# S0038, biyun days).

Reactive Oxygen Species (ROS) in the liver

Liver ROS level was measured by staining with Dihydroethidium (DHE) (10 μm; #S0063, biyun) and slicing frozen liver (5 μm thick) in a humid and dark room (37 ℃) for 30 minutes according to the kit instructions. Images were taken using a fluorescence microscope (Olympus, japan) and the percentage of DHE stained area was analyzed and quantified using Image J software (version 1.52v, national Institutes of Health, USA).

Cell viability

Cell viability was measured according to the instructions of CCK-8 kit (#C0039, biyun day). Stably transfected HepG2 and SMMC-7721 cells were seeded in 96-well plates (5000 cells/well). After incubation for the indicated time, 10ml of CCK-8 reagent was added to each well, and after co-incubation at 37 ℃ for 4 hours, the absorbance at 450nm was measured for each well by a microplate reader (SpectraMax iD3, molecular Devices, USA) to check the number of living cells.

Nile red dyeing

After 24 hours of transfection, cells were washed twice with PBS and fixed with 4% paraformaldehyde for 10 minutes at room temperature. After the last PBS wash, the cells were stained with nile red (# 7385-67-3, soribao) for 15 minutes at room temperature. After washing with PBS, nuclei were stained with DAPI (#c1006, bi-cloudy day) for 5 min and washed with PBS. Fluorescence images were captured using a fluorescence microscope (Olympus, japan).

EdU staining method

Stably transfected HepG2 and SMMC-7721 cells (5X 10) ⁴ ) Inoculate in 24-well plates. Using BeyoClick ^TM EdU cell proliferation kit and Alexa Fluor 594 imaging kit (#c0078S, bi yun). EdU staining was performed according to the instructions. Then, DAPI (#c1006, bi-cloudy) solution was incubated with the cells for 5 minutes at room temperature. The image was observed and captured under a fluorescence microscope (Olympus, japan). The positive rate of cells EdU is determined by the ratio of EdU positive nuclei (red)/fluorescent nuclei (blue).

In vitro terminal deoxynucleotidyl transferase dUTP notch end marker (TUNEL) staining

Apoptosis in stably transfected HepG2 and SMMC-7721 cells was detected using a one-step TUNEL apoptosis detection kit (#c1090, bi-cloudy days) according to the detection kit instructions. After washing twice with PBS and fixing with 4% paraformaldehyde for 30 min, the cells were permeabilized in 0.3% Triton X-100 (#ST797, biyun days) for 5 min at room temperature. Then, the cells were washed twice with PBS and incubated with TUNEL detection solution at 37℃for 1 hour in the dark, and then nuclei were stained with DAPI (#C1006, biyun) for 5 minutes. After three washes with PBS, red fluorescence of apoptotic cells was captured with a fluorescence microscope (Olympus, japan). Apoptosis rate was calculated as TUNEL positive cells (red)/DAPI (blue).

Statistical analysis

Quantitative values of the data are expressed as mean ± Standard Error (SEM). The mean values of the two groups of samples were compared using Student's two-tailed T-test and the multiple groups of samples were compared using one-way analysis of variance (ANOVA), followed by either Bonferroni's post-hoc test (data for demonstrating variance homogeneity) or Tamhane's T2 (M) post-hoc test (data for demonstrating heteroscedastic). Final data analysis used GraphPad Prism software (version 8.0 or 9.2.0;Graph Pad Software,Inc, san Diego, CA) or SPSS statistical software (version 26.0.0.2; ibm, inc., new York, USA). P values <0.05 were considered significant. Randomization and blind methods were employed as much as possible.

EXAMPLE 1 Down-regulation of DUSP22 expression in fatty liver

In the present invention, we first examined the expression changes of 25 DUSPs family members in liver tissue of NASH patients and liver tissue of high fat/high cholesterol diet-induced model NASH mice using a high throughput quantitative PCR (HTqPCR) assay. Pathological section results show that the NASH patients have obvious hepatocyte saccule, severe inflammatory cell infiltration and hepatic fibrosis. The results showed that the expression levels of DUSP3, DUSP8, DUSP12, DUSP14, DUSP16, DUSP22 and DUSP26 were significantly reduced compared to the normal samples. Similar down-regulation of expression of these dusp family members was also detected in livers of HFHC-fed mice. Western blotting (Western blotting) and real-time fluorescent quantitative PCR (RT-qPCR) results showed that, among these affected DUSPs, DUSP22 was most severely down-regulated in NASH patients and mouse models, with significantly lowest protein and gene expression levels (fig. 1). In addition, liver DUSP22 protein expression levels showed a more pronounced negative correlation trend with indexes such as Body Mass Index (BMI), serum Total Cholesterol (TC), gamma-glutamyl transpeptidase (GGT), fasting blood glucose, alkaline phosphatase (AKP), type IV collagen (IVC), laminin (LN) content, and IL-6 gene expression compared to DUSP3, DUSP8, duspp12, DUSP14, DUSP16, DUSP26 (fig. 2). Multiple linear regression and Pearson multiple correlation analysis showed that liver DUSP22 protein expression was significantly negatively correlated with NASH severity (fig. 3). The levels of mRNA and protein expression of liver DUSP22 were significantly reduced in mice fed HFHC for 24 weeks and ob/ob groups compared to normal diet (NCD) and lean body groups (fig. 4). These results indicate that, among the DUSP family members, DUSP22 is significantly reduced in both NASH patients and mouse models.

To build an in vitro cell model of lipid accumulation, we used PO culture cells composed of Palmitic Acid (PA) and Oleic Acid (OA). The results showed that expression of mouse primary hepatocytes DUSP22 was significantly reduced after PO treatment (fig. 5). To confirm that the expression changes of DUSP22 are indeed correlated with dyslipidemia and inflammation under metabolic stress, we constructed a special in vitro model. Serum from NASH subjects (NASH serum) or non-steatosis subjects (non-steasis serum) was obtained, conditioned Medium (CM) was prepared, and then human hepatocytes L02 cells were cultured. The results show that CM containing serum of NASH subjects significantly increased lipid deposition and intracellular Triglyceride (TG) content of L02 cells. The levels of pro-inflammatory cytokines and chemokines TNF- α, IL-6, IL-18 and MCP-1 were significantly elevated in L02 cells cultured with NASH serum compared to the non-adipose denatured group. Importantly, we found that various adipogenic factors, including TNF- α, IL-6 and LPS, significantly inhibited expression of DUSP22 (FIG. 6).

Given the significant decrease in expression of DUSP22 in fatty liver, we next utilized adenovirus-mediated shDUSP22 gene suppression (Ad-shDUSP 22) and adenovirus-mediated DUSP22 overexpression (Ad-DUSP 22) vectors to construct in vitro models, primarily studying the regulatory role of DUSP22 on liver steatosis in L02 cells cultured in CM containing serum from NASH or steatosis-free individuals. First, DUSP22 deletion or overexpression had no significant effect on the expression changes of other DUSPs. We then found that serum from NASH subjects resulted in accumulation of lipids and intracellular TG in L02 cells, whereas Ad-shDUSP22 significantly exacerbated this process, accompanied by an exacerbation of pro-inflammatory molecule gene expression (fig. 7). In contrast, DUSP22 overexpression significantly improved NASH serum-induced L02 cell lipid deposition and inflammatory response (fig. 8). The serum TGF- β1 concentration was also higher in NASH patients than in non-steatodenatured patient groups. The hepatic steatosis stimulatory factor TGF- β1 strongly down-regulates expression of DUSP22 in L02 cells (fig. 9), suggesting that DUSP22 may be involved in liver fibrosis. We have subsequently found that CM from NASH serum-treated L02 cells significantly increased the expression of the fibrosis markers α -SMA, COL1A1, COL3A1 and CTGF in human Hepatic Stellate Cell (HSC) LX2 cell lines, whereas Ad-shDUSP22 may significantly exacerbate these effects. However, ad-DUSP22 significantly alleviates this phenomenon (FIG. 10). The above in vitro cell experiments initially demonstrate the inhibitory effect of DUSP22 on lipid deposition, inflammation and fibrosis, revealing the potential of DUSP22 for the treatment of NASH.

EXAMPLE 2 ROS inhibiting expression of DUSP22

ROS are key factors in adipogenesis and are abundantly produced in the liver of NASH animal models, so we intervene with the ROS scavenger N-acetylcysteine (NAC) in HFHC-induced NASH mice. Likewise, 24-week HFHC significantly increased hepatic ROS production, MDA and H ₂ O ₂ While NAC co-intervention can significantly improve these conditions, while improving the activity of antioxidant enzyme SOD (fig. 11). Notably, NAC significantly upregulated HFHC-inhibited DUSP22 expression levels (fig. 12). Pearson correlation analysis further revealed DUSP22 expression and H in the liver of HFHC fed mice ₂ O ₂ There was a clear negative correlation between the contents (fig. 13). We found that, through H ₂ O ₂ The expression level of DUSP22 protein was gradually decreased in treatment 6-48 hours, while the expression level of DUSP22 protein was significantly restored after NAC treatment. Furthermore, NAC treatment significantly restored the expression of DUSP22 in PO-cultured primary hepatocytes (fig. 14). Taken together, ROS production during NASH pathology inhibits DUSP22 expression.

Example 3 hepatocyte-specific DUSP22 knockout exacerbates HFHC-induced NASH pathology

Based on the important role of DUSP22 in fatty liver, we further constructed hepatocyte-specific DUSP22 knockout mice (DUSP 22 ^HepKO ). Western blotting results demonstrated that the knockout of DUSP22 did not affect the expression changes of other DUSPs. With DUSP22 ^flox Mice were induced by NCD diet for 24 weeks, DUSP22 compared to ^HepKO The mice do not haveAny NASH-related pathological phenotype occurred, serum ALT and AST concentrations, tumor necrosis factor TNF- α and interleukin IL-1β levels, and liver TG, TC levels were all at normal levels with no significant changes (fig. 15). Indicating DUSP22 ^HepKO The mice strain did not have a spontaneous NASH liver phenotype.

Subsequently, DUSP22HepKO mice were subjected to HFHC feeding for 24 weeks to investigate whether DUSP22 knockout was involved in the development of liver steatosis. After HFHC feeding, DUSP22 ^HepKO The liver weight and liver coefficient (LW/BW) of mice were significantly higher than DUSP22 ^flox There was no significant difference in the body weight change between the mice in the group and the two groups (FIGS. 16A-C). With DUSP22 ^flox HFHC-fed DUSP22HepKO mice exhibited higher fasting blood insulin levels and insulin resistance steady state model assessment (HOMA-IR) values compared to mice (fig. 16D and E). Glucose Tolerance Test (GTT) demonstrated that it was compatible with DUSP22 ^flox Compared to mice, after HFHC feeding, the DUSP22HepKO mice had decreased glucose tolerance (fig. 16F). With DUSP22 ^flox Group comparison, DUSP22 ^HepKO The ALT and AST concentrations in HFHC-induced mouse serum were exacerbated, indicating that DUSP22 knockout aggravated liver dysfunction (fig. 16G). Furthermore, after feeding HFHC, DUSP22 ^HepKO Mice had more severe liver steatosis and further worsened liver appearance, manifested by hepatocyte spheroid degeneration, inflammatory cell infiltration, collagen accumulation and higher NAS scores. Likewise, DUSP22 ^HepKO The liver inflammatory response of mice is obviously aggravated, and the liver inflammatory response is obviously enhanced with DUSP22 ^flox CD11b positive inflammatory cell infiltration was more pronounced following HFHC feeding compared to mice (fig. 17). Furthermore, DUSP22 ^HepKO Aggravate lipid accumulation and inflammatory response in mice of HFHC group, manifested by higher liver TG, total Cholesterol (TC) and non-esterified fatty acids (NEFA) levels, and higher serum pro-inflammatory factor levels (TNF- α, IL-1β, IL-6, MCP-1). The RT-qPCR results further showed that DUSP22 after HFHC feeding ^flox Abnormal gene expression in mouse liver associated with inflammation, lipid metabolism and fibrosis; however, these phenomena are exacerbated by the lack of hepatocyte DUSP22 expression (fig. 18). Fat accumulation in the viscera is often associated with metabolic disorders. The variation in food intake was not significantly different among the groups of mice. However, with DUSP22 ^flox Compared with mice, after HFHC feeding, DUSP22 ^HepKO Body Fat Weight (BFW) and BFW/BW of mice increased significantly. However, changes in expression of hepatocellular DUSP22 did not affect the size of HFHC fed mouse adipocytes.

We also examined a source derived from DUSP22 ^flox Or DUSP22 ^HepKO Primary hepatocytes and DUSP 22-deleted L02 cells of mice. Likewise, the DUSP22 knockout had no significant effect on the expression of other DUSPs. The results demonstrate that murine hepatocytes and L02 cells lacking DUSP22 expression release higher levels of pro-inflammatory cytokines after PO stimulation. RT-qPCR results demonstrated that in both PO-induced cell lines, the DUSP22 deletion aggravated the inflammatory response (FIG. 19). Consistent with the results of animal experiments, DUSP22 expression-deficient primary hepatocytes and L02 cells exhibited more severe lipid deposition and TG accumulation following PO treatment, and exhibited significant expression abnormalities with lipid metabolism-related genes (fig. 20). PO-stimulated DUSP22 ^HepKO After CM culture induction of hepatocytes, expression of fibrosis-associated molecules in LX2 cells was significantly exacerbated (fig. 21).

The above results of cell level and animal level experiments indicate that a deficiency of DUSP22 may exacerbate the development of NASH pathology.

Example 3 liver cell-specific DUSP22 overexpression can ameliorate HFHC-induced NASH pathology

Based on Rosa26 conditions and/or the way in which transgenesis is induced, we further established DUSP22 conditional knock-in mice using the Rosa26 site (DUSP 22 ^Rosa ) Successful construction of hepatocyte-specific DUSP22 overexpressing mice (DUSP 22 ^HepOE ) To further demonstrate the regulatory function of DUSP22 in NASH. Then to DUSP22 ^Rosa Mice injected with adeno-associated virus serotype 8-thyroxine-binding globulin promoter-cre recombinase vector (AAV 8-TBG-cre), induced overexpression of DUSP22 in hepatocytes alone, while DUSP22 injected with AAV8-TBG blank vector ^HepRosa Mice served as controls. By H&E staining and biochemical analysis, and DUSP22 ^HepRosa Compared with mice, DUSP22 ^HepOE Mice were unable to spontaneously develop NASH-related hepatopathological phenotypes 24 weeks after NCD diet (fig. 22). Furthermore, HFHC feedingAfter 24 weeks of consumption, DUSP22 ^HepOE The liver weight and LW/BW of mice were significantly lower than DUSP22 ^HepRosa A mouse; while DUSP22 ^HepRosa HFHC group and DUSP22 ^HepOE There was no significant difference in body weight change in mice in the HFHC group. DUSP22 overexpression significantly down-regulated HFHC-induced fasting insulin levels, HOMA-IR values and improved impaired glucose tolerance (fig. 23). DUSP22 ^HepOE Can also improve liver dysfunction in HFHC mice and reduce serum ALT and AST levels (FIG. 24). With DUSP22 ^HepRosa Compared with mice, DUSP22 ^HepOE Following HFHC feeding, liver sections showed significantly reduced hepatocyte ballooning, NAS scoring, lipid deposition, fibrosis and cd11b positive inflammatory cell infiltration (fig. 25). DUSP22 ^HepOE Mice also showed a significant decrease in liver steatosis following HFHC stimulation, decreased liver TC, TG and NEFA levels and improved levels of gene expression associated with lipid metabolism (fig. 26). With DUSP22 ^HepRosa Group comparison, HFHC treated DUSP22 ^HepOE The mice serum and liver inflammation markers were significantly reversed. Hepatocyte-specific DUSP22 overexpression significantly reduced the expression of fibrosis-related genes in the livers of HFHC fed mice (figure 27). HTqPCR results demonstrated that DUSP22 was induced 24 weeks after HFHC induction ^HepOE Significantly reduced liver inflammatory response, dyslipidemia and fibrosis (fig. 28).

To verify the protective function of DUSP22, DUSP22 is isolated ^HepRosa And DUSP22 ^HepOE Mouse hepatocytes, and L02 cells Ad-DUSP22.DUSP22 overexpression did not affect the expression changes of other DUSPs members. Consistent with in vivo results, PO-triggered lipid deposition and TG accumulation were significantly reversed in DUSP22 overexpressed mouse and human hepatocytes, while lipid metabolism-related gene expression levels were improved (fig. 29). DUSP22 expression also significantly improved PO-induced inflammatory factor release. RT-qPCR further showed anti-inflammatory effects of DUSP22 in PO-stimulated hepatocytes and L02 cells (FIG. 30). And from DUSP22 ^HepRosa Compared to LX2 cells cultured in CM of hepatocytes, DUSP22 from PO induction ^HepOE Hepatocyte CM significantly down-regulated the expression of fibrosis-associated genes in LX2 cells (fig. 31). Taken together, these findings reveal that upregulation of DUSP22 can improve fatty liverThe occurrence and development of inflammation.

EXAMPLE 4 DUSP22 alleviating HFMCD-induced NASH pathological phenotype

Since the molecular mechanisms of the development of NASH caused by high fat diet plus methionine choline deficiency diet (HFMCD) and other high energy diets (e.g., HFHC) are different, to elucidate whether DUSP22 has a similar effect on HFMCD-induced NASH, we established a HFMCD-triggered NASH mouse model and achieved hepatocyte DUSP22 knockout (DUSP 22 by the experimental methods described above ^HepKO ) And overexpression (DUSP 22) ^HepOE ). HFMCD stimulation results in DUSP22 ^flox Mice had significantly reduced body weight, significant liver steatosis, elevated NAS scores, lipid deposition and collagen accumulation. Notably, DUSP22 ^HepKO These histological lesions of HFMCD mice were significantly exacerbated, but there was no significant effect on body weight (fig. 32). In contrast, DUSP22 ^HepOE Liver steatosis was significantly improved, and hepatocyte spheroid lesions, NAS scores, lipid accumulation and fibrosis levels were reduced, but without affecting the mice weight change (fig. 33). DUSP22 feeding HFMCD ^HepKO Serum ALT and AST levels and liver TG, TC, NEFA levels were significantly elevated in mice, whereas HFMCD-fed DUSP22 ^HepOE ALT and AST levels were significantly reduced in mouse serum (FIG. 34). Furthermore, DUSP22 ^HepKO Exacerbating HFMCD-induced expression of liver fibrosis markers, whereas DUSP22 ^HepOE Mice can reverse the abnormal expression of these molecules. DUSP22 ^HepKO Significantly exacerbating the liver inflammatory response in HFMCD mice, whereas DUSP22 ^HepOE Can improve liver inflammatory response (FIG. 35).

The above results further demonstrate that DUSP22 can also alleviate HFMCD-induced NASH progression.

EXAMPLE 5 DUSP22 modulates the activation of the NF- κB and FAK signaling pathways in the liver of HFHC fed mice

To elucidate in depth the molecular mechanism of action of DUSP22, we studied downstream signaling pathways associated with DUSP 22-mediated inflammatory responses. Given the ability of DUSP22 to regulate MAPKs activation, and the close relationship of MAPKs signaling activation to be involved in the development of pathological NASH, we first evaluated DUSP22 ^HepKO And DUSP22 ^HepOE Mice at HActive expression of pro-inflammatory signals NF- κB and MAPKs in fatty liver after FHC feeding. Consistent with the changes in inflammatory response described above, we found DUSP22 ^HepKO By promoting the expression of phosphorylated IKKα, ikBα and NF-kB/p 65, the HFHC-induced excessive activation of the NF-kB signaling pathway of the transcription factor is significantly improved. While DUSP22 ^HepOE Mice significantly inhibited the activation levels of these proteins. We then further examined the active expression levels of MAPKs pathways. As shown in fig. 36, HFHC ingestion or PO stimulation significantly activated MAPKs signaling pathways, and the phosphorylation levels of p38, MEK1/2, ERK1/2, and JNK1/2 were significantly upregulated in liver tissue and primary hepatocytes. However, the deletion of DUSP22 further aggravates the activity of p-MEK1/2 and p-ERK1/2, while there is no effect on p-p38 and p-JNK1/2, while overexpression of DUSP22 significantly inhibits their activation. Activation of FAK, ASK1, TAK1 and TBK1 can mediate NF- κb and MAPKs signaling pathways under a variety of pathological conditions. We found that HFHC feeding resulted in liver FAK ^Y576+Y577 、FAK ^Y397 The phosphorylation activities of ASK1, TAK1 and TBK1 were significantly increased. Notably, DUSP22 ^HepKO Only exacerbate FAK ^Y576+Y577 And FAK ^Y397 Without affecting the phosphorylation activity of ASK1, TAK1 and TBK 1. These effects were also demonstrated in PO treated DUSP22 deleted primary hepatocytes.

Taken together, these findings demonstrate that DUSP22 protects liver steatosis by inhibiting NF- κ B, ERK1/2 and FAK signaling pathways.

EXAMPLE 6 DUSP22 Regulation of NASH development by acting on FAK

As shown in FIG. 37, co-immunoprecipitation (co-IP) results indicate that there is an interaction between DUSP22 and FAK. Glutathione s-transferase (GST) precipitation analysis confirmed that a direct interaction relationship does exist between DUSP22 and FAK. The inhibition of FAK activation at positions Y576+y577 and Y397 by DUSP22 is dose dependent.

Furthermore, we found that expression of p-FAKY576+y577 and p-FAKY397 in liver tissue was significantly upregulated in NASH patients compared to non-steatosis patients, indicating significantly elevated levels of FAK activity. As shown in fig. 38, FAKY576+y577 and FAKY397 were significantly up-regulated in the livers of HFHC fed mice, we detected p-FAKY576+y577 and p-FAKY397. Expression of DUSP22 and activation of FAK show a clear negative correlation in the development of NASH.

We further found that in PO-stimulated FAK-deficient L02 cells, the introduction of FAK-FERM and FAK-kinase mutants activated FAK activity and downstream ERK1/2 and NF- κB/p65 activity, accompanied by pro-inflammatory responses, lipid deposition and intracellular TG accumulation, but that the introduction of FAK-related non-kinase (FRNK) variants did not, as shown in FIG. 39. These findings above indicate that DUSP22 directly interacts with FAK and primarily inhibits FAK activation at the Y576+y577 and Y397 sites, which is likely necessary for DUSP22 to alleviate NASH development in vivo and in vitro.

We infected hepatocytes with adenovirus vectors expressing full length DUSP22 or mutant DUSP22 (C88S) with serine instead of cysteine 88 to further determine if the interaction of DUSP22 and FAK is essential for DUSP22 to exert its biological function in PO-cultured cells. We found that the C88S mutation significantly abrogated the effect of DUSP22 on inhibition of lipid deposition and TG accumulation in mouse primary hepatocytes and L02 cells under PO stimulation. In addition, after PO stimulation induced primary hepatocytes and L02 cells, the C88S mutation significantly abrogated DUSP22 inhibition of FAK ^Y576+Y577 、FAK ^Y397 The effects of IκBα and NF- κB/p65 phosphorylation were accompanied by restoration of the pro-inflammatory response (FIG. 40). Expression of DUSP22 significantly improved PO-induced hepatocyte dyslipidemia, but this effect completely disappeared when DUSP22-C88S was mutated (fig. 41). PO-cultured mouse hepatocyte conditioned medium with DUSP22-C88S mutation was collected and the culture of LX2 cells continued. The results showed that the expression of the fibrosis-associated gene inhibited by DUSP22 was significantly eliminated (fig. 41).

Example 7 Effect of FAK inactivation on DUSP22 function

In view of the key role of FAK activation in NASH development, to further confirm the inhibitory effect of DUSP22 on FAK signaling, we constructed hepatocyte FAK-specific knockout mice (FAK ^HepKO ) And hepatocyte DUSP22/FAK specific double knockout mice (HepDKO). FAK deletion reverses DUSP22 expression deletion versus HFHCInduced FAK ^Y576+Y577 And FAK ^Y397 Enhancement of phosphorylation. Especially after HFHC stimulation, the FAK deficiency significantly improved DUSP22 ^HepKO Exacerbating up-regulated liver weight, LW/BW ratio, blood glucose levels, fasting insulin content, HOMA-IR values, and mouse serum ALT and AST concentrations (fig. 42). FAK knockdown also eases DUSP22 ^HepKO Exacerbated HFHC-induced NAS scoring, lipid deposition, fibrosis formation and CD11B positive inflammatory cell infiltration (fig. 43), while significantly reducing liver TG, TC and NEFA levels, as well as serum pro-inflammatory factors, liver ikbα and NF- κb/p65 phosphorylation expression levels (fig. 44). In addition, FAK in PO-cultured primary hepatocytes and L02 cells ^Y576+Y577 And FAK ^Y397 Inhibition of activity significantly eases the increased lipid deposition, intracellular TG production, and expression of p-IκBα and p-NF- κB/p65 by Ad-shDUSP22 (FIG. 45).

To further demonstrate the role of the DUSP22/FAK signaling axis in NASH pathogenesis, we have further established another specific NASH in vivo model. FAK (Fabry-Perot) ^HepKO Mouse and FAK ^flox The constructed lentivirus LV-shDUSP22 was injected intravenously into the portal of mice to construct hepatocellular-specific DUSP22-FAK double-deleted mice or hepatocellular-specific FAK-deleted mice, which were then fed with 24-week HFHC diet (FAK ^HepKO HFHC feed) or halfway feeding HFHC diet (FAK ^HepKO /LV-shDUSP22/HFHC，FAK ^flox LV-shDUSP 22/HFHC). We found that FAK fed with HFHC ^flox FAK compared with LV-shDUSP22 mice ^HepKO The progression of exacerbated NASH by LV-shDUSP22 was significantly improved, shown by down-regulated liver weight, LW/BW ratio, blood glucose levels, fasting insulin levels, HOMA-IR index, and ALT and AST concentrations in serum, but without affecting body weight changes. As shown in fig. 46, FAK ^HepKO After HFHC feeding, the LV-shDUSP22 mice have symptoms of hepatocyte spheroid degeneration, NAS score, lipid deposition, fibrosis, CD11b positive inflammatory cell infiltration and the like which are all superior to those of FAK ^flox The LV-shDUSP22 mice were improved. With FAK ^flox Compared with LV-shDUSP22 mice, HFHC-induced liver TG, TC, NEFA content abnormality, lipid metabolism and fibrosis related gene overexpression level is controlled by FAK ^HepKO Effectively inhibit. With FAK ^flox FAK compared with LV-shDUSP22 mice ^HepKO Expression of p-IκBα and p-NF- κB/p65 was also significantly reduced in livers of/LV-shDUSP 22 mice, while HFHC-induced serum and/or pro-inflammatory factors in the livers were also improved.

These results indicate that inhibition of FAK activity is critical for DUSP22 to alleviate NASH progression.

EXAMPLE 8 DUSP22 inhibits HFHC-induced NASH pathology

The lentiviral-loaded full-length DUSP22 sequence (LV-DUSP 22) or shRNA targeted to inhibit DUSP22 (LV-shDUSP 22) was further constructed, followed by in vitro gene therapy methods to reveal the therapeutic role of DUSP22 in the development of NASH. In the mouse transplantation model, hepatocyte-specific DUSP22 expression (LV-DUSP 22) significantly reduced HFHC up-regulated liver weight, LW/BW ratio, blood glucose concentration, fasting insulin level, HOMA-IR values, and ALT and AST concentrations in mouse serum; however, hepatocyte-specific DUSP22 knockout (LV-shDUSP 22) significantly aggravated the HFHC-induced NASH phenotype, but did not affect the weight change in the mice of each group (fig. 47). In addition, as shown in fig. 48, LV-DUSP22/HFHC mice had significantly reduced liver cell spheroid degeneration, NAS scores, liver tissue lipid deposition, fibrosis, inflammatory cell infiltration, down-regulated liver TG, TC, NEFA content, and reduced serum pro-inflammatory factor release levels. As shown in FIG. 49, LV-DUSP22/HFHC mice exhibited significantly down-regulated levels of FAK, IκBα and NF- κB/p65 phosphorylation and expression of genes associated with fibrosis, inflammation and lipid metabolism compared to LV-Ctrl/HFHC mice. However, after HFHC feeding, LV-shDUSP22 mice exhibited more severe liver steatosis than LV-shCtrl mice.

These results indicate that the occurrence and development of NASH induced by HFHC can be effectively alleviated by DUSP22 in vitro gene therapy.

EXAMPLE 9 DUSP22 improving NASH-related HCC development

We examined the expression level of DUSP22 in human NAFLD-HCC tumor samples and paired adjacent normal tissues. As shown in fig. 50, mRNA and protein expression levels of DUSP22 were also significantly down-regulated in NAFLD-HCC samples compared to adjacent normal samples. Then, we examined the expression of DUSP22 in two obesity-related NAFLD-HCC mouse models. Similarly, DUSP22 expression levels were significantly reduced in all liver cancer tumor tissues of N, N-Diethylnitrosamine (DEN) and HFHC treated mice. Likewise, significantly down-regulated DUSP22 was also observed in HCC tumors in DEN-induced ob/ob mice. In addition, the hepatoma cell lines (Hep 3B, hepG2 and SMMC-7721) also exhibited significantly reduced DUSP22 expression levels compared to non-tumor cells, as shown in figure 51.

These results indicate that down-regulation of DUSP22 may be germane to the development of NAFLD-related HCC.

Subsequently, we apply to DUSP22 ^HepKO And DUSP22 ^HepOE The mice were treated with DEN (25 mg/kg;2 weeks old), DUSP22 ^flox And DUSP22 ^HepRosa Mice were used as the corresponding control groups, and NASH-HCC model was constructed by 24-week HFHC diet induction, with no significant difference in weight change among the groups of mice. As shown in FIG. 52, after DEN/HFHC treatment, DUSP22 ^HepKO Mice and DUSP22 ^flox Compared with mice, the number of liver surface tumors is larger and the volume is larger. DUSP22 under DEN/HFHC stimulation ^HepKO Liver weight, LW/BW ratio, serum ALT and AST concentrations, liver TG and TC levels were all higher than DUSP22 in mice ^flox And (3) a mouse. In contrast, liver-specific DUSP22 overexpression significantly inhibited NASH-related HCC development in the nan/HFHC mice with improved NASH phenotype. Notably, DUSP22 ^HepOE In addition to regulating tumorigenesis, pathological features of NASH including liver steatosis, fibrosis, F4/80 mediated inflammatory cell infiltration are also significantly inhibited. With DUSP22 ^HepRosa Compared with mice, DUSP22 ^HepOE Obviously inhibit DEN/HFHC induced KI-67 positive expression level, simultaneously block downstream FAK, ERK1/2 and NF- κB signal paths, reduce inflammation and fibrosis related gene expression, and inhibit proliferation of liver cancer cells. However, with DUSP22 ^flox Compared with DEN/HFHC mice, the DEN/HFHC-induced NASH-related HCC has histological and mechanical characteristics of DUSP22 ^HepKO Significant exacerbations were seen in mice (fig. 53). In addition, in vitro transfection of Ad-shDUSP22 or HepG2 and SMMC-772 of Ad-DUSP22 by CCK-8 and EdU staining compared to the corresponding control group1 cell. As shown in fig. 54, DUSP22 knockout significantly promoted liver cancer cell proliferation, while DUSP22 overexpression effectively inhibited HCC cell growth. TUNEL staining demonstrated that promoting DUSP22 expression can lead to apoptosis of hepatoma cells. Similarly, ad-shDUSP22 can obviously improve FAK of HepG2 cells ^Y576+Y577 、FAK ^Y397 Phosphorylation levels of ERK1/2, IκBα and NF- κB, whereas Ad-DUSP22 inhibits FAK in HepG2 cells ^Y576+Y577 、FAK ^Y397 Phosphorylation levels of ERK1/2, IκBα and NF- κB.

These results indicate that DUSP22 has inhibitory effects on NAFLD-related HCC both in vivo and in vitro.

To further determine whether FAK inhibition was involved in NASH-HCC progression with DUSP22 inhibition, we subsequently measured FAK activation levels in the liver of NAFLD-HCC patients. Western blotting results show that NAFLD-HCC patient p-FAK ^Y576+Y577 And p-FAK ^Y397 Is significantly higher than in normal tissue samples. Subsequently, DUSP22 is utilized ^HepKO 、FAK ^HepKO And Hep-DKO mice a NASH-HCC mouse model was developed to investigate the effect of FAK activation on DUSP 22-regulated NASH-HCC progression. As shown in FIG. 55, FAK fed in DEN/HFHC ^HepKO And DuSP22 in Hep-DKO group mice ^HepKO The exacerbated NASH-HCC is significantly reduced, with a significant reduction in tumor number and size. DUSP22 after FAK knockout ^HepKO The number of cells positively stained with enhanced KI-67 was also significantly reduced. H&E staining showed DUSP22 after DEN/HFHC induction ^HepKO Mice developed more severe histopathological features, manifested by cancer cells distributed in liver parenchymal tissues, indicating abnormal liver structure, whereas FAK ^HepKO The mice or Hep-DKO mice were significantly improved, with a significant decrease in serum ALT and AST concentrations, revealing an improvement in liver function.

The above experimental results show that the inhibition of the development of NASH-HCC by DUSP22 is closely related to the blocking of FAK signal.

Example 10 Small molecule Compounds promote the detection of expression of DUSP22

DUSP22 expression was reduced in PO-induced L02 cells, and divided into control and dosing groups at a concentration of 100. Mu. Mol/LThe compounds intervene to detect the mRNA level of DUSP22, to divide the mRNA level of DUSP22 in the dosing group by the mRNA level of DUSP22 in the control group (Q _drug /Q _ctrl ) As an evaluation compound for its ability to promote DUSP22 expression. The results are shown in Table 1 below, where the expression level of DUSP22 was increased 2.8-8.4-fold following compound intervention by PO.

TABLE 1 Effect of small molecule Compounds on PO-induced DUSP22 expression

/>

Example 11 Chinese herbal extracts promote the detection of expression of DUSP22

Inducing a decrease in expression of DUSP22 by L02 cells with PO, dividing into a control group and a dosing group, intervening with an alcohol extract at a concentration of 100mg/L, detecting the mRNA level of DUSP22, dividing the mRNA level of DUSP22 in the dosing group by the mRNA level of DUSP22 in the control group (Q _drug /Q _ctrl ) As an evaluation compound for its ability to promote DUSP22 expression. The results are shown in Table 2 below, where the expression level of DUSP22 was increased 2.9-4.8-fold in response to the dry condition of the herbal extract by PO.

TABLE 2 Effect of Chinese medicinal extracts on PO-induced DUSP22 expression

/>

/>

Sequence listing

<110> Chongqing Mei Pu blue technology Co., ltd

Application of <120> DUSP22 in preparation of NAFLD/NASH (non-fluorescent protein/non-fluorescent protein) marker and medicament

<130> 2022.4.19

<141> 2022-05-13

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 184

<212> PRT

<213> Homo sapiens

<400> 1

Met Gly Asn Gly Met Asn Lys Ile Leu Pro Gly Leu Tyr Ile Gly Asn

1 5 10 15

Phe Lys Asp Ala Arg Asp Ala Glu Gln Leu Ser Lys Asn Lys Val Thr

20 25 30

His Ile Leu Ser Val His Asp Ser Ala Arg Pro Met Leu Glu Gly Val

35 40 45

Lys Tyr Leu Cys Ile Pro Ala Ala Asp Ser Pro Ser Gln Asn Leu Thr

50 55 60

Arg His Phe Lys Glu Ser Ile Lys Phe Ile His Glu Cys Arg Leu Arg

65 70 75 80

Gly Glu Ser Cys Leu Val His Cys Leu Ala Gly Val Ser Arg Ser Val

85 90 95

Thr Leu Val Ile Ala Tyr Ile Met Thr Val Thr Asp Phe Gly Trp Glu

100 105 110

Asp Ala Leu His Thr Val Arg Ala Gly Arg Ser Cys Ala Asn Pro Asn

115 120 125

Val Gly Phe Gln Arg Gln Leu Gln Glu Phe Glu Lys His Glu Val His

130 135 140

Gln Tyr Arg Gln Trp Leu Lys Glu Glu Tyr Gly Glu Ser Pro Leu Gln

145 150 155 160

Asp Ala Glu Glu Ala Lys Asn Ile Leu Ala Ala Pro Gly Ile Leu Lys

165 170 175

Phe Trp Ala Phe Leu Arg Arg Leu

180

<210> 2

<211> 184

<212> PRT

<213> Mus musculus

<400> 2

Met Gly Ser Gly Met Ser Gln Ile Leu Pro Gly Leu Tyr Ile Gly Asn

1 5 10 15

Phe Lys Asp Ala Arg Asp Ala Glu Gln Leu Ser Arg Asn Lys Val Thr

20 25 30

His Ile Leu Ser Val His Asp Thr Ala Arg Pro Met Leu Glu Gly Val

35 40 45

Lys Tyr Leu Cys Ile Pro Ala Ala Asp Thr Pro Ser Gln Asn Leu Thr

50 55 60

Arg His Phe Lys Glu Ser Ile Lys Phe Ile His Glu Cys Arg Leu Gln

65 70 75 80

Gly Glu Ser Cys Leu Val His Cys Leu Ala Gly Val Ser Arg Ser Val

85 90 95

Thr Leu Val Ile Ala Tyr Ile Met Thr Val Thr Asp Phe Gly Trp Glu

100 105 110

Asp Ala Leu His Thr Val Arg Ala Gly Arg Ser Cys Ala Asn Pro Asn

115 120 125

Leu Gly Phe Gln Arg Gln Leu Gln Glu Phe Glu Lys His Glu Val His

130 135 140

Gln Tyr Arg Gln Trp Leu Arg Glu Glu Tyr Gly Glu Asn Pro Leu Arg

145 150 155 160

Asp Ala Glu Glu Ala Lys Asn Ile Leu Ala Ala Pro Gly Ile Leu Lys

165 170 175

Tyr Trp Ala Phe Leu Arg Arg Leu

180

<210> 3

<211> 1052

<212> PRT

<213> Homo sapiens

<400> 3

Met Ala Ala Ala Tyr Leu Asp Pro Asn Leu Asn His Thr Pro Asn Ser

1 5 10 15

Ser Thr Lys Thr His Leu Gly Thr Gly Met Glu Arg Ser Pro Gly Ala

20 25 30

Met Glu Arg Val Leu Lys Val Phe His Tyr Phe Glu Ser Asn Ser Glu

35 40 45

Pro Thr Thr Trp Ala Ser Ile Ile Arg His Gly Asp Ala Thr Asp Val

50 55 60

Arg Gly Ile Ile Gln Lys Ile Val Asp Ser His Lys Val Lys His Val

65 70 75 80

Ala Cys Tyr Gly Phe Arg Leu Ser His Leu Arg Ser Glu Glu Val His

85 90 95

Trp Leu His Val Asp Met Gly Val Ser Ser Val Arg Glu Lys Tyr Glu

100 105 110

Leu Ala His Pro Pro Glu Glu Trp Lys Tyr Glu Leu Arg Ile Arg Tyr

115 120 125

Leu Pro Lys Gly Phe Leu Asn Gln Phe Thr Glu Asp Lys Pro Thr Leu

130 135 140

Asn Phe Phe Tyr Gln Gln Val Lys Ser Asp Tyr Met Leu Glu Ile Ala

145 150 155 160

Asp Gln Val Asp Gln Glu Ile Ala Leu Lys Leu Gly Cys Leu Glu Ile

165 170 175

Arg Arg Ser Tyr Trp Glu Met Arg Gly Asn Ala Leu Glu Lys Lys Ser

180 185 190

Asn Tyr Glu Val Leu Glu Lys Asp Val Gly Leu Lys Arg Phe Phe Pro

195 200 205

Lys Ser Leu Leu Asp Ser Val Lys Ala Lys Thr Leu Arg Lys Leu Ile

210 215 220

Gln Gln Thr Phe Arg Gln Phe Ala Asn Leu Asn Arg Glu Glu Ser Ile

225 230 235 240

Leu Lys Phe Phe Glu Ile Leu Ser Pro Val Tyr Arg Phe Asp Lys Glu

245 250 255

Cys Phe Lys Cys Ala Leu Gly Ser Ser Trp Ile Ile Ser Val Glu Leu

260 265 270

Ala Ile Gly Pro Glu Glu Gly Ile Ser Tyr Leu Thr Asp Lys Gly Cys

275 280 285

Asn Pro Thr His Leu Ala Asp Phe Thr Gln Val Gln Thr Ile Gln Tyr

290 295 300

Ser Asn Ser Glu Asp Lys Asp Arg Lys Gly Met Leu Gln Leu Lys Ile

305 310 315 320

Ala Gly Ala Pro Glu Pro Leu Thr Val Thr Ala Pro Ser Leu Thr Ile

325 330 335

Ala Glu Asn Met Ala Asp Leu Ile Asp Gly Tyr Cys Arg Leu Val Asn

340 345 350

Gly Thr Ser Gln Ser Phe Ile Ile Arg Pro Gln Lys Glu Gly Glu Arg

355 360 365

Ala Leu Pro Ser Ile Pro Lys Leu Ala Asn Ser Glu Lys Gln Gly Met

370 375 380

Arg Thr His Ala Val Ser Val Ser Glu Thr Asp Asp Tyr Ala Glu Ile

385 390 395 400

Ile Asp Glu Glu Asp Thr Tyr Thr Met Pro Ser Thr Arg Asp Tyr Glu

405 410 415

Ile Gln Arg Glu Arg Ile Glu Leu Gly Arg Cys Ile Gly Glu Gly Gln

420 425 430

Phe Gly Asp Val His Gln Gly Ile Tyr Met Ser Pro Glu Asn Pro Ala

435 440 445

Leu Ala Val Ala Ile Lys Thr Cys Lys Asn Cys Thr Ser Asp Ser Val

450 455 460

Arg Glu Lys Phe Leu Gln Glu Ala Leu Thr Met Arg Gln Phe Asp His

465 470 475 480

Pro His Ile Val Lys Leu Ile Gly Val Ile Thr Glu Asn Pro Val Trp

485 490 495

Ile Ile Met Glu Leu Cys Thr Leu Gly Glu Leu Arg Ser Phe Leu Gln

500 505 510

Val Arg Lys Tyr Ser Leu Asp Leu Ala Ser Leu Ile Leu Tyr Ala Tyr

515 520 525

Gln Leu Ser Thr Ala Leu Ala Tyr Leu Glu Ser Lys Arg Phe Val His

530 535 540

Arg Asp Ile Ala Ala Arg Asn Val Leu Val Ser Ser Asn Asp Cys Val

545 550 555 560

Lys Leu Gly Asp Phe Gly Leu Ser Arg Tyr Met Glu Asp Ser Thr Tyr

565 570 575

Tyr Lys Ala Ser Lys Gly Lys Leu Pro Ile Lys Trp Met Ala Pro Glu

580 585 590

Ser Ile Asn Phe Arg Arg Phe Thr Ser Ala Ser Asp Val Trp Met Phe

595 600 605

Gly Val Cys Met Trp Glu Ile Leu Met His Gly Val Lys Pro Phe Gln

610 615 620

Gly Val Lys Asn Asn Asp Val Ile Gly Arg Ile Glu Asn Gly Glu Arg

625 630 635 640

Leu Pro Met Pro Pro Asn Cys Pro Pro Thr Leu Tyr Ser Leu Met Thr

645 650 655

Lys Cys Trp Ala Tyr Asp Pro Ser Arg Arg Pro Arg Phe Thr Glu Leu

660 665 670

Lys Ala Gln Leu Ser Thr Ile Leu Glu Glu Glu Lys Ala Gln Gln Glu

675 680 685

Glu Arg Met Arg Met Glu Ser Arg Arg Gln Ala Thr Val Ser Trp Asp

690 695 700

Ser Gly Gly Ser Asp Glu Ala Pro Pro Lys Pro Ser Arg Pro Gly Tyr

705 710 715 720

Pro Ser Pro Arg Ser Ser Glu Gly Phe Tyr Pro Ser Pro Gln His Met

725 730 735

Val Gln Thr Asn His Tyr Gln Val Ser Gly Tyr Pro Gly Ser His Gly

740 745 750

Ile Thr Ala Met Ala Gly Ser Ile Tyr Pro Gly Gln Ala Ser Leu Leu

755 760 765

Asp Gln Thr Asp Ser Trp Asn His Arg Pro Gln Glu Ile Ala Met Trp

770 775 780

Gln Pro Asn Val Glu Asp Ser Thr Val Leu Asp Leu Arg Gly Ile Gly

785 790 795 800

Gln Val Leu Pro Thr His Leu Met Glu Glu Arg Leu Ile Arg Gln Gln

805 810 815

Gln Glu Met Glu Glu Asp Gln Arg Trp Leu Glu Lys Glu Glu Arg Phe

820 825 830

Leu Lys Pro Asp Val Arg Leu Ser Arg Gly Ser Ile Asp Arg Glu Asp

835 840 845

Gly Ser Leu Gln Gly Pro Ile Gly Asn Gln His Ile Tyr Gln Pro Val

850 855 860

Gly Lys Pro Asp Pro Ala Ala Pro Pro Lys Lys Pro Pro Arg Pro Gly

865 870 875 880

Ala Pro Gly His Leu Gly Ser Leu Ala Ser Leu Ser Ser Pro Ala Asp

885 890 895

Ser Tyr Asn Glu Gly Val Lys Leu Gln Pro Gln Glu Ile Ser Pro Pro

900 905 910

Pro Thr Ala Asn Leu Asp Arg Ser Asn Asp Lys Val Tyr Glu Asn Val

915 920 925

Thr Gly Leu Val Lys Ala Val Ile Glu Met Ser Ser Lys Ile Gln Pro

930 935 940

Ala Pro Pro Glu Glu Tyr Val Pro Met Val Lys Glu Val Gly Leu Ala

945 950 955 960

Leu Arg Thr Leu Leu Ala Thr Val Asp Glu Thr Ile Pro Leu Leu Pro

965 970 975

Ala Ser Thr His Arg Glu Ile Glu Met Ala Gln Lys Leu Leu Asn Ser

980 985 990

Asp Leu Gly Glu Leu Ile Asn Lys Met Lys Leu Ala Gln Gln Tyr Val

995 1000 1005

Met Thr Ser Leu Gln Gln Glu Tyr Lys Lys Gln Met Leu Thr Ala Ala

1010 1015 1020

His Ala Leu Ala Val Asp Ala Lys Asn Leu Leu Asp Val Ile Asp Gln

1025 1030 1035 1040

Ala Arg Leu Lys Met Leu Gly Gln Thr Arg Pro His

1045 1050

<210> 4

<211> 1052

<212> PRT

<213> Mus musculus

<400> 4

Met Ala Ala Ala Tyr Leu Asp Pro Asn Leu Asn His Thr Pro Ser Ser

1 5 10 15

Ser Thr Lys Thr His Leu Gly Thr Gly Met Glu Arg Ser Pro Gly Ala

20 25 30

Met Glu Arg Val Leu Lys Val Phe His Tyr Phe Glu Ser Ser Ser Glu

35 40 45

Pro Thr Thr Trp Ala Ser Ile Ile Arg His Gly Asp Ala Thr Asp Val

50 55 60

Arg Gly Ile Ile Gln Lys Ile Val Asp Ser His Lys Val Lys His Val

65 70 75 80

Ala Cys Tyr Gly Phe Arg Leu Ser His Leu Arg Ser Glu Glu Val His

85 90 95

Trp Leu His Val Asp Met Gly Val Ser Ser Val Arg Glu Lys Tyr Glu

100 105 110

Leu Ala His Pro Pro Glu Glu Trp Lys Tyr Glu Leu Arg Ile Arg Tyr

115 120 125

Leu Pro Lys Gly Phe Leu Asn Gln Phe Thr Glu Asp Lys Pro Thr Leu

130 135 140

Asn Phe Phe Tyr Gln Gln Val Lys Ser Asp Tyr Met Gln Glu Ile Ala

145 150 155 160

Asp Gln Val Asp Gln Glu Ile Ala Leu Lys Leu Gly Cys Leu Glu Ile

165 170 175

Arg Arg Ser Tyr Trp Glu Met Arg Gly Asn Ala Leu Glu Lys Lys Ser

180 185 190

Asn Tyr Glu Val Leu Glu Lys Asp Val Gly Leu Lys Arg Phe Phe Pro

195 200 205

Lys Ser Leu Leu Asp Ser Val Lys Ala Lys Thr Leu Arg Lys Leu Ile

210 215 220

Gln Gln Thr Phe Arg Gln Phe Ala Asn Leu Asn Arg Glu Glu Ser Ile

225 230 235 240

Leu Lys Phe Phe Glu Ile Leu Ser Pro Val Tyr Arg Phe Asp Lys Glu

245 250 255

Cys Phe Lys Cys Ala Leu Gly Ser Ser Trp Ile Ile Ser Val Glu Leu

260 265 270

Ala Ile Gly Pro Glu Glu Gly Ile Ser Tyr Leu Thr Asp Lys Gly Cys

275 280 285

Asn Pro Thr His Leu Ala Asp Phe Asn Gln Val Gln Thr Ile Gln Tyr

290 295 300

Ser Asn Ser Glu Asp Lys Asp Arg Lys Gly Met Leu Gln Leu Lys Ile

305 310 315 320

Ala Gly Ala Pro Glu Pro Leu Thr Val Thr Ala Pro Ser Leu Thr Ile

325 330 335

Ala Glu Asn Met Ala Asp Leu Ile Asp Gly Tyr Cys Arg Leu Val Asn

340 345 350

Gly Ala Thr Gln Ser Phe Ile Ile Arg Pro Gln Lys Glu Gly Glu Arg

355 360 365

Ala Leu Pro Ser Ile Pro Lys Leu Ala Asn Ser Glu Lys Gln Gly Met

370 375 380

Arg Thr His Ala Val Ser Val Ser Glu Thr Asp Asp Tyr Ala Glu Ile

385 390 395 400

Ile Asp Glu Glu Asp Thr Tyr Thr Met Pro Ser Thr Arg Asp Tyr Glu

405 410 415

Ile Gln Arg Glu Arg Ile Glu Leu Gly Arg Cys Ile Gly Glu Gly Gln

420 425 430

Phe Gly Asp Val His Gln Gly Val Tyr Leu Ser Pro Glu Asn Pro Ala

435 440 445

Leu Ala Val Ala Ile Lys Thr Cys Lys Asn Cys Thr Ser Asp Ser Val

450 455 460

Arg Glu Lys Phe Leu Gln Glu Ala Leu Thr Met Arg Gln Phe Asp His

465 470 475 480

Pro His Ile Val Lys Leu Ile Gly Val Ile Thr Glu Asn Pro Val Trp

485 490 495

Ile Ile Met Glu Leu Cys Thr Leu Gly Glu Leu Arg Ser Phe Leu Gln

500 505 510

Val Arg Lys Tyr Ser Leu Asp Leu Ala Ser Leu Ile Leu Tyr Ala Tyr

515 520 525

Gln Leu Ser Thr Ala Leu Ala Tyr Leu Glu Ser Lys Arg Phe Val His

530 535 540

Arg Asp Ile Ala Ala Arg Asn Val Leu Val Ser Ser Asn Asp Cys Val

545 550 555 560

Lys Leu Gly Asp Phe Gly Leu Ser Arg Tyr Met Glu Asp Ser Thr Tyr

565 570 575

Tyr Lys Ala Ser Lys Gly Lys Leu Pro Ile Lys Trp Met Ala Pro Glu

580 585 590

Ser Ile Asn Phe Arg Arg Phe Thr Ser Ala Ser Asp Val Trp Met Phe

595 600 605

Gly Val Cys Met Trp Glu Ile Leu Met His Gly Val Lys Pro Phe Gln

610 615 620

Gly Val Lys Asn Asn Asp Val Ile Gly Arg Ile Glu Asn Gly Glu Arg

625 630 635 640

Leu Pro Met Pro Pro Asn Cys Pro Pro Thr Leu Tyr Ser Leu Met Thr

645 650 655

Lys Cys Trp Ala Tyr Asp Pro Ser Arg Arg Pro Arg Phe Thr Glu Leu

660 665 670

Lys Ala Gln Leu Ser Thr Ile Leu Glu Glu Glu Lys Val Gln Gln Glu

675 680 685

Glu Arg Met Arg Met Glu Ser Arg Arg Gln Ala Thr Val Ser Trp Asp

690 695 700

Ser Gly Gly Ser Asp Glu Ala Pro Pro Lys Pro Ser Arg Pro Gly Tyr

705 710 715 720

Pro Ser Pro Arg Ser Ser Glu Gly Phe Tyr Pro Ser Pro Gln His Met

725 730 735

Val Gln Thr Asn His Tyr Gln Val Ser Gly Tyr Pro Gly Ser His Gly

740 745 750

Ile Pro Ala Met Ala Gly Ser Ile Tyr Gln Gly Gln Ala Ser Leu Leu

755 760 765

Asp Gln Thr Glu Leu Trp Asn His Arg Pro Gln Glu Met Ser Met Trp

770 775 780

Gln Pro Ser Val Glu Asp Ser Ala Ala Leu Asp Leu Arg Gly Met Gly

785 790 795 800

Gln Val Leu Pro Pro His Leu Met Glu Glu Arg Leu Ile Arg Gln Gln

805 810 815

Gln Glu Met Glu Glu Asp Gln Arg Trp Leu Glu Lys Glu Glu Arg Phe

820 825 830

Leu Lys Pro Asp Val Arg Leu Ser Arg Gly Ser Ile Asp Arg Glu Asp

835 840 845

Gly Ser Phe Gln Gly Pro Thr Gly Asn Gln His Ile Tyr Gln Pro Val

850 855 860

Gly Lys Pro Asp Pro Ala Ala Pro Pro Lys Lys Pro Pro Arg Pro Gly

865 870 875 880

Ala Pro Gly His Leu Ser Asn Leu Ser Ser Ile Ser Ser Pro Ala Asp

885 890 895

Ser Tyr Asn Glu Gly Val Lys Leu Gln Pro Gln Glu Ile Ser Pro Pro

900 905 910

Pro Thr Ala Asn Leu Asp Arg Ser Asn Asp Lys Val Tyr Glu Asn Val

915 920 925

Thr Gly Leu Val Lys Ala Val Ile Glu Met Ser Ser Lys Ile Gln Pro

930 935 940

Ala Pro Pro Glu Glu Tyr Val Pro Met Val Lys Glu Val Gly Leu Ala

945 950 955 960

Leu Arg Thr Leu Leu Ala Thr Val Asp Glu Thr Ile Pro Ala Leu Pro

965 970 975

Ala Ser Thr His Arg Glu Ile Glu Met Ala Gln Lys Leu Leu Asn Ser

980 985 990

Asp Leu Gly Glu Leu Ile Ser Lys Met Lys Leu Ala Gln Gln Tyr Val

995 1000 1005

Met Thr Ser Leu Gln Gln Glu Tyr Lys Lys Gln Met Leu Thr Ala Ala

1010 1015 1020

His Ala Leu Ala Val Asp Ala Lys Asn Leu Leu Asp Val Ile Asp Gln

1025 1030 1035 1040

Ala Arg Leu Lys Met Leu Gly Gln Thr Arg Pro His

1045 1050

<210> 5

<211> 553

<212> DNA

<213> Homo sapiens

<400> 5

atggggaatg ggatgaacaa gatcctgccc ggcctgtaca tcggcaactt caaagatgcc 60

agagacgcgg aacaattgag caagaacaag gtgacacata ttctgtctgt ccatgatagt 120

gccaggccta tgttggaggg agttaaatac ctgtgcatcc cagcagcgga ttcaccatct 180

caaaacctga caagacattt caaagaaagt attaaattca ttcacgagtg ccggctccgc 240

ggtgagagct gccttgtaca ctgcctggcc ggggtctcca ggagcgtgac actggtgatc 300

gcatacatca tgaccgtcac tgactttggc tgggaggatg ccctgcacac cgtgcgtgct 360

gggagatcct gtgccaaccc caacgtgggc ttccagagac agctccagga gtttgagaag 420

catgaggtcc atcagtatcg gcagtggctg aaggaagaat atggagagag ccctttgcag 480

gatgcagaag aagccaaaaa cattctggcc gctccaggaa ttctgaagtt ctgggccttt 540

ctcagaagac tgt 553

<210> 6

<211> 555

<212> DNA

<213> Mus musculus

<400> 6

atggggagtg ggatgagcca gatcctgccg ggcctgtaca ttggcaactt caaagacgca 60

agagatgcag aacagttgag caggaacaag gtgacacaca ttctttctgt gcacgatact 120

gccaggccca tgttggaggg agttaaatac ctgtgtattc cagcggcaga cacaccatct 180

caaaacctga caagacattt caaagaaagc attaaattca ttcatgagtg ccgactccag 240

ggtgagagct gtcttgtaca ttgcctggct ggggtctcca ggagtgtgac attggtgatc 300

gcatacatca tgactgtcac cgactttggc tgggaagatg ccttgcacac tgttcgtgcg 360

gggaggtcct gtgccaaccc caacctgggc tttcaaaggc agctgcagga gtttgagaaa 420

catgaagtgc accagtatcg gcaatggctg agagaagagt atggagagaa ccctttgcgg 480

gatgcagaag aagccaaaaa tattctggct gccccgggaa ttctgaagta ctgggccttt 540

ctcagaagac tgtaa 555

<210> 7

<211> 3159

<212> DNA

<213> Homo sapiens

<400> 7

atggcagctg cttaccttga ccccaacttg aatcacacac caaattcgag tactaagact 60

cacctgggta ctggtatgga acgttctcct ggtgcaatgg agcgagtatt aaaggtcttt 120

cattattttg aaagcaatag tgagccaacc acctgggcca gtattatcag gcatggagat 180

gctactgatg tcaggggcat cattcagaag atagtggaca gtcacaaagt aaagcatgtg 240

gcctgctatg gattccgcct cagtcacctg cggtcagagg aggttcactg gcttcacgtg 300

gatatgggcg tctccagtgt gagggagaag tatgagcttg ctcacccacc agaggagtgg 360

aaatatgaat tgagaattcg ttatttgcca aaaggatttc taaaccagtt tactgaagat 420

aagccaactt tgaatttctt ctatcaacag gtgaagagcg attatatgtt agagatagct 480

gatcaagtgg accaggaaat tgctttgaag ttgggttgtc tagaaatacg gcgatcatac 540

tgggagatgc ggggcaatgc actagaaaag aagtctaact atgaagtatt agaaaaagat 600

gttggtttaa agcgattttt tcctaagagt ttactggatt ctgtcaaggc caaaacacta 660

agaaaactga tccaacaaac atttagacaa tttgccaacc ttaatagaga agaaagtatt 720

ctgaaattct ttgagatcct gtctccagtc tacagatttg ataaggaatg cttcaagtgt 780

gctcttggtt caagctggat tatttcagtg gaactggcaa tcggcccaga agaaggaatc 840

agttacctaa cggacaaggg ctgcaatccc acacatcttg ctgacttcac tcaagtgcaa 900

accattcagt attcaaacag tgaagacaag gacagaaaag gaatgctaca actaaaaata 960

gcaggtgcac ccgagcctct gacagtgacg gcaccatccc taaccattgc ggagaatatg 1020

gctgacctaa tagatgggta ctgccggctg gtgaatggaa cctcgcagtc atttatcatc 1080

agacctcaga aagaaggtga acgggctttg ccatcaatac caaagttggc caacagcgaa 1140

aagcaaggca tgcggacaca cgccgtctct gtgtcagaaa cagatgatta tgctgagatt 1200

atagatgaag aagatactta caccatgccc tcaaccaggg attatgagat tcaaagagaa 1260

agaatagaac ttggacgatg tattggagaa ggccaatttg gagatgtaca tcaaggcatt 1320

tatatgagtc cagagaatcc agctttggcg gttgcaatta aaacatgtaa aaactgtact 1380

tcggacagcg tgagagagaa atttcttcaa gaagccttaa caatgcgtca gtttgaccat 1440

cctcatattg tgaagctgat tggagtcatc acagagaatc ctgtctggat aatcatggag 1500

ctgtgcacac ttggagagct gaggtcattt ttgcaagtaa ggaaatacag tttggatcta 1560

gcatctttga tcctgtatgc ctatcagctt agtacagctc ttgcatatct agagagcaaa 1620

agatttgtac acagggacat tgctgctcgg aatgttctgg tgtcctcaaa tgattgtgta 1680

aaattaggag actttggatt atcccgatat atggaagata gtacttacta caaagcttcc 1740

aaaggaaaat tgcctattaa atggatggct ccagagtcaa tcaattttcg acgttttacc 1800

tcagctagtg acgtatggat gtttggtgtg tgtatgtggg agatactgat gcatggtgtg 1860

aagccttttc aaggagtgaa gaacaatgat gtaatcggtc gaattgaaaa tggggaaaga 1920

ttaccaatgc ctccaaattg tcctcctacc ctctacagcc ttatgacgaa atgctgggcc 1980

tatgacccca gcaggcggcc caggtttact gaacttaaag ctcagctcag cacaatcctg 2040

gaggaagaga aggctcagca agaagagcgc atgaggatgg agtccagaag acaggccaca 2100

gtgtcctggg actccggagg gtctgatgaa gcaccgccca agcccagcag accgggttat 2160

cccagtccga ggtccagcga aggattttat cccagcccac agcacatggt acaaaccaat 2220

cattaccagg tttctggcta ccctggttca catggaatca cagccatggc tggcagcatc 2280

tatccaggtc aggcatctct tttggaccaa acagattcat ggaatcatag acctcaggag 2340

atagcaatgt ggcagcccaa tgtggaggac tctacagtat tggacctgcg agggattggg 2400

caagtgttgc caacccatct gatggaagag cgtctaatcc gacagcaaca ggaaatggaa 2460

gaagatcagc gctggctgga aaaagaggaa agatttctga aacctgatgt gagactctct 2520

cgaggcagta ttgacaggga ggatggaagt cttcagggtc cgattggaaa ccaacatata 2580

tatcagcctg tgggtaaacc agatcctgca gctccaccaa agaaaccgcc tcgccctgga 2640

gctcccggtc atctgggaag ccttgccagc ctcagcagcc ctgctgacag ctacaacgag 2700

ggtgtcaagc ttcagcccca ggaaatcagc ccccctccta ctgccaacct ggaccggtcg 2760

aatgataagg tgtacgagaa tgtgacgggc ctggtgaaag ctgtcatcga gatgtccagt 2820

aaaatccagc cagccccacc agaggagtat gtccctatgg tgaaggaagt cggcttggcc 2880

ctgaggacat tattggccac tgtggatgag accattcccc tcctaccagc cagcacccac 2940

cgagagattg agatggcaca gaagctattg aactctgacc tgggtgagct catcaacaag 3000

atgaaactgg cccagcagta tgtcatgacc agcctccagc aagagtacaa aaagcaaatg 3060

ctgactgctg ctcacgccct ggctgtggat gccaaaaact tactcgatgt cattgaccaa 3120

gcaagactga aaatgcttgg gcagacgaga ccacactga 3159

<210> 8

<211> 3159

<212> DNA

<213> Mus musculus

<400> 8

atggcagctg cttatcttga cccaaacttg aatcacacac caagttcgag tactaagact 60

cacctgggta ctggcatgga acggtcccct ggtgcaatgg aacgagtatt aaaggtcttt 120

cattattttg aaagcagtag tgagccaacc acctgggcca gtattatcag gcatggagat 180

gctactgatg tcaggggcat cattcagaag atagtggaca gtcacaaagt aaagcacgtg 240

gcctgctatg gatttcgcct cagtcacctg cgatcggagg aggtgcactg gctgcacgtg 300

gacatgggtg tctccagtgt gagggagaaa tatgaactcg cccacccacc agaggagtgg 360

aaatatgagt tgagaattcg ttacttgcca aaaggatttc taaaccagtt tactgaagat 420

aagccaacat tgaatttctt ctatcaacag gtgaagagtg actacatgca agaaatagct 480

gatcaagtag accaagaaat agctttgaag ttgggttgtt tggaaattag gcgatcctat 540

tgggagatga ggggtaatgc cctagagaag aagtccaact atgaagtatt agaaaaagat 600

gttggtttaa agcgattttt tcctaagagt ttactggatt ctgtcaaggc caaaacacta 660

agaaagctga tccagcaaac attcaggcag tttgccaacc ttaatagaga agaaagcatc 720

ctgaaattct ttgagattct ttctcctgtg tacagatttg acaaagagtg cttcaagtgt 780

gcccttgggt caagttggat catttctgtg gaattggcaa tcggcccaga agaagggatc 840

agttacctga cagacaaagg ctgcaatccc acacacctag cagactttaa ccaagtgcag 900

accatccagt actcaaacag tgaagacaaa gacaggaaag gaatgctaca actcaaaatc 960

gctggtgctc ctgagcctct gaccgtgacg gcaccatccc taaccattgc cgagaacatg 1020

gccgacctga ttgatggata ctgccggctg gtgaatggag ccacacaatc tttcatcatc 1080

agaccccaga aagaaggtga acgggcgttg ccatcaatac caaagttggc caacagtgaa 1140

aagcaaggca tgcggacaca tgcagtctct gtgtcagaga cagatgacta tgcagagatc 1200

atcgatgagg aagacacata caccatgccc tcgaccaggg attatgagat tcagagagaa 1260

agaatagaac ttggacgctg tattggagaa ggtcagtttg gagatgtaca tcaaggcgtg 1320

tacctgagcc cagagaatcc agctttggct gttgcaatca aaacatgtaa aaactgtact 1380

tcggacagcg tgagagagaa gttccttcaa gaagccttaa caatgcgtca gtttgaccat 1440

cctcacatcg tgaagctgat tggagtcatt acagagaacc ctgtctggat aatcatggag 1500

ttgtgcacac ttggagagct gaggtcattt ttgcaagtaa gaaaatacag cttggacctg 1560

gcatctttga tattatatgc ctatcagctt agtacagcac tcgcgtatct ggagagcaaa 1620

agatttgttc acagggacat tgctgctcgg aatgttctgg tgtcttcaaa tgattgtgta 1680

aaattgggag actttggatt atctcgatat atggaagaca gtacttacta taaagcttcc 1740

aaaggaaaat tacctattaa atggatggct ccagagtcaa tcaattttcg acgttttacc 1800

tcagctagtg acgtgtggat gtttggtgtg tgtatgtggg agatactgat gcatggcgtg 1860

aagccttttc aaggagtgaa gaacaatgat gtgatcggtc gaattgaaaa tggggaaaga 1920

ttaccaatgc ctccaaattg tcctcccacc ctctacagcc ttatgacgaa atgttgggcc 1980

tatgacccca gcaggcggcc caggtttact gaactaaaag ctcagctcag cacaatcctg 2040

gaggaggaga aggtgcagca agaagaacgg atgaggatgg aatccagaag acaggctacc 2100

gtgtcctggg actctggagg gtctgatgaa gcaccaccca agcccagcag acctggttat 2160

cctagcccga gatccagtga aggattttat cccagcccac agcacatggt ccagaccaat 2220

cactaccagg tctctggcta cccgggttcc catggaatcc cagccatggc tggcagcatt 2280

taccaaggtc aggcatctct tctggaccag acagaattgt ggaatcacag acctcaggag 2340

atgtccatgt ggcagcccag tgtggaggat tcggcagctt tggaccttcg agggatggga 2400

caggtgcttc cccctcacct gatggaagag cggctaatcc gacagcagca ggaaatggaa 2460

gaagaccagc gctggctgga gaaggaagag cgattcctga aacctgatgt gaggctctct 2520

cgaggcagca tcgacaggga agacgggagt tttcagggtc cgactggaaa ccaacacatc 2580

tatcagcctg tggggaagcc agatcctgca gctccaccaa agaaacctcc tcgccctgga 2640

gcacctggcc acctaagcaa cctgtccagc atcagcagcc ctgcagacag ctacaatgag 2700

ggtgtcaagc ttcagcccca ggaaatcagc ccccctccca ctgccaacct tgaccggtcc 2760

aatgacaagg tatatgaaaa tgtgacaggc ctagtgaagg ctgtcatcga gatgtccagc 2820

aaaatccagc cagctcctcc agaagagtac gtccctatgg tgaaggaagt tggcctggcc 2880

ctgcggacct tactagccac ggtggatgag accattcctg ctcttccagc cagcactcat 2940

cgagagatcg agatggcaca gaagctgctg aactccgact taggcgagct catcagcaag 3000

atgaagctgg cgcagcagta cgtcatgacc agcctgcagc aggagtataa gaagcagatg 3060

ctgacagctg ctcacgccct ggctgtggat gccaagaacc tacttgatgt tattgatcaa 3120

gcaagactga aaatgctagg gcagacacgg ccacactga 3159

Claims (6)

1. Use of DUSP22 in the preparation of a marker for non-alcoholic steatohepatitis (NASH), characterized in that the amino acid sequence of DUSP22 is as set forth in SEQ ID NO:1 or SEQ ID NO: 2.
2. Use of DUSP22 in combination with FAK for co-production of a marker for non-alcoholic steatohepatitis (NASH), characterized in that the amino acid sequence of DUSP22 is as set forth in SEQ ID NO:1 or SEQ ID NO: 2.
3. Use of an accelerator of dusp22 and/or an inhibitor of FAK in the preparation of a medicament for the treatment of non-alcoholic steatohepatitis (NASH).
4. 4. The use according to claim 3, wherein the promoter treats nonalcoholic steatohepatitis (NASH) by lowering serum pro-inflammatory factors.
5. 5. The use according to claim 4, wherein the serum pro-inflammatory factors comprise TNF- α, IL-1β, IL-6, MCP-1.
6. 6. The use according to claim 3, wherein the promoter comprises a gene interference system comprising DNA and its expression system packaged into adenovirus, the DNA having a nucleic acid sequence set forth in SEQ ID NO:5 or SEQ ID NO: shown at 6.