CN115011593A

CN115011593A - High-order nucleic acid structure and preparation method and application thereof

Info

Publication number: CN115011593A
Application number: CN202210661310.2A
Authority: CN
Inventors: 丁宝全; 刘建兵; 王宇昂; 李燕
Original assignee: National Center for Nanosccience and Technology China
Current assignee: National Center for Nanosccience and Technology China
Priority date: 2022-06-13
Filing date: 2022-06-13
Publication date: 2022-09-06
Anticipated expiration: 2042-06-13
Also published as: CN115011593B

Abstract

The invention provides a high-order nucleic acid structure and a preparation method and application thereof, wherein the high-order nucleic acid structure is formed by co-assembling a nucleic acid scaffold chain, a branched chain type staple chain and a linear staple chain except a linear staple chain in the branched chain type staple chain through base complementary pairing, and the branched chain type staple chain comprises a branched chain type organic molecule and a nucleic acid containing the linear staple chain and covalently coupled with the branched chain type organic molecule. According to the invention, a branched chain type staple chain is introduced into a nucleic acid structure assembly system, so that a high-efficiency preparation of a high-order nucleic acid structure is realized, the high-order nucleic acid structure can be further locked to form a compact locked high-order nucleic acid structure, the locked high-order nucleic acid structure can accurately position nanoparticles, and the method can be applied to the fields of molecular devices, biosensing, drug delivery and the like; the high-order nucleic acid structure is simple in preparation method and high in production efficiency, and popularization and use of related products are greatly promoted.

Description

High-order nucleic acid structure and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological materials, and particularly relates to a high-order nucleic acid structure, and a preparation method and application thereof.

Background

Nucleic acid serving as a biological macromolecule can be self-assembled to form nucleic acid nano-structures with different sizes and appearances through strict base complementary pairing. Nucleic acid origami structures have been widely studied and reported as a representative class of nucleic acid nanostructures. The nucleic acid origami structure is formed by precisely folding a long annular single-stranded nucleic acid serving as a scaffold chain with the aid of hundreds of short linear staple chains. The most common nucleic acid scaffold strand is the phage-derived circular DNA single strand M13mp18, which contains 7249 bases. The nucleic acid origami structure has excellent structure designability, site addressability and biocompatibility, and is widely applied to the fields of molecular devices, biosensing, drug delivery and the like. With the continuous development of biomacromolecule materials, people have more and more demands on large-size nucleic acid origami structures. However, the size of conventional nucleic acid origami structures is largely limited by the length of the native nucleic acid scaffold strands. Therefore, there is a need to develop a new method for efficiently preparing high-order nucleic acid origami structures having larger sizes in large quantities.

With the continuous development of nucleic acid self-assembly technology, a series of technologies for co-assembling large-size nucleic acid origami structures are reported, mainly including cohesive end splicing and structure shape complementation. The sticky end splicing strategy is mainly to obtain the nucleic acid origami structure with larger size by extending the linear staple chains in the nucleic acid origami structure, so that the nucleic acid origami structure can be spliced by the extended parts in a base complementary pairing mode. The structure shape complementation technology is to design nucleic acid origami structures with complementary shapes in advance, and to perform the co-assembly of the structures in a shape complementary mode, so as to finally obtain nucleic acid origami structures with larger sizes. However, both the sticky end-splicing strategy and the structure shape complementation technique require a multi-step structure assembly, separation and purification and final co-assembly process in series. The above strategies are complicated in preparation process and inefficient in assembly of the target structure, and cannot achieve the purpose of efficiently preparing high-order nucleic acid structures in large quantities.

Branched nucleic acid structures based on base complementary pairing have been reported as early as 80 s in the last century. The branched nucleic acid structure is used as a connecting pivot, so that the types of the constructed high-order nucleic acid structure can be greatly enriched. However, the branched nucleic acid structure constructed by the base complementary pairing method has relatively poor thermal stability, still needs to be co-assembled by the step-by-step assembly method, has low efficiency, and limits the wide popularization and application of high-order nucleic acid structures.

In summary, how to provide an efficient method for preparing a high-order nucleic acid structure to realize one-step co-assembly is one of the problems in the field of high-order nucleic acid preparation.

Disclosure of Invention

Aiming at the defects and practical requirements of the prior art, the invention provides a high-order nucleic acid structure and a preparation method and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a high-order nucleic acid structure formed by co-assembling a nucleic acid scaffold chain, a branched-chain type staple chain comprising a branched-chain type organic molecule and a nucleic acid containing a linear staple chain covalently coupled to the branched-chain type organic molecule, and a linear staple chain other than a linear staple chain in the branched-chain type staple chain by base complementary pairing.

According to the invention, the branched chain type staple chain has high thermal stability, the branched chain type staple chain is premixed with the nucleic acid scaffold chain and the linear staple chain, a high-order nucleic acid structure can be efficiently prepared through one-step co-assembly, the production efficiency is remarkably improved, and meanwhile, compared with a traditional multi-step assembly mode, the one-step assembly strategy can effectively avoid the time and cost increased by multi-step separation and purification.

In the present invention, the nucleic acid scaffold strand may be any single-stranded nucleic acid, and may be, for example, a circular single-stranded nucleic acid.

Preferably, the nucleic acid scaffold strand comprises a circular DNA single strand M13mp18 (containing 7249 bases, the specific sequence is shown in the reference: Nature,2006,440,297) or P7308 (containing 7308 bases, the specific sequence is shown in the reference: PNAS,2007,104,6644).

In the present invention, the linear staple chain may be any staple chain for assembling a nucleic acid origami structure.

Preferably, the linear staple chain comprises a staple chain for assembling triangular folded paper, square folded paper or nanotube folded paper, respectively.

In the specific embodiment of the invention, the linear staple chain comprises a linear staple chain assembled with triangular folded paper (the specific sequence is shown in the reference: ACS Nano,2014,8,6633), a linear staple chain assembled with square folded paper (the specific sequence is shown in the reference: Nature,2017,552,67) and a linear staple chain assembled with nanotube folded paper (the specific sequence is shown in the reference: PNAS,2007,104,6644).

Preferably, the branched organic molecule is an organic molecule having a branched structure.

In the present invention, the branched organic molecule may be any multi-arm organic molecule capable of undergoing a covalent coupling reaction.

Preferably, the branched organic molecule comprises azide-modified dipentaerythritol ((CH) ₂ N ₃ ) ₃ CCH ₂ OCH ₂ C(CH ₂ N ₃ ) ₃ ) Or azide-modified alpha-cyclodextrin (alpha-CD-6N) ₃ )。

In the present invention, the nucleic acid containing a linear staple chain may be a nucleic acid containing any one linear staple chain in any paper folding structure.

Preferably, the nucleic acid sequence of the nucleic acid containing the linear staple chain comprises a sequence shown in SEQ ID NO. 1-SEQ ID NO. 4.

SEQ ID NO. 1: (for constructing high-order triangular paper folding structure)

TTTTTTTTTTTGCTATTTTGCACCCAGCTACAATTTTG；

SEQ ID NO. 2: (for constructing high-order square paper folding structure)

TTTTTTTTTTTTTTTTTTTTGGAACCCATGTACCGTAACACTGAGTTT；

SEQ ID NO. 3: (for constructing apex crosslinked higher order nanotube origami structures)

TTTTTTTTTTTTTGAAATACCGACCGTGTGATAAATAA；

SEQ ID NO. 4: (for constructing intermediate crosslinked high-order nanotube origami structures)

TTTTTTTTTTTTTTTTTTTTGGATAAGTGCCGTCGAGAGGGTTGATAT。

In a second aspect, the present invention provides a method of preparing a higher order nucleic acid structure according to the first aspect, the method comprising:

mixing and co-assembling a nucleic acid scaffold chain, a branched chain type staple chain and a linear staple chain except for the linear staple chain in the branched chain type staple chain to obtain the high-order nucleic acid structure;

the branched staple chain includes a branched organic molecule and a nucleic acid containing a linear staple chain covalently coupled to the branched organic molecule.

According to the invention, the branched chain type staple chain with a specific composition has extremely high thermal stability, can still maintain a complete branched chain structure at a high temperature of 95 ℃, can be used for realizing one-step co-assembly preparation of a high-order nucleic acid structure with a nucleic acid scaffold chain and a linear staple chain through base complementary pairing, realizes one-step efficient mass construction of the high-order nucleic acid structure with a specific size and morphology, and is applied to the fields of molecular devices, biosensing, drug delivery and the like, thereby having important significance.

Preferably, the conditions of the co-assembly include: incubating at 90-95 deg.C (such as 90 deg.C, 91 deg.C, 92 deg.C, 93 deg.C, 94 deg.C or 95 deg.C) for 1-10 min (such as 1min, 2min, 3min, 4min, 5min, 6min, 7min, 8min, 9min or 10min), and cooling to 1-4 deg.C (such as 1 deg.C, 2 deg.C, 3 deg.C or 4 deg.C).

Preferably, the preparation method of the branched chain type staple chain comprises the following steps:

modifying a reaction functional group at the tail end of the nucleic acid containing the linear staple chain, and carrying out covalent coupling reaction on the nucleic acid containing the linear staple chain modified with the reaction functional group and a branched chain type organic molecule to obtain the branched chain type staple chain.

In the present invention, the type of modification of the terminal functional group of the nucleic acid containing a linear staple chain may be any chemical group capable of covalent reaction.

Preferably, the reactive functional group comprises dibenzocyclooctyne-succinimidyl ester (DBCO-NHS).

Preferably, the terminal of the nucleic acid containing a linear staple chain has NH ₂ C6(-(CH ₂ ) ₆ NH ₂ ) And (5) modifying.

Preferably, the molar charge ratio of the nucleic acid containing the linear staple chain to the reaction functional group is 1 (10-50), including but not limited to 1:11, 1:12, 1:13, 1:14, 1:20, 1:25, 1:30, 1:40, 1:41, 1:42, 1:43, 1:45, 1:46, 1:47, 1:48 or 1: 49.

Preferably, the molar charge ratio of the linear staple chain-containing nucleic acid modified with the reaction functional group to the branched organic molecule is (1-12): 1, including but not limited to 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1 or 11: 1.

It should be noted that the embodiment of the present invention is not necessarily limited to the preferred range, and the preferred range merely indicates that the present invention can achieve a preferable effect within the range, for example, the molar charge ratio of the nucleic acid containing the linear staple chain to the reactive functional group is controlled within the range of 1 (10 to 50), the reactive functional group can be further modified for each nucleic acid containing the linear staple chain, and insufficient modification of the terminal of the nucleic acid is caused when the charge amount of the reactive functional group is too small; the excessive feeding of the reaction functional groups can cause the waste of raw materials, simultaneously increases the difficulty of subsequent removal of the redundant reaction functional groups, controls the molar ratio of the branched chain type organic molecules to the DBCO modified nucleic acid containing the linear staple chain within the range of 1 (1-12), and can well obtain the branched chain type staple chains with different branched chain numbers.

Preferably, in the method for producing a branched staple chain, a branched organic molecule and a nucleic acid containing a linear staple chain modified with a reactive functional group are mixed, and the mixture is stirred in a buffer solution containing sodium chloride (at a final concentration of 0.8 to 1.5M (mol/L), for example, 0.8M, 0.9M, 1M, 1.1M, 1.2M, 1.3M, 1.4M, or 1.5M) at 25 to 45 ℃ (for example, 25 ℃, 30 ℃, 35 ℃, 40 ℃, or 45 ℃) for 2 to 4 days (for example, 2 days, 3 days, or 4 days), and then the reaction product is separated and purified by polyacrylamide gel electrophoresis to obtain a branched staple chain having a predetermined number of branches.

Preferably, the molar ratio of the linear staple chain contained in the nucleic acid scaffold chain, the branched chain type staple chain and the linear staple chain other than the linear staple chain contained in the branched chain type staple chain is 1:1 (5-20), including but not limited to 1:1:5, 1:1:10, 1:1:15 or 1:1: 20.

In the present invention, the yield of the nucleic acid-ordered structure can be further improved by controlling the molar ratio of the linear staple chain contained in the nucleic acid scaffold chain and the branched chain to the linear staple chain other than the linear staple chain contained in the branched chain to be within the range of 1:1 (5-20).

As a preferred technical scheme, the preparation method of the higher order nucleic acid structure comprises the following steps:

(1) modifying a reaction functional group at the tail end of the nucleic acid containing the linear staple chain, and carrying out covalent coupling reaction on the nucleic acid containing the linear staple chain modified with the reaction functional group and a branched chain type organic molecule to obtain the branched chain type staple chain;

(2) and mixing and assembling the nucleic acid scaffold chain, the branched chain type staple chain and the linear staple chain except the linear staple chain in the branched chain type staple chain to obtain the high-order nucleic acid structure.

In the invention, an Atomic Force Microscope (AFM) can be used for carrying out morphology characterization on a high-order nucleic acid structure, and the AFM sample scanning mode can be a solid phase or liquid phase mode, and is preferably a solid phase scanning mode.

In a third aspect, the present invention provides the use of a higher order nucleic acid structure according to the first aspect for localizing a nanoparticle.

In a fourth aspect, the present invention provides a method of localizing nanoparticles, the method comprising:

(1') adding a capture strand to the higher order nucleic acid structure of the first aspect to obtain a higher order nucleic acid structure comprising a capture strand;

(2 ') mixing the bivalent staple chain with the capture chain-containing higher-order nucleic acid structure obtained in step (1') to obtain a locked higher-order nucleic acid structure;

(3') co-assembling the locked high-order nucleic acid structure and the nanoparticle modified with the hybrid chain to obtain the locked high-order nucleic acid structure of the nanoparticle positioned on the nanoparticle.

Preferably, base complementary pairing is performed between the capture strand and the hybrid strand.

Preferably, the nucleic acid sequence of the capture strand comprises the sequence shown in SEQ ID NO. 5-SEQ ID NO. 22.

Preferably, the nucleic acid sequence of the bivalent staple chain comprises a sequence shown in SEQ ID NO. 23-SEQ ID NO. 30.

Preferably, the nucleic acid sequence of the hybrid strand comprises the sequence shown in SEQ ID NO. 31.

The capture chain on the triangular paper folding structure comprises sequences shown in SEQ ID NO. 5-SEQ ID NO. 10.

SEQ ID NO.5：

AAAAAAAAAAAAAAACCCACGGGGTTTCCTCAAGAGAAGGATTTTGAATTA。

SEQ ID NO.6：

AAAAAAAAAAAAAAACCCACCTTTTTTCATTTAACAATTTCATAGGATTAG。

SEQ ID NO.7：

AAAAAAAAAAAAAAACCCATCATATGTGTAATCGTAAAACTAGTCATTTTC。

SEQ ID NO.8：

AAAAAAAAAAAAAAACCCAAGGGATAGCTCAGAGCCACCACCCCATGTCAA。

SEQ ID NO.9：

AAAAAAAAAAAAAAACCCATCGGGAGATATACAGTAACAGTACAAATAATT。

SEQ ID NO.10：

AAAAAAAAAAAAAAACCCACGCGTCTGATAGGAACGCCATCAACTTTTACA。

The capture chain on the square origami structure comprises sequences shown in SEQ ID NO. 11-SEQ ID NO. 22.

SEQ ID NO.11：

AAAAAAAAAAAAAAACCCACATAGGCTGGCTGACCTTTGAAAG。

SEQ ID NO.12：

AAAAAAAAAAAAAAACCCAAGGACAGATGATTTTTTCA。

SEQ ID NO.13：

AAAAAAAAAAAAAAACCCATAATAAAACGAACTAAATTATACCAGTCAGGA。

SEQ ID NO.14：

AAAAAAAAAAAAAAACCCACAAACGTAGAAAATACCTGGCATG。

SEQ ID NO.15：

AAAAAAAAAAAAAAACCCACCAGTAGCACCATTACCGACTTGAGCCATTTG。

SEQ ID NO.16：

AAAAAAAAAAAAAAACCCAATTAAGACTCCTTTTTAAT。

SEQ ID NO.17：

AAAAAAAAAAAAAAACCCAGTTATTAATTTTAAAAAACAATTC。

SEQ ID NO.18：

AAAAAAAAAAAAAAACCCAATACAGTAACAGTACCGAAATTGCGTAGATTT。

SEQ ID NO.19：

AAAAAAAAAAAAAAACCCAGACAACTCGTATTTTTTCC。

SEQ ID NO.20：

AAAAAAAAAAAAAAACCCAGCCATTCGCCATTCAGTTCCGGCA。

SEQ ID NO.21：

AAAAAAAAAAAAAAACCCATGTGTGAAATTGTTATCCGAGCTCGAATTCGT。

SEQ ID NO.22：

AAAAAAAAAAAAAAACCCACCGCTTCTGGTTTTTTCGT。

The divalent staple chain for locking the triangle comprises the sequences shown as SEQ ID NO. 23-SEQ ID NO. 26.

SEQ ID NO.23：

TTTTTTTTTTCCAATCCAAATAAGAAACGATTTTTTGT。

SEQ ID NO.24：

TTTTTTTTTTTAACCCACAAGAATTGAGTTAAGCCCAA。

SEQ ID NO.25：

TTTTTTTTTTAAATCGGAACCCTAAAGGGAGCCCCCGA。

SEQ ID NO.26：

TTTTTTTTTTAAAGGGATTTTAGACAGGAACGGTACGC。

The divalent staple chain for locking squares comprises the sequences shown in SEQ ID NO. 27-SEQ ID NO. 30.

SEQ ID NO.27：

TTTTTTTTTTTTTTTTTTTTATTGCTCCTTTTGATA。

SEQ ID NO.28：

TTTTTTTTTTTTTTTTTTTTGGTTTATCAGCTTGCT。

SEQ ID NO.29：

TTTTTTTTTTTTTTTTTTTTGTATAAACAGTTAATG。

SEQ ID NO.30：

TTTTTTTTTTTTTTTTTTTTAACCTCCCGACTTGCG。

SEQ ID NO.31：

TTTTTTTTTTTTTTTAGCG。

Preferably, in step (1'), the linear staple chains in the high-order nucleic acid structure are replaced with corresponding linear staple chains containing capture chains.

Preferably, in the step (2'), mixing is carried out according to the molar ratio of the line-type staple chain in the divalent staple chain to the folded paper structure in the high-order nucleic acid structure being 1:1, the mixture is placed in a PCR instrument for 2-4 times of cyclic annealing at 45-25 ℃, and then the temperature is reduced to 2-5 ℃ to obtain the locked high-order nucleic acid structure.

Preferably, in the step (3'), the hybrid chain with the sulfhydryl at the end is modified on the gold nanoparticles with the diameter of 10-20 nm in a manner of forming a gold-sulfur bond.

Preferably, in the step (3'), mixing is carried out according to the molar ratio of the folded paper structure in the locked high-order nucleic acid structure to the gold nanoparticles modified with the hybrid chains being 1 (3-7), and after the mixture is placed in a PCR (polymerase chain reaction) instrument for carrying out 2-4 times of cyclic annealing at 45-25 ℃, the temperature is slowly reduced to 2-5 ℃, so as to obtain the locked high-order nucleic acid structure of the gold nanoparticles with accurate positioning.

Compared with the prior art, the invention has the following beneficial effects:

(1) the branched chain type staple chain, the nucleic acid scaffold chain and the linear staple chain which are covalently coupled in the high-order nucleic acid structure can be assembled together to form the high-order nucleic acid structure in one step, so that the preparation method is strong in universality and simple, and large-scale production can be realized;

(2) the high-order nucleic acid structure can be further locked to obtain a compact locking type high-order nucleic acid structure, so that the regularity of the high-order nucleic acid structure is improved;

(3) the locked high-order nucleic acid structure can accurately position the nano particles, thereby providing a new method for the research in the fields of molecular devices, biosensing, drug delivery and the like.

Drawings

FIG. 1 is a schematic illustration of the preparation of higher order nucleic acid structures for precise nanoparticle localization;

FIG. 2 is a diagram showing the results of gel electrophoresis detection of the branched chain type staple chain for assembling the high-order triangular paper folding structure prepared in example 1, wherein the chain comprises a double-stranded DNA marker of a known length, a monovalent triangular staple chain, a divalent triangular staple chain, a trivalent triangular staple chain, a tetravalent triangular staple chain, a pentavalent triangular staple chain, and a hexavalent triangular staple chain, respectively, in lane 1 and lane 2, and lane 3, and lane 4, and lane 5, and lane 6, and lane 7, respectively;

FIG. 3 is a diagram showing the results of gel electrophoresis detection of the high-order triangular folded paper co-assembly system prepared in example 1, wherein the ring DNA scaffold chain in lane 1-M13mp18, the monovalent triangular folded paper co-assembly system in lane 2, the divalent triangular folded paper co-assembly system in lane 3, the trivalent triangular folded paper co-assembly system in lane 4, the tetravalent triangular folded paper co-assembly system in lane 5, the pentavalent triangular folded paper co-assembly system in lane 6, and the hexavalent triangular folded paper co-assembly system in lane 7;

fig. 4 is an atomic force microscope characterization chart (scale bar 100nm) of the high-order triangular origami structure prepared in example 1;

FIG. 5 is a diagram showing the results of gel electrophoresis of the branched chain type staple chain assembled with the high-order square origami structure prepared in example 2, wherein, Lane 1 is a double-stranded DNA marker with a known length, Lane 2 is a monovalent square staple chain, Lane 3 is a divalent square staple chain, Lane 4 is a trivalent square staple chain, and Lane 5 is a tetravalent square staple chain;

FIG. 6 is a diagram showing the results of gel electrophoresis detection of the high-order square origami structure co-assembly system prepared in example 2, wherein the loop DNA scaffold chain in lane 1-M13mp18, the unit price square origami co-assembly system in lane 2, the two price square origami co-assembly system in lane 3, the three price square origami co-assembly system in lane 4, and the four valence square origami co-assembly system in lane 5;

fig. 7 is an atomic force microscope characterization plot (scale bar 100nm) of the high order square origami structure prepared in example 2;

FIG. 8 is a graph of the results of gel electrophoresis of branched chain type staple chains for assembling high-order nanotube origami structures with vertex cross-links prepared in example 3, wherein lane 1 is a double-stranded DNA marker of known length, lane 2 is a nanotube staple chain cross-linked by monovalent vertex, lane 3 is a nanotube staple chain cross-linked by divalent vertex, lane 4 is a nanotube staple chain cross-linked by trivalent vertex, lane 5 is a nanotube staple chain cross-linked by tetravalent vertex, lane 6 is a nanotube staple chain cross-linked by pentavalent vertex, and lane 7 is a nanotube staple chain cross-linked by hexavalent vertex;

fig. 9 is an atomic force microscope characterization plot (scale bar 200nm) of the apex-crosslinked higher order nanotube origami structure prepared in example 3;

FIG. 10 is a graph of the results of gel electrophoresis of branched chain type staple chains for assembling a high-order nanotube origami structure prepared in example 4, wherein the chain is a double-stranded DNA marker of known length, a single-valent intermediate crosslinked nanotube staple chain, a divalent intermediate crosslinked nanotube staple chain, a trivalent intermediate crosslinked nanotube staple chain, a tetravalent intermediate crosslinked nanotube staple chain, a pentavalent intermediate crosslinked nanotube staple chain, a hexavalent intermediate crosslinked nanotube staple chain, a trivalent intermediate crosslinked nanotube chain, a tetravalent intermediate crosslinked nanotube chain, a trivalent intermediate crosslinked nanotube chain, a divalent nanotube chain, a trivalent intermediate crosslinked nanotube chain, a trivalent intermediate crosslinked nanotube chain, a trivalent, a conjugated to a conjugated structure, a conjugated to a conjugated structure, a conjugated to a conjugated structure, a conjugated to a conjugated structure, and a conjugated to a conjugated structure, and a conjugated to a conjugated structure, prepared in a conjugated structure, a conjugated to a conjugated structure, and a conjugated to a conjugated structure, prepared in a conjugated structure, to a conjugated structure, to a conjugated structure, to a conjugated structure, to a conjugated;

fig. 11 is an atomic force microscope characterization of the intermediate cross-linked higher order nanotube origami structure prepared in example 4 (scale bar 200 nm);

fig. 12 is an atomic force microscope characterization chart (scale bar 100nm) of the locked high-order triangular origami structure prepared in example 8;

fig. 13 is an atomic force microscope characterization chart (scale bar 100nm) of the locked high-order triangular origami structure of the localized gold nanoparticles prepared in example 8;

fig. 14 is an atomic force microscope characterization chart (scale bar 100nm) of the locked high-order square origami structure prepared in example 9;

fig. 15 is an atomic force microscope characterization chart (scale bar 100nm) of the locked high-order square origami structure of the aligned gold nanoparticles prepared in example 9.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

In the embodiment of the invention, circular DNA single-chain M13mp18 (containing 7249 bases, the specific sequence is shown in the reference of Nature 2006,440,297) and P7308 (containing 7308 bases, the specific sequence is shown in the reference of PNAS 2007,104,6644) are respectively used as nucleic acid scaffold chains, linear staple chains for assembling triangular folded paper (the specific sequence is shown in the reference of ACS Nano,2014,8,6633), linear staple chains for assembling square folded paper (the specific sequence is shown in the reference of Nature 2017,552,67) and linear staple for assembling nanotube folded paperA staple chain (the specific sequence is shown in the reference: PNAS,2007,104,6644), a branched organic molecule azide modified dipentaerythritol ((CH) ₂ N ₃ ) ₃ CCH ₂ OCH ₂ C(CH ₂ N ₃ ) ₃ ) Or azide-modified alpha-cyclodextrin (alpha-CD-6N) ₃ ) By way of example, several higher order nucleic acid structures were prepared, which are sufficient to demonstrate that the use of specific branched staple chains (including branched organic molecules and linear staple chain-containing nucleic acids covalently coupled to the branched organic molecules) in the present invention enables efficient preparation of higher order nucleic acid structures by one-step co-assembly with a nucleic acid scaffold chain and a linear staple chain.

The instruments and materials used in the examples are as follows:

equipment: gradient PCR instrument (Eppendorf, germany), microcentrifuge (ThermoFisher, usa), uv-vis spectrophotometer (shimadzu, japan), microuv-vis spectrophotometer (ThermoFisher, usa), electrophoresis apparatus (junyi, beijing), multimode scanning probe microscope (Bruker, germany);

raw materials: DNA sequences were purchased from Shanghai Biotechnology engineering, Inc.; dibenzocyclooctyne-succinimidyl ester (DBCO-NHS) was purchased from Sigma Aldrich trade, Inc.

Reagent: 1 XTAE/Mg ²⁺ The composition of the buffer solution (pH 8.3) was: 4X 10 ^-2 mol·L ^-1 Tris、2×10 ^- ² mol·L ^-1 Acetic acid, 2.0X 10 ^-3 mol·L ^-1 EDTA and 1.25X 10 ^-2 mol·L ^-1 Magnesium acetate, analytical grade, was obtained from Sigma-Aldrich.

Example 1

In this embodiment, a high-order triangular paper folding structure is prepared, and a specific process is shown in fig. 1, and the steps are as follows:

(1) preparation of DBCO-modified nucleic acids containing linear staple chains

150 μ L of 5' terminal NH ₂ C6 modified nucleic acid containing linear staple chains SEQ ID NO.1 (concentration 100. mu.M) and 22.5. mu.L DBCO-NHS (concentration DMF) dissolved in N, N-Dimethylformamide (DMF)20mM) mixed (NH) ₂ The molar ratio of the C6 modified nucleic acid containing the linear staple chain to DBCO-NHS is 1:30), 50 mu L of acetonitrile, 20 mu L of DMF and 1.0 mu L of triethylamine are added into the mixture, after stirring for 12 hours, sodium acetate with the final concentration of 0.3M and 75 percent of ethanol are added into a reaction system, and after shaking and uniform mixing, the mixture is placed at minus 80 ℃ for overnight;

centrifuging at 13000rpm for 30min at 4 ℃ to precipitate DNA, removing supernatant, dissolving the obtained precipitate in water, centrifuging at 13000rpm for 10min by using a purification column (3kDa molecular weight cut-off), separating and concentrating, removing redundant DBCO-NHS, repeating for 2 times, and collecting liquid retained in the purification column to a new centrifugal tube, namely the DBCO modified nucleic acid containing the linear staple chain;

SEQ ID NO. 1: (for constructing high-order triangular paper folding structure)

TTTTTTTTTTTGCTATTTTGCACCCAGCTACAATTTTG；

(2) Preparation of branched staple chains

A branched organic molecule (CH) ₂ N ₃ ) ₃ CCH ₂ OCH ₂ C(CH ₂ N ₃ ) ₃ Mixing the DBCO modified nucleic acid containing the linear staple chain obtained in the step (1) in a buffer solution containing sodium chloride (the final concentration is 1M) according to a molar ratio of 1:6, stirring at 37 ℃ for 3 days, and then separating and purifying a reaction product through polyacrylamide gel electrophoresis to obtain a branched chain type staple chain for constructing high-order triangular folded paper, wherein the branched chain type staple chain comprises a monovalent triangular staple chain (B) ₁ ) Bivalent triangular staple chain (B) ₂ ) Trivalent triangular staple chain (B) ₃ ) Quadrivalent triangular staple chain (B) ₄ ) Five-valent triangular staple chain (B) ₅ ) Hexavalent triangular staple chain (B) ₆ )；

Gel electrophoresis detection is performed on the branched chain type staple chain for assembling the high-order triangular paper folding structure, and the result is shown in fig. 2, where fig. 2 is the result of the prepared branched chain type staple chain for assembling the high-order triangular paper folding structure in 8% non-denaturing polyacrylamide gel electrophoresis detection, where a lane 1 is a double-stranded DNA marker with a known length, and the electrophoresis rates are sequentially from fast to slow: 20. 40, 60, 80, 100, 120, 140, 160, 180, 200, and 300 base pairs; lane 2 is a monovalent triangular staple chain; lane 3 is a divalent triangular staple chain; lane 4 is a trivalent triangular staple chain; lane 5 is a tetravalent triangular staple chain; lane 6 is a pentavalent triangular staple chain; lane 7 is a hexavalent triangular staple chain. From the results, the electrophoresis rate of the branched chain type staple chain is reduced along with the increase of the number of the branched chains, which indicates that the branched chain type staple chain is successfully prepared, and the amount of the linear nucleic acid contained in the branched chain type staple chain is accurately controllable;

(3) preparation of higher order nucleic acid structures

The nucleic acid scaffold chain (M13mp 18: 7249 bases) and the monovalent triangular staple chain B obtained in the step (2) ₁ The linear staple chain contained in the paper folding device and the linear staple chain for assembling the triangular paper folding structure except the branched chain type staple chain are mixed at 1 XTAE/Mg according to the molar ratio of 1:1:5 ²⁺ Incubating the buffer solution for 1min at 90 ℃, slowly cooling to 0-4 ℃ to obtain a monovalent triangular folded paper co-assembly system (B) ₁ -triangle).

Will be assembled into B in the system ₁ By substitution with B ₂ Keeping other conditions unchanged to obtain a divalent triangular folded paper co-assembly system (B) ₂ -triangle).

Will be assembled into B in the system ₁ By substitution with B ₃ And other conditions are kept unchanged to obtain a trivalent triangular folded paper co-assembly system (B) ₃ -triangle).

Will be assembled into B in the system ₁ By substitution with B ₄ Keeping other conditions unchanged to obtain a quadrivalent triangular folded paper co-assembly system (B) ₄ -triangle).

Will be assembled into B in the system ₁ By substitution with B ₅ Keeping other conditions unchanged to obtain a pentavalent triangular folded paper co-assembly system (B) ₅ -triangle).

Will be assembled into B in the system ₁ By substitution with B ₆ Other conditions are kept unchanged to obtain a hexavalent triangular folded paper co-assembly system (B) ₆ -triangle).

The results of gel electrophoresis detection on the 6 high-order triangular folded paper co-assembly systems prepared in this embodiment are shown in fig. 3, where fig. 3 is the result of the prepared high-order triangular folded paper co-assembly system in 0.4% agarose gel electrophoresis detection, where lane 1 is M13mp18 circular DNA scaffold chain, lane 2 is monovalent triangular folded paper co-assembly system, lane 3 is divalent triangular folded paper co-assembly system, lane 4 is trivalent triangular folded paper co-assembly system, lane 5 is tetravalent triangular folded paper co-assembly system, lane 6 is pentavalent triangular folded paper co-assembly system, lane 7 is hexavalent triangular folded paper co-assembly system, and the results show that the electrophoresis rate of the high-order triangular folded paper structure slows down with the increase of the number of triangular folded paper structures, indicating the successful preparation of the high-order triangular folded paper structure, and the number of the included triangular folded paper structures is precise and controllable, through statistical analysis, the yield of the high-order triangular paper folding structure is over 80 percent.

The morphology of the high-order triangular paper folding structure is characterized by an Atomic Force Microscope (AFM) in a solid phase scanning mode, and the result is shown in fig. 4, fig. 4 is an atomic force microscope image of the prepared high-order triangular paper folding structure, and a ruler is 100 nanometers.

Example 2

This example prepared a high-order square origami structure, differing from example 1 only in that the nucleic acid containing the linear staple chain used in step (1) was SEQ ID No.2, and the linear staple chain used for assembly of the square origami structure was used in step (3), while the nucleic acid scaffold chain (M13mp18), the linear staple chain contained in the branched chain staple chain, and the linear staple chain used for assembly of the square origami structure other than the branched chain staple chain were mixed at a molar ratio of 1:1:10, incubated at 95 ℃ for 10min, and the remaining conditions were the same as example 1.

SEQ ID No. 2: (for constructing high-order square paper folding structure)

TTTTTTTTTTTTTTTTTTTTGGAACCCATGTACCGTAACACTGAGTTT。

Gel electrophoresis detection is performed on the branched chain type staple chain for assembling the high-order square origami structure, and the result is shown in fig. 5, where fig. 5 is the result of the prepared branched chain type staple chain for assembling the high-order square origami structure in 8% native polyacrylamide gel electrophoresis detection, where a lane 1 is a double-stranded DNA marker with a known length, and the electrophoresis rates are, in order from fast to slow: 20. 40, 60, 80, 100, 120, 140, 160, 180, 200, and 300 base pairs; lane 2 is a monovalent square staple chain; lane 3 is a bivalent square staple chain; lane 4 is a trivalent square staple chain; lane 5 is a tetravalent square staple chain. From the results, the electrophoresis rate of the branched staple chain is slowed down with the increase of the number of the branched chains, which indicates that the branched staple chain is successfully prepared, and the amount of the linear nucleic acid contained is accurately controllable.

The gel electrophoresis detection is performed on the high-order square origami system, and the result is shown in fig. 6, fig. 6 is the result of the prepared high-order square origami system in the 0.4% agarose gel electrophoresis detection, where lane 1 is M13mp18 circular DNA scaffold chain, lane 2 is a monovalent square origami system, lane 3 is a divalent square origami system, lane 4 is a trivalent square origami system, and lane 5 is a tetravalent square origami system. The result shows that the electrophoresis rate of the high-order square origami structure is slowed down along with the increase of the number of the square origami structures, which indicates that the high-order square origami structure is successfully prepared, and the number of the square origami structures is accurately controllable. Statistical analysis shows that the yield of the high-order square origami structure is over 80%.

The shapes of the high-order square origami structures are respectively characterized by an Atomic Force Microscope (AFM) in a liquid phase scanning mode, the result is shown in FIG. 7, FIG. 7 is an atomic force microscope picture of the prepared high-order square origami structures, and a ruler is 100 nanometers. From the results, the embodiment successfully prepares the pre-designed high-order square origami structure, and the structural regularity is good.

Example 3

This example prepares a higher-order nucleic acid structure, differing from example 1 only in that the nucleic acid containing a linear staple chain used in step (1) is SEQ ID No.3, and a linear staple chain for assembly of a nanotube origami structure is used in step (3), while a nucleic acid scaffold chain (M13mp18), a linear staple chain contained in a branched chain staple chain, and a linear staple chain for assembly of a nanotube origami structure other than a branched chain staple chain are mixed at a molar ratio of 1:1:20, incubated at 92 ℃ for 8min, and the remaining conditions are the same as example 1.

TTTTTTTTTTTTTGAAATACCGACCGTGTGATAAATAA。

Gel electrophoresis detection is performed on the branched chain type staple chain for assembling the vertex-crosslinked high-order nanotube origami structure, and the result is shown in fig. 8, where fig. 8 is a result of the prepared branched chain type staple chain for the vertex-crosslinked high-order nanotube origami structure in 8% native polyacrylamide gel electrophoresis detection, where a lane 1 is a double-stranded DNA marker with a known length, and the electrophoresis rates are, in order from fast to slow: 20. 40, 60, 80, 100, 120, 140, 160, 180, 200 and 300 base pairs; lane 2 is monovalent apex crosslinked nanotube staple chains; lane 3 is divalent vertex-crosslinked nanotube staple chains; lane 4 is trivalent apex crosslinked nanotube staple chains; lane 5 is tetravalent apex crosslinked nanotube staple chains; lane 6 is pentavalent, apex-crosslinked nanotube staple chains; lane 7 is hexavalent apex crosslinked nanotube staple chains. From the results, the electrophoresis rate of the branched staple chain is slowed down with the increase of the number of the branched chains, which indicates that the branched staple chain is successfully prepared, and the amount of the linear nucleic acid contained is accurately controllable.

The shape of the high-order nanotube origami structure with the crosslinked vertex is respectively characterized by an Atomic Force Microscope (AFM) in a solid phase scanning mode, and the result is shown in fig. 9, fig. 9 is an atomic force microscope image of the prepared high-order nanotube origami structure with the crosslinked vertex, and the ruler is 200 nanometers. From the results, the embodiment successfully prepares the pre-designed high-order nanotube origami structure with vertex cross-linking, and the structural regularity is good.

Example 4

This example prepares a higher-order nucleic acid structure, differing from example 1 only in that the nucleic acid containing a linear staple chain used in step (1) is SEQ ID No.4, and a linear staple chain for nanotube origami structure assembly is used in step (3), while the nucleic acid scaffold chain (M13mp18), the linear staple chain contained in the branched chain staple chain and the linear staple chain for nanotube origami structure assembly other than the branched chain staple chain are mixed at a molar ratio of 1:1:15, incubated at 93 ℃ for 7min, and the remaining conditions are the same as example 1.

TTTTTTTTTTTTTTTTTTTTGGATAAGTGCCGTCGAGAGGGTTGATAT。

Gel electrophoresis detection is performed on the branched chain type staple chain for assembling the intermediate cross-linked high-order nanotube origami structure, and the result is shown in fig. 10, where fig. 10 is a result of the prepared branched chain type staple chain for the intermediate cross-linked high-order nanotube origami structure in 8% non-denaturing polyacrylamide gel electrophoresis detection, where a lane 1 is a double-stranded DNA marker with a known length, and the electrophoresis rates are, in order from fast to slow: 40. 60, 80, 100, 120, 140, 160, 180, 200, 300, 400, and 500 base pairs; lane 2 is monovalent intermediate crosslinked nanotube staple chains; lane 3 is a divalent intermediate crosslinked nanotube staple chain; lane 4 is trivalent intermediate cross-linked nanotube staple chains; lane 5 is tetravalent intermediate crosslinked nanotube staple chain; lane 6 is pentavalent intermediate cross-linked nanotube staple chains; lane 7 is a hexavalent intermediate crosslinked nanotube staple chain. From the results, the electrophoresis rate of the branched staple chain is slowed down with the increase of the number of the branched chains, which indicates that the branched staple chain is successfully prepared, and the amount of the linear nucleic acid contained is accurately controllable.

The shapes of the high-order nanotube origami structures with intermediate cross-linking are respectively characterized by an Atomic Force Microscope (AFM) in a solid phase scanning mode, and the results are shown in fig. 11, where fig. 11 is an atomic force microscope image of the high-order nanotube origami structures with intermediate cross-linking prepared, and the scale is 200 nm. From the results, the embodiment successfully prepares the pre-designed high-order nanotube origami structure with intermediate crosslinking, and the structural regularity is good.

Example 5

This example differs from example 1 only in that the branched organic molecule employed in step (2) is azide-modified α -cyclodextrin (α -CD-6N) ₃ ) The other conditions were the same as in example 1.

This example only expands the variety of branched organic molecules, which can still be efficiently used to prepare branched staple chains for assembling higher order nucleic acid structures.

Example 6

This example is different from example 1 only in that the nucleic acid scaffold strand used in step (3) is P7308, and the other conditions are the same as example 1.

This embodiment only expands the variety of nucleic acid scaffold strands, which can still be efficiently used to assemble higher order nucleic acid structures.

Example 7

The present example is different from example 1 only in that in step (3), the nucleic acid scaffold chain (M13mp18), the linear staple chain contained in the branched chain type staple chain obtained in step (2), and the linear staple chain for triangular folding structure assembly other than the branched chain type staple chain were assembled by mixing them at a molar ratio of 1:1:1, and the remaining conditions were the same as example 1.

Since the proportion of the linear staple chain in this embodiment is too low, the yield of the resulting high-order triangular folded paper structure is reduced.

Example 8

This example explores the ability of a high-order triangular structure to precisely locate nanoparticles, and includes the following steps:

(1) preparation of higher order nucleic acid structures containing Capture Strand

The only difference from example 1 is that the corresponding linear staple chains used for assembling the triangular paper folding structure employed in example 1 were replaced with linear staple chains SEQ ID No.5 to SEQ ID No.10 containing a capturing chain, and the remaining conditions were the same as in example 1;

(2) preparation of dense locked higher order nucleic acid structures

Firstly, constructing a divalent triangular staple chain SEQ ID NO. 23-SEQ ID NO.26 for locking a triangular paper folding structure, then mixing a linear staple chain contained in the divalent triangular staple chain for locking the triangular paper folding structure with the triangular paper folding structure contained in the high-order triangular paper folding structure containing the capturing chain obtained in the step (1) in a ratio of 1:1, placing the mixture in a PCR (polymerase chain reaction) instrument for 3 times of circular annealing at 45-25 ℃, and then slowly cooling to 4 ℃ to obtain a locking type high-order triangular paper folding structure;

the shape of the locking type high-order triangular paper folding structure is characterized by an Atomic Force Microscope (AFM) in a solid phase scanning mode, and the result is shown in fig. 12, fig. 12 is an atomic force microscope image of the locking type high-order triangular paper folding structure obtained by preparation, and a ruler is 100 nanometers. According to the results, the locking type high-order triangular paper folding structure which is designed in advance is successfully prepared and obtained in the embodiment, and the structural regularity is good;

(3) locked high-order nucleic acid structure for preparing gold nanoparticles with precise positioning

Firstly, modifying a hybrid chain SEQ ID NO.31 with a thiol group at the upper end by a gold nanoparticle with the diameter of 13nm in a manner of forming a gold-sulfur bond, then mixing a triangular paper folding structure contained in the locked high-order triangular paper folding structure obtained in the step (2) with the gold nanoparticle with the modified hybrid chain in a ratio of 1:5, placing the mixture in a PCR (polymerase chain reaction) instrument for 3 times of circular annealing at 45-25 ℃, and then slowly cooling to 4 ℃ to obtain the locked high-order triangular nucleic acid structure of the positioned gold nanoparticle.

The morphology of the locked high-order triangular origami structure with positioned gold nanoparticles was characterized by an Atomic Force Microscope (AFM) in a solid phase scanning mode, and the results are shown in fig. 13.

Fig. 13 is an atomic force microscope image of the prepared locking high-order triangular origami structure with positioned gold nanoparticles, with a scale of 100 nm. From the results, the locking type high-order triangular paper folding structure with the gold nanoparticles accurately positioned and designed in advance is successfully prepared and obtained in the embodiment, and the structural regularity is good.

Example 9

This example prepares a locking type high-order square origami structure in which gold nanoparticles are precisely positioned, and differs from example 5 only in that a branched chain type staple chain, a linear type staple chain and a linear type staple chain including a capturing chain of a square origami structure SEQ ID No.11 to SEQ ID No.22 are used in step (1) of example 5, and a divalent square type staple chain of a locking square origami structure SEQ ID No.27 to SEQ ID No.30 are used in step (2), and the rest of the conditions are the same as example 5.

The shapes of the locked high-order square origami structures were characterized by an Atomic Force Microscope (AFM) in a liquid phase scanning mode, and the results are shown in fig. 14.

Fig. 14 is an atomic force microscope image of the prepared locking high-order square origami structure with a scale of 100 nm. From the results, the embodiment successfully prepares the pre-designed locking type high-order square origami structure, and the structural regularity is good.

The morphology of the locked high-order square origami structure with positioned gold nanoparticles was characterized by an Atomic Force Microscope (AFM) in a solid phase scanning mode, and the results are shown in fig. 15.

Fig. 15 is an atomic force microscope image of the prepared locking high-order square origami structure with positioned gold nanoparticles, with a scale of 100 nm. From the results, the locking type high-order square origami structure with the gold nanoparticles accurately positioned and designed in advance is successfully prepared and obtained in the embodiment, and the structural regularity is good.

In summary, the present invention combines the covalently coupled branched chain type staple chain with the nucleic acid scaffold chain and the linear staple chain together in one step to form a high-order nucleic acid structure, and the obtained high-order nucleic acid structure can be further locked to obtain a compact locked high-order nucleic acid structure, which can accurately position the nanoparticle, thereby providing a new method for the research in the fields of molecular devices, biosensing, drug delivery, etc. Generally, the high-order nucleic acid structure has simple preparation process and strong universality, can realize large-scale production and has extremely high application value.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> national center for Nano science

<120> high-order nucleic acid structure, preparation method and application thereof

<130> 2022-06-10

<160> 31

<170> PatentIn version 3.3

<210> 1

<211> 38

<212> DNA

<213> Artificial sequence

<400> 1

tttttttttt tgctattttg cacccagcta caattttg 38

<210> 2

<211> 48

<212> DNA

<213> Artificial sequence

<400> 2

tttttttttt tttttttttt ggaacccatg taccgtaaca ctgagttt 48

<210> 3

<211> 38

<212> DNA

<213> Artificial sequence

<400> 3

tttttttttt tttgaaatac cgaccgtgtg ataaataa 38

<210> 4

<211> 48

<212> DNA

<213> Artificial sequence

<400> 4

tttttttttt tttttttttt ggataagtgc cgtcgagagg gttgatat 48

<210> 5

<211> 51

<212> DNA

<213> Artificial sequence

<400> 5

aaaaaaaaaa aaaaacccac ggggtttcct caagagaagg attttgaatt a 51

<210> 6

<211> 51

<212> DNA

<213> Artificial sequence

<400> 6

aaaaaaaaaa aaaaacccac cttttttcat ttaacaattt cataggatta g 51

<210> 7

<211> 51

<212> DNA

<213> Artificial sequence

<400> 7

aaaaaaaaaa aaaaacccat catatgtgta atcgtaaaac tagtcatttt c 51

<210> 8

<211> 51

<212> DNA

<213> Artificial sequence

<400> 8

aaaaaaaaaa aaaaacccaa gggatagctc agagccacca ccccatgtca a 51

<210> 9

<211> 51

<212> DNA

<213> Artificial sequence

<400> 9

aaaaaaaaaa aaaaacccat cgggagatat acagtaacag tacaaataat t 51

<210> 10

<211> 51

<212> DNA

<213> Artificial sequence

<400> 10

aaaaaaaaaa aaaaacccac gcgtctgata ggaacgccat caacttttac a 51

<210> 11

<211> 43

<212> DNA

<213> Artificial sequence

<400> 11

aaaaaaaaaa aaaaacccac ataggctggc tgacctttga aag 43

<210> 12

<211> 38

<212> DNA

<213> Artificial sequence

<400> 12

aaaaaaaaaa aaaaacccaa ggacagatga ttttttca 38

<210> 13

<211> 51

<212> DNA

<213> Artificial sequence

<400> 13

aaaaaaaaaa aaaaacccat aataaaacga actaaattat accagtcagg a 51

<210> 14

<211> 43

<212> DNA

<213> Artificial sequence

<400> 14

aaaaaaaaaa aaaaacccac aaacgtagaa aatacctggc atg 43

<210> 15

<211> 51

<212> DNA

<213> Artificial sequence

<400> 15

aaaaaaaaaa aaaaacccac cagtagcacc attaccgact tgagccattt g 51

<210> 16

<211> 38

<212> DNA

<213> Artificial sequence

<400> 16

aaaaaaaaaa aaaaacccaa ttaagactcc tttttaat 38

<210> 17

<211> 43

<212> DNA

<213> Artificial sequence

<400> 17

aaaaaaaaaa aaaaacccag ttattaattt taaaaaacaa ttc 43

<210> 18

<211> 51

<212> DNA

<213> Artificial sequence

<400> 18

aaaaaaaaaa aaaaacccaa tacagtaaca gtaccgaaat tgcgtagatt t 51

<210> 19

<211> 38

<212> DNA

<213> Artificial sequence

<400> 19

aaaaaaaaaa aaaaacccag acaactcgta ttttttcc 38

<210> 20

<211> 43

<212> DNA

<213> Artificial sequence

<400> 20

aaaaaaaaaa aaaaacccag ccattcgcca ttcagttccg gca 43

<210> 21

<211> 51

<212> DNA

<213> Artificial sequence

<400> 21

aaaaaaaaaa aaaaacccat gtgtgaaatt gttatccgag ctcgaattcg t 51

<210> 22

<211> 38

<212> DNA

<213> Artificial sequence

<400> 22

aaaaaaaaaa aaaaacccac cgcttctggt tttttcgt 38

<210> 23

<211> 38

<212> DNA

<213> Artificial sequence

<400> 23

tttttttttt ccaatccaaa taagaaacga ttttttgt 38

<210> 24

<211> 38

<212> DNA

<213> Artificial sequence

<400> 24

tttttttttt taacccacaa gaattgagtt aagcccaa 38

<210> 25

<211> 38

<212> DNA

<213> Artificial sequence

<400> 25

tttttttttt aaatcggaac cctaaaggga gcccccga 38

<210> 26

<211> 38

<212> DNA

<213> Artificial sequence

<400> 26

tttttttttt aaagggattt tagacaggaa cggtacgc 38

<210> 27

<211> 36

<212> DNA

<213> Artificial sequence

<400> 27

tttttttttt tttttttttt attgctcctt ttgata 36

<210> 28

<211> 36

<212> DNA

<213> Artificial sequence

<400> 28

tttttttttt tttttttttt ggtttatcag cttgct 36

<210> 29

<211> 36

<212> DNA

<213> Artificial sequence

<400> 29

tttttttttt tttttttttt gtataaacag ttaatg 36

<210> 30

<211> 36

<212> DNA

<213> Artificial sequence

<400> 30

tttttttttt tttttttttt aacctcccga cttgcg 36

<210> 31

<211> 19

<212> DNA

<213> Artificial sequence

<400> 31

tttttttttt tttttagcg 19

Claims

1. A high-order nucleic acid structure is characterized in that the high-order nucleic acid structure comprises a nucleic acid scaffold chain, a branched chain type staple chain and a linear staple chain except the linear staple chain in the branched chain type staple chain, wherein the nucleic acid scaffold chain, the branched chain type staple chain and the linear staple chain are assembled together through base complementary pairing;

the branched staple chain includes a branched organic molecule and a nucleic acid including a linear staple chain covalently coupled to the branched organic molecule.

2. The higher order nucleic acid structure of claim 1, wherein the nucleic acid scaffold strand comprises a circular DNA single strand M13mp18 or P7308;

preferably, the linear staple chain comprises a staple chain for assembling triangular folded paper, square folded paper or nanotube folded paper, respectively;

preferably, the branched organic molecule comprises azide-modified dipentaerythritol or azide-modified alpha-cyclodextrin;

3. A method of making a higher order nucleic acid structure according to claim 1 or 2, comprising:

4. The method of claim 3, wherein the co-assembly conditions comprise: incubating for 1-10 min at 90-95 ℃, and cooling to 1-4 ℃;

preferably, the mole ratio of the linear staple chain contained in the nucleic acid scaffold chain and the branched chain staple chain to the linear staple chain other than the branched chain staple chain is 1:1 (5-20).

5. The method for preparing a higher order nucleic acid structure according to claim 3 or 4, wherein the method for preparing a branched staple chain comprises:

6. The method of claim 5, wherein the reactive functional group comprises dibenzocyclooctyne-succinimide ester;

preferably, the molar charge ratio of the nucleic acid containing the linear staple chain to the reaction functional group is 1 (10-50);

preferably, the molar charge ratio of the nucleic acid modified with the reaction functional group and containing the linear staple chain to the branched organic molecule is (1-12): 1.

7. The method for preparing a higher order nucleic acid structure according to any of claims 3 to 6, wherein the method for preparing a higher order nucleic acid structure comprises the steps of:

(2) and mixing and co-assembling the nucleic acid scaffold chain, the branched chain type staple chain and the linear staple chain except the linear staple chain in the branched chain type staple chain to obtain the high-order nucleic acid structure.

8. Use of the higher order nucleic acid structure of claim 1 or 2 to localize a nanoparticle.

9. A method of positioning nanoparticles, the method comprising:

(1') adding a capture strand to the higher order nucleic acid structure of claim 1 or 2 to obtain a higher order nucleic acid structure containing a capture strand;

10. The method of claim 9, wherein base complementary pairing is performed between the capture strand and the hybrid strand;

preferably, the nucleic acid sequence of the capture chain comprises a sequence shown in SEQ ID NO. 5-SEQ ID NO.22, wherein the nucleic acid sequence of the capture chain for the triangular paper folding structure comprises a sequence shown in SEQ ID NO. 5-SEQ ID NO.10, and the nucleic acid sequence of the capture chain for the square paper folding structure comprises a sequence shown in SEQ ID NO. 11-SEQ ID NO. 22;

preferably, the nucleic acid sequence of the divalent staple chain comprises a sequence shown in SEQ ID No. 23-SEQ ID No.30, wherein the nucleic acid sequence of the divalent staple chain for locking the triangular paper folding structure comprises a sequence shown in SEQ ID No. 23-SEQ ID No.26, and the nucleic acid sequence of the divalent staple chain for locking the square paper folding structure comprises a sequence shown in SEQ ID No. 27-SEQ ID No. 30;