CN115011580B

CN115011580B - Cutinase mutant and its application in degradation of polyethylene terephthalate

Info

Publication number: CN115011580B
Application number: CN202210755217.8A
Authority: CN
Inventors: 吴敬; 颜正飞; 陈晓倩; 王蕾
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2023-08-25
Anticipated expiration: 2042-06-29
Also published as: CN115011580A

Abstract

The invention discloses a cutinase mutant and application thereof in polyethylene terephthalate degradation, belonging to the field of environmental science. The invention constructs 11 mutants by carrying out single-point or multi-point mutation on BhrPETase from bacterial HR29 and carrying out mutation on at least one amino acid of 93 rd, 122 th, 174 th, 184 th, 194 th, 207 th, 209 th and 213 th. Compared with the wild BhrPETase, the mutant for constructing 11 BhrPETases has obviously improved half-life at the temperature of 60 ℃ and obviously improved PET degradation efficiency, and has good industrial prospect.

Description

Cutinase mutant and its application in degradation of polyethylene terephthalate

Technical Field

The invention relates to a cutinase mutant and application thereof in polyethylene terephthalate degradation, belonging to the field of environmental science.

Background

Polyethylene terephthalate (PET) is one of plastics, and has been widely used worldwide at present because of its high mechanical strength, low air permeability, light weight, low cost price, and the like. A large amount of PET waste is difficult to degrade in a natural state because of being not effectively recovered, so that the PET is accumulated in a global ecological system to cause soil hardening caused by loss of soil nutrients, and a large amount of plastic drifting on the ocean can cause destructive striking on the ocean ecological system. At present, the landfill, incineration and materialization recovery treatment modes cause energy waste and have serious influence on the environment. Biodegradation is considered to be the most effective method of controlling plastic contamination.

Various PET hydrolases have been identified and demonstrated to degrade PET to varying degrees, such as PETase of Ideonella sakaiensis, a metagenomic LC cutinase in plant compost, a cutinase of Saccharomonora viridis AHK190, hiC of Thermomyces insolens, and lipase B of Candida antarctica, among others. Although the partially identified PET hydrolases have been shown to have relatively high degradability, their degradative effects are far from being as large-scale as desired.

In 2018, kato et al studied the PET hydrolase (BhrPETase) derived from bacterium HR29, which has good heat resistance and can catalyze ester bond hydrolysis, and has the effect of degrading PET into terephthalic acid (TPA) and Ethylene Glycol (EG). Nevertheless, the enzyme has lower catalytic efficiency, so the structure of the enzyme needs to be modified through site-directed mutagenesis, the efficiency of degrading PET is improved, and the efficient biodegradation of PET is realized.

Disclosure of Invention

The invention aims to overcome the defect of low PET degradation efficiency of cutinase and provides a novel cutinase mutant and application thereof. BhrPETase derived from bacteria HR29 and capable of hydrolyzing PET is synthesized, expressed and purified, and after the structure of the BhrPETase is studied, amino acid of an active region of the BhrPETase participating in substrate interaction is mutated so as to increase the activity of enzyme on the substrate PET.

The invention provides a cutinase mutant, which substitutes at least one amino acid of 93 rd, 122 th, 174 th, 184 th, 194 th, 207 th, 209 th and 213 th of a starting sequence; wherein,,

the starting sequence has at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the polypeptide at positions 1 to 259 shown in SEQ ID NO. 1.

In one embodiment, the mutant has a substitution of at least one amino acid of the starting sequence set forth in SEQ ID NO. 1:

substitution of glycine for phenylalanine at position 93;

substitution of proline for alanine at position 122;

substitution of serine for glutamic acid at position 174;

serine to histidine at position 184;

substitution of proline for serine at position 194;

substitution of threonine at position 207 with lysine;

substitution of phenylalanine at position 209 with isoleucine;

the isoleucine was replaced with lysine at position 213.

In one embodiment, the mutant is a BhrPETase mutant M1 (F93G) in which the amino acid sequence of the mutant is shown as SEQ ID NO. 2, and the 93 rd amino acid of the polypeptide shown as SEQ ID NO.1 is replaced by phenylalanine.

In one embodiment, the mutant is a BhrPETase mutant M2 (A122P) in which the 122 th amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by alanine and proline, and the amino acid sequence of the mutant is shown in SEQ ID NO. 3.

In one embodiment, the mutant is a BhrPETase mutant M3 (E174S) in which the amino acid sequence of the mutant is shown as SEQ ID NO. 4, and the amino acid at position 174 of the polypeptide shown as SEQ ID NO.1 is replaced by serine.

In one embodiment, the mutant is a BhrPETase mutant M4 (H184S) in which the 184 th amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by serine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 5.

In one embodiment, the mutant is a BhrPETase mutant M5 (S194P) in which the 194 th amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by serine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 6.

In one embodiment, the mutant is a BhrPETase mutant M6 (T207K) in which the 207 th amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by lysine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 7.

In one embodiment, the mutant is a BhrPETase mutant M7 (F209I) in which the 209 th amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by lysine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8.

In one embodiment, the mutant is a BhrPETase mutant M8 (S213K) in which the 213 th amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 9.

In one embodiment, the mutant is a BhrPETase mutant M9 (F93G/H184S) in which the 93 rd amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by phenylalanine and the 184 th amino acid is mutated from histidine to serine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 10.

In one embodiment, the mutant is a BhrPETase mutant M10 (F93G/H184S/F209I) in which the 93 rd amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by phenylalanine, the 184 th amino acid is mutated from histidine to serine, and the 209 th amino acid is mutated from phenylalanine to isoleucine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 11.

In one embodiment, the mutant is a BhrPETase mutant M11 (F93G/H184S/F209I/S213K) with the amino acid sequence shown in SEQ ID NO. 12, wherein the 93 rd amino acid of the polypeptide shown in SEQ ID NO.1 is replaced by phenylalanine, the 184 th amino acid is mutated from histidine to serine, the 209 th amino acid is mutated from phenylalanine to isoleucine, and the 213 th amino acid is mutated from serine to lysine.

The present invention provides polynucleotides encoding the mutants.

The invention provides a nucleic acid construct and a vector comprising the polynucleotide.

In one embodiment, the vector includes, but is not limited to, pET series, duet series, pGEX series, pHY300PLK, pPIC3K or pPIC9K series vectors.

In one embodiment, the vector is pET24a, and the polynucleotide encoding the mutant is inserted into the pET24a vector at a polyclonal cleavage site.

The present invention provides host cells expressing the mutants, or comprising the polynucleotides.

In one embodiment, the host cell includes, but is not limited to, E.coli, pichia pastoris, bacillus subtilis, saccharomyces cerevisiae.

The present invention provides a method for producing said cutinase mutant.

In one embodiment, the method comprises:

a) Culturing a host cell of the invention under conditions suitable for expression of the variant; and

b) Optionally recovering the variant.

In one embodiment, the a) is culturing the host cell in a medium comprising a carbon source, a nitrogen source and an inorganic salt.

In one embodiment, the a) is culturing the host cell in LB medium at 35-40℃and 150-250 rpm to OD ₆₀₀ After that, IPTG was added at a final concentration of 0.4mM and incubated at 20 to 30 ℃ and 150 to 250rpm to obtain a fermentation broth.

In one embodiment, b) is to centrifuge the fermentation broth and take the supernatant to obtain a crude enzyme solution, heat-treat the crude enzyme solution at 60 ℃ for 1h, remove other foreign proteins, and then centrifuge the supernatant to obtain a pure enzyme solution.

The invention provides products containing said cutinase mutants.

In one embodiment, the product includes, but is not limited to, an enzyme preparation or composition comprising the cutinase mutant.

In one embodiment, the enzyme preparation or composition contains an enzyme protecting agent; the protective agent comprises an acid-base regulator and a freeze-drying protective agent.

The present invention provides a method of degrading polyethylene terephthalate or a polyethylene terephthalate-containing substance by contacting the cutinase mutant with polyethylene terephthalate or a polyethylene terephthalate-containing product.

In one embodiment, the method is to add the cutinase mutant to a system comprising polyethylene terephthalate, and to contact the mutant with polyethylene terephthalate and to effect an enzymatic reaction.

In one embodiment, the cutinase mutant is added in an amount of not less than 6000U/g substrate; optionally, the cutinase is added in an amount of 6000 to 12000U/g substrate, or 6000 to 9000U/g substrate.

In one embodiment, the reaction is carried out at pH 8.0.+ -. 0.5, 50-60 ℃ and 150-250 rpm.

In one embodiment, the reaction time is not less than 80 hours, or not less than 96 hours.

The invention also provides a composition containing the cutinase mutant.

In one embodiment, the composition has the cutinase mutant as a primary enzyme component.

In one embodiment, the composition may comprise a plurality of enzymatic activities, contain the cutinase mutant, and contain one or more components selected from the group consisting of: proteases, glucoamylases, beta-amylases, pullulanases.

The invention also provides application of the mutant in degrading polyethylene terephthalate or a product containing the polyethylene terephthalate.

In one embodiment, the product is a plastic product comprising polyethylene terephthalate.

In one embodiment, the plastic product includes, but is not limited to, rigid or flexible packaging, agricultural film, bags, disposable items, textiles, fabrics, non-wovens, floor coverings, plastic waste, or fibrous waste.

In one embodiment, the plastic product is a plastic film, a plastic bottle, a plastic tray.

The invention has the beneficial effects that: a series of mutants are obtained by modifying BhrPETase from bacterial HR29, wherein single-point or multi-point mutation occurs near a substrate binding site of the BhrPETase, and the 93 rd, 122 th, 174 th, 184 th, 194 th, 207 th, 209 th and 213 th of the BhrPETase are mutated, so that 11 mutants are constructed. Compared with the wild BhrPETase, the 11 BhrPETase mutants (M1-M11) have obviously improved half lives at the temperature of 60 ℃ under the enzyme activity, obviously improved PET degradation efficiency and good industrial prospect.

Detailed Description

Definition or term:

cutinase: the term "cutinase" refers to an enzyme in class ec3.1.1.74 as defined by the enzyme nomenclature. For the purposes of the present invention, cutinase activity was determined according to the procedure described in the examples. In one aspect, variants of the invention have at least 20%, e.g., at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the cutinase activity of the polypeptide of SEQ ID NO. 1.

Polynucleotides encoding mutants: the term "polynucleotide encoding a mutant" directly specifies the amino acid sequence of a variant cutinase. The boundaries of the coding sequence are typically determined by an open reading frame that begins with a start codon (e.g., ATG, GTG, or TTG) and ends with a stop codon (e.g., TAA, TAG, or TGA). The coding sequence may be genomic DNA, cDNA, synthetic DNA, or a combination thereof, and the polynucleotides to which the present invention relates include, but are not limited to:

polynucleotide sequence encoding M1 (F93G):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATGGCCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGCATGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATTTTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M2 (a 122P):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATTTTCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATCCGAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGCATGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATTTTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M3 (E174S):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATTTTCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGAGTGCGGATACCGTGGCGCCGGTGAGTCAGCATGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATTTTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M4 (H184S):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATTTTCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGAGTGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATTTTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M5 (S194P):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATTTTCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGCATGCGATTCCGTTTTATCAGAACCTGCCGCCGACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATTTTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M6 (T207K):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATTTTCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGCATGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGAAACATTTTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M7 (F209I):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATTTTCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGCATGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATATTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M8 (S213K):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATTTTCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGCATGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATTTTGCGCCGAACAAACCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M9 (F93G/H184S):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATGGCCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGAGTGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATTTTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M10 (F93G/H184S/F209I):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATGGCCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGAGTGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATATTGCGCCGAACAGCCCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

polynucleotide sequence encoding M11 (F93G/H184S/F209I/S213K):

ATGAGCAACCCGTATCAGCGCGGCCCGAACCCGACCCGCAGCGCGCTGACCACCGATGGCCCGTTTAGCGTGGCGACCTATAGCGTGAGCCGCCTGAGCGTGAGCGGCTTTGGCGGCGGCGTGATTTATTATCCGACCGGCACCACCCTGACCTTTGGCGGCATTGCGATGAGCCCGGGCTATACCGCGGACGCGAGCAGCCTGGCGTGGTTAGGCCGCCGCCTGGCGAGCCATGGCTTTGTGGTGATTGTGATTAACACCAACAGCCGCCTGGATGGCCCGGATAGCCGCGCGAGTCAGCTGAGCGCGGCGCTGAACTATCTGCGCACGAGCAGTCCGAGTGCGGTACGGGCGCGCCTGGATGCCAATCGCCTGGCGGTCGCGGGACACAGCATGGGCGGCGGCGCGACCCTGCGCATTAGCGAACAGATTCCGACCCTGAAAGCGGGCGTGCCGCTGACCCCGTGGCATACCGATAAAACCTTTAACACCCCGGTGCCGCAGCTGATTGTGGGCGCGGAAGCGGATACCGTGGCGCCGGTGAGTCAGAGTGCGATTCCGTTTTATCAGAACCTGCCGAGCACCACCCCGAAAGTGTATGTGGAACTGTGCAACGCGACCCATATTGCGCCGAACAAACCGAACGCGGCGATTAGCGTGTATACCATTAGCTGGATGAAACTGTGGGTGGATAACGATACCCGCTATCGTCAGTTTCTGTGCAACGTGAACGATCCGGCGCTGTGCGATTTTCGCAGCAACAACCGCCATTGTCAG

expression: the term "expression" includes any step involving the production of a variant of a cutinase, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

Expression vector: the term "expression vector" means a linear or circular DNA molecule comprising a polynucleotide encoding a cutinase variant of the present invention and operably linked to control sequences that provide for its expression.

Fragments: the term "fragment" means a polypeptide that lacks one or more (e.g., several) amino acids at the amino and/or carboxy terminus of the polypeptide; wherein the fragment has cutinase activity. In one aspect, the fragment contains at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% of the number of amino acids 1 to 331 of SEQ ID NO.1 (i.e., not comprising the length of the zymogen region sequence).

Host cell: the term "host cell" means any cell type that is readily transformed, transfected, transduced, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any parent cell progeny that are not identical to the parent cell due to mutations that occur during replication.

The host cell may be any cell useful in the recombinant production of a variant of a cutinase, such as a prokaryotic cell or a eukaryotic cell.

The prokaryotic host cell may be any gram-positive or gram-negative bacterium. Gram positive bacteria include, but are not limited to: bacillus, clostridium, enterococcus, geobacillus (Geobacillus), lactobacillus, lactococcus, bacillus, staphylococcus, streptococcus and streptomyces. Gram-negative bacteria include, but are not limited to, campylobacter, escherichia, flavobacterium, fusobacterium, helicobacter, mirobacter, neisseria, pseudomonas, salmonella, and ureaplasma.

The host cell may also be a eukaryotic organism, such as a mammalian, insect, plant or fungal cell.

Improved degradability: the term "improved degradability" means a characteristic of a cutinase variant that is improved with respect to the effect of the parent cutinase in degrading PET or acting on ester linkages.

Separating: the term "isolated" means a substance in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance; (2) Any material that is at least partially removed from one or more or all of the naturally occurring components associated with it in nature, including but not limited to any enzyme, variant, nucleic acid, protein, peptide, or cofactor; (3) Any substance that is manually modified by hand relative to that found in nature; or (4) any agent modified by increasing the amount of the agent relative to other components with which it is naturally associated (e.g., multiple copies of a gene encoding the agent; use of a stronger promoter than that naturally associated with the gene encoding the agent). The isolated material may be present in a fermentation broth sample.

Variants: the term "variant" means a polypeptide having cutinase activity that comprises an alteration (i.e., substitution, insertion, and/or deletion) at one or more (e.g., several) positions. Substitution means that an amino acid occupying a certain position is replaced with a different amino acid; deletion means the removal of an amino acid occupying a certain position; whereas insertion means adding an amino acid next to and immediately after the amino acid occupying a certain position. The variant of the invention has the polypeptide amino acid sequence of SEQ ID NO.1, and is respectively substituted at 93 rd, 122 th, 174 th, 184 th, 194 th, 207 th, 209 th and 213 th, and the substituted amino acids are glycine (G), proline (P), serine (S), proline (P), lysine (K) isoleucine (I) and lysine (K). Meanwhile, 1 amino acid is added before the 1 st position (namely, the-1 st amino acid is generated), and the added amino acid is asparagine (D). At least 20%, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the cutinase activity of the variants of the invention.

M1 (F93G): on the basis of the wild type, the 93 rd position is replaced by glycine (G).

M2 (a 122P): on the basis of the wild type, the 122 th position is replaced by proline (P).

M3 (E174S): the 174 th position is replaced by serine (S) based on the wild type.

M4 (H184S): on the basis of the wild type, the 184 th position is replaced by serine (S).

M5 (S194P): on the basis of the wild type, the 194 th position is replaced by proline (P).

M6 (T207K): on the basis of the wild type, the 207 th position is replaced by lysine (K).

M7 (F209I): on the basis of the wild type, position 209 is substituted by isoleucine (I).

M8 (S213K): on the basis of the wild type, the 213 th position is replaced by lysine (K).

M9 (F93G/H184S): the 93 rd and 184 th positions are replaced by glycine (G) and serine (S) respectively on the basis of the wild type.

M10 (F93G/H184S/F209I): the 93 rd, 184 th and 209 th positions are replaced by glycine (G), serine (S) and isoleucine (I) respectively on the basis of the wild type.

M11 (F93G/H184S/F209I/S213K): positions 93, 184, 209 and 213 are substituted with glycine (G), serine (S), isoleucine (I) and lysine (K), respectively, based on the wild type.

In describing the variants of the invention, the nomenclature described below is adapted for ease of reference, using accepted IUPAC single letter or three letter amino acid abbreviations.

Substitution: for amino acid substitutions, the following nomenclature is used: original amino acid, position, substituted amino acid.

The cutinase of the present invention comprises a substitution at position 93 corresponding to the sequence shown in SEQ ID NO.1, substituted with glycine (G); substitution at position 122 to proline (P); substitution at position 174 to serine (S); substitution at position 184 to serine (S); substitution at position 194 to proline (P); substitution at position 207 to lysine (K); substitution at position 209 to isoleucine (I); substitution at position 213 to lysine (K); wherein,,

i) A polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the polypeptide at positions 1 to 259 shown in SEQ ID No. 1; and/or

ii) the cutinase is a polypeptide encoded by a polynucleotide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide coding sequence at positions 1 to 777 of the nucleotide sequence set forth in SEQ ID No. 13;

in one embodiment, the cutinase is substituted at position 93 with glycine (G);

in one embodiment, the substitution at position 122 of the cutinase is substituted with proline (P);

in one embodiment, the substitution at position 174 of the cutinase is substituted with serine (S);

in one embodiment, the substitution at position 184 of the cutinase is substituted with serine (S);

in one embodiment, the substitution at position 194 of the cutinase is substituted with proline (P);

in one embodiment, the substitution at position 207 of the cutinase is substituted with lysine (K);

in one embodiment, the substitution at position 209 of the cutinase is substituted with isoleucine (I);

in one embodiment, the substitution at position 213 of the cutinase is substituted with lysine (K).

Fermentation liquid: the term "fermentation broth" refers to a preparation produced by fermentation of cells that undergoes no or minimal recovery and/or purification. For example, fermentation broths are produced when a microbial culture is grown to saturation under carbon-limiting conditions that allow protein synthesis (e.g., expression of enzymes by host cells) and secretion of the protein into the cell culture medium. The fermentation broth may contain the unfractionated or fractionated content of the fermented material obtained at the end of the fermentation. Typically, the fermentation broth is unfractionated and comprises spent medium and cell debris present after removal of microbial cells (e.g., filamentous fungal cells), such as by centrifugation. In some embodiments, the fermentation broth contains spent cell culture medium, extracellular enzymes, and viable and/or non-viable microbial cells.

And (3) plastic: the term "plastic" or "plastic material" refers to a plastic product (e.g., sheet, tray, film, tube, block, fiber, fabric, etc.) and a plastic composition used to make the plastic product. In addition to the polymer, the plastic material may also contain other substances or additives, such as plasticizers, mineral or organic fillers, dyes, etc. Thus, in the context of the present invention, plastic material refers to any plastic product and/or plastic composition comprising at least one polymer in semi-crystalline and/or amorphous form, in particular at least one PET.

And (3) plastic products: the term "plastic product" includes manufactured plastic-containing products such as rigid or flexible packaging (films, bottles, trays), agricultural films, bags, disposable items, textiles, fabrics, non-wovens, floor coverings, plastic waste or fibrous waste, and the like.

And (2) polymer: the term "polymer" refers to a compound whose structure is made up of multiple repeating units (i.e., "monomers") linked by chemical covalent bonds. In the context of the present invention, without particular description, "polymer" refers more specifically to such compounds used in compositions of plastic materials.

And (3) polyester: the term "polyester" refers to a polymer that contains ester functionality in its backbone of the structure. The ester function is characterized by a bond between carbon and the other three atoms: a single bond to another carbon atom, a double bond to oxygen, and a single bond to another oxygen atom. Oxygen bonded to carbon by a single bond is itself bonded to another carbon by a single bond. The polyester may be made from only one type of monomer (i.e., a homopolymer) or at least two different monomers (i.e., a copolymer). The polyesters may be aromatic, aliphatic or semi-aromatic. For example, polyethylene terephthalate is a semi-aromatic copolymer composed of two monomers, terephthalic acid and ethylene glycol.

Degradation: "degradation" of a plastic or PET-containing plastic refers to the degradation of a polymer of the plastic material into smaller molecules, such as monomers and/or oligomers. In the context of the present invention, the use of a plastic material for degrading PET or PET-containing material refers to degrading PET in the plastic into monomers (such as terephthalic acid and/or ethylene glycol) and/or oligomers; such oligomers include, but are not limited to, dimethyl terephthalate (DMT), 2-hydroxyethyl methyl terephthalate (MHET), bis (2-hydroxyethyl) terephthalate (BHET).

The materials referred to in the following examples:

polyethylene terephthalate (PET) plastics referred to in the examples below were purchased from Goodfellow corporation. Ethylene Terephthalate (BHET), hydroxyethyl terephthalate (MHET) and terephthalic acid (TPA) were purchased from Sigma.

The detection method involved in the following examples is as follows:

coli JM109 and E.coli BL21 (DE 3) were purchased from Takara-Bao Ri doctor technology (Beijing) Co., ltd.

The culture medium involved is as follows:

LB solid medium (g/L): peptone 10, yeast powder 5, sodium chloride 10, agar 13, pH 7.0.

LB liquid medium (g/L): peptone 10, yeast powder 5, sodium chloride 10, pH 7.0.

Protein concentration determination method:

protein concentration was determined by Coomassie Brilliant blue method (Analytical Biochemistry 1976 72 (1-2): 248-54).

The degradation product and the content detection method thereof are as follows:

standard substance treatment: respectively weighing TPA, MHET, BHET standard substances, dissolving in dimethyl sulfoxide (DMSO) to obtain mother solution, diluting the mother solution into 0.1mg/mL standard substance solution with sterile water, filtering with 0.22 μm filter head, and injecting into liquid phase bottle with syringe for HPLC detection;

sample treatment: the culture broth was allowed to stand for 10min, the supernatant was centrifuged at 12000rpm for 8min at 5mL, filtered with a 0.22. Mu.M filter head, and injected into a liquid bottle by syringe for HPLC detection.

The degradation rate detection method comprises the following steps:

degradation rate (%) = ((M1/x1+m2/x2+m3/x 3) ×m)/(PET mass before treatment) ×100;

m1, m2 and m3 represent the weight of TPA, MHET and BHET in the volume of the reaction mixture; m is the relative molecular mass of the PET unit; x1 is the relative molecular mass of TPA; x2 is the relative molecular mass of MHET; x3 is the relative molecular mass of BHET.

The detection method of the enzyme activity comprises the following steps:

Tris-HCl buffer (10 mM pH 7.0): accurately weighing 1.210g of Tris, 0.584g of NaCl, adding about 800mL of deionized water, fully stirring and dissolving, adjusting the pH to 8.0 by using HCl, and fixing the volume to 1000mL.

Substrate (50 mmol/L p-nitrobenzoate solution): accurately weighing 0.1046g of p-nitrobutyrate, and keeping the volume to 10mL and at-20 ℃.

Preparation of a p-nitrophenol standard curve: 13.9mg of p-nitrophenol was weighed, the volume was set to 1000mL with 10mM Tris-HCl buffer, 100. Mu. Mol/L of p-nitrophenol mother liquor was prepared, and diluted to 0, 20, 40, 60, 80, 100. Mu. Mol/L with 10mM Tris-HCl buffer, pH 7.0. The absorbance at 405nm was measured on a spectrophotometer using a 0.5cm glass cuvette, and a standard curve a=a×c+b was drawn with the p-nitrophenol concentration C as the abscissa and the absorbance a as the ordinate.

1.5mL Tris-HCl buffer (10 min. Advanced incubation at 37 ℃) was accurately pipetted into a 0.5cm glass cuvette with a 5mL pipette and zeroed at an absorption wavelength of 405 nm. Taking 1.44mL of Tris-HCl buffer solution to a quartz cuvette of 0.5cm, taking 30 mu L of diluted enzyme solution to be detected, adding the diluted enzyme solution to the quartz cuvette, taking 30 mu L of substrate solution, adding the substrate solution to the quartz cuvette, shaking uniformly, immediately placing the mixture into a visible spectrophotometer, and measuring an A value at an absorption wavelength of 405 nm. The a value was recorded every 5 seconds with a reaction time of 1 minute.

And (3) calculating:

wherein: k: slope of curve formed by different time A values and time (min) measured by enzyme reaction;

V ₁ : reaction volume (mL);

V ₂ : enzyme addition amount (mL);

n: dilution factor.

The enzyme activity is defined as the amount of enzyme per minute catalyzing the hydrolysis of p-nitrophenyl butyrate to 1. Mu. Mol of p-nitrophenol at 65℃and pH8.0, which is one enzyme activity unit (U).

The method for detecting the half-life of enzyme activity comprises the following steps:

a certain amount of pure enzyme solution is dissolved in Tris-HCl buffer solution (10 mM pH 7.0) to prepare the enzyme solution to be detected with the final concentration of the pure enzyme of 1mg/mL. 2mL of enzyme solution to be detected is taken and placed at 60 ℃ for heat preservation treatment. And taking out 0.2mL of enzyme liquid to be detected every 24h, diluting, and adding a corresponding enzyme activity reaction system (enzyme activity detection method) to determine residual activity, wherein the enzyme activity before heat preservation is 100%. And (3) carrying out linear fitting by taking relative enzyme activity as an ordinate and holding time as an abscissa to construct a curve, wherein when the relative enzyme activity is 50%, the corresponding holding time is half-life.

The production method of the cutinase mutant comprises the following steps:

a method of producing a cutinase variant comprising: (a) Culturing a host cell of the invention under conditions suitable for expression of the cutinase variant; and (b) recovering the cutinase variant.

The host cells are cultured in a nutrient medium suitable for producing the cutinase variant using methods known in the art. For example, the cells may be cultured by shake flask culture, or small-scale or large-scale fermentation (including continuous fermentation, batch fermentation, fed-batch fermentation, or solid state fermentation) in a laboratory or industrial fermentor under conditions that allow expression and/or isolation of the cutinase or variant. Culturing occurs in a suitable nutrient medium containing carbon and nitrogen sources and inorganic salts using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions. If the cutinase variant is secreted into the nutrient medium, the cutinase variant may be recovered directly from the culture medium. If the cutinase variant is not secreted, it may be recovered from the cell lysate.

The cutinase variants may be detected using methods known in the art that are specific for the cutinase variants. These detection methods include, but are not limited to: the use of specific antibodies, the formation of enzyme products or the disappearance of enzyme substrates. For example, enzyme assays may be used to determine the activity of a cutinase variant (such as those described in the examples).

The cutinase variants may be recovered using methods known in the art. For example, the cutinase variant may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

The cutinase variants may be purified to obtain substantially pure cutinase variants by a variety of procedures known in the art, including, but not limited to, chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, chromatofocusing, and size exclusion chromatography), electrophoresis procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction.

In an alternative aspect, the cutinase variant is not recovered, but rather a host cell of the invention expressing the cutinase variant is used as a source of the cutinase variant.

Example 1: construction of BhrPETase mutant recombinant plasmid

(1) Inserting wild type cutinase (the amino acid sequence is shown as SEQ ID NO.1, the nucleotide sequence is shown as SEQ ID NO. 13) into NdeI site and XhoI site of pET24a by restriction enzyme to obtain pET24a-BhrPETase; then, PCR was performed using the plasmid pET24a-BhrPETase as a template and the primers shown in Table 1 by using site-directed mutagenesis (site-directed mutagenesis) to obtain the desired gene mutant fragment (the primers are shown in Table 1). The target fragment was ligated to pET-24a expression vector by Megawhop PCR to obtain a recombinant plasmid. Transforming the constructed recombinant plasmid into Escherichia coli JM109 to obtain a transformation product; coating the transformation product on LB solid medium (containing 40 mug/mL kanamycin), and inversely culturing for 8-12 h in a constant temperature incubator at 37 ℃ to obtain a transformant; picking up the transformant, inoculating the transformant into LB liquid medium, shake-flask culturing for 8-12 h at 37 ℃ and 120-180 rpm, extracting plasmids, and carrying out sequencing verification to obtain recombinant plasmids expressing different BhrPETase mutants.

TABLE 1 primer sequences

(2) Construction of BhrPETase mutant recombinant E.coli

Transforming the correct recombinant plasmid obtained in the step (1) into Escherichia coli BL21 to obtain a transformation product; coating the transformation product on LB solid medium (containing 50 mug/mL kanamycin), and inversely culturing for 8-12 h in a constant temperature incubator at 37 ℃ to obtain a transformant; picking up the transformant, inoculating the transformant into an LB liquid medium, shaking and culturing for 8-12 hours at 37 ℃ and 120-180 rpm, extracting plasmids, performing enzyme digestion verification and sequencing verification, and obtaining recombinant escherichia coli after verification of correctness: e.coli BL21/pET-24 (+) -M1, E.coli BL21/pET-24 (+) -M2, E.coli BL21/pET-24 (+) -M3, E.coli BL21/pET-24 (+) -M4, E.coli BL21/pET-24 (+) -M5;

(3) Preparation of BhrPETase mutant

The BhrPETase mutant recombinant E.coli obtained in the step 2 was transferred into 100mL of LB liquid medium at an inoculum size of 5% (v/v), and shake-cultured at 37℃at 200rpm for 3 hours to OD ₆₀₀ After=0.8 IPTG was added to a final concentration of 0.4mM, shaking culture was continued at 25 ℃ at 200rpm for 20h to obtain a fermentation broth; centrifuging at 8000rpm for 15min to obtain supernatant as crude enzyme solution. In order to quickly obtain high-purity enzyme protein, the crude enzyme solution is subjected to ammonium sulfate precipitation to obtain protein precipitation, then 10mM Tris-HCl buffer solution with pH of 7.0 is used for redissolving, the obtained product is placed at 60 ℃, heat-treated in a warm bath for 1h, and centrifuged for 15min under the condition of 8000rpm to remove the impurity protein, so as to obtain purified BhrPETase enzyme solution.

Example 2: performance of BhrPETase mutants

Wild type and BhrPETase mutants were taken to determine enzyme activity, protein concentration and heat resistance (half life at 60 ℃).

As shown in Table 2, compared with the wild type BhrPETase, the specific enzyme activity of the 11 BhrPETase mutants is obviously improved, for example, the mutant M4 is improved from 123.25U/mg to 371.82U/mg, and the improvement is 201.7%. Meanwhile, the expression level of the mutant is improved to different degrees, for example, the mutant M3 is improved from 0.43mg/mL of the wild type to 0.51mg/mL, and is improved by 2.2 times compared with the wild type.

Compared with the wild BhrPETase, the thermal stability of the 11 BhrPETase mutants is obviously improved at 60 ℃, and compared with the wild BhrPETase mutants, the thermal stability of the 11 BhrPETase mutants is improved to 109-150 h at 103h, and the half life of the mutant M1 is improved to 150h from 96h.

TABLE 2 enzymatic Activity and concentration of BhrPETase mutants

Example 3: degradation performance of BhrPETase mutant on PET film

Taking 20mL of pH8.0,0.1M phosphate buffer solution, adding 100mg of polyethylene terephthalate film to the buffer solution, and adding BhrPETase mutants obtained in example 2 in the addition amount of 50mg of enzyme protein/g substrate (namely, 6162U/g substrate, 11103U/g substrate, 8284U/g substrate, 7637U/g substrate, 18591U/g substrate, 9149U/g substrate, 15396U/g substrate, 6322U/g substrate, 7643U/g substrate, 7942U/g substrate, 8230U/g substrate and 8957U/g substrate of wild type and M1-M11 respectively); after 96 hours of reaction in a water bath shaker with constant temperature of 60 ℃ and 200rpm, the reaction liquid is boiled for 15 minutes to inactivate enzyme, and the supernatant is obtained by centrifugation at 12,000rpm/min for 10 minutes, and the degradation rate is calculated by HPLC analysis.

As shown in Table 3, the efficiency of the mutant of 11 BhrPETases on PET degradation is obviously higher than that of the wild BhrPETase protein, wherein the degradation rate of the mutant M10 of the BhrPETase on PET is up to 100%, and the degradation rate of the mutant M10 of the BhrPETase is improved by nearly 3.1 times compared with that of the wild BhrPETase protein.

TABLE 3 Effect of BhrPETase mutants on PET degradation

Example 4: application of BhrPETase mutant in treatment of PET plastic bottle

A cola plastic bottle was cut into pieces (about 25 mg/piece) of 0.5mm 2cm X2 cm in thickness, 3 pieces of the plastic bottle pieces, about 75mg, were added to 20mL of a phosphate buffer solution of pH8.0, 0.1M, and 50mg of the enzyme protein/g substrate (i.e., 6162U/g substrate for the wild type, M1 to M11, respectively), 11103U/g substrate, 8284U/g substrate, 7637U/g substrate, 18591U/g substrate, 9149U/g substrate, 15396U/g substrate, 6322U/g substrate, 7643U/g substrate, 7942U/g substrate, 8230U/g substrate, 8957U/g substrate) was reacted in a shaking table of water bath at 60℃for 96 hours, and after the reaction, the reaction solution was digested for 15 minutes, and centrifuged for 10 minutes at 12,000rpm to obtain supernatants, and the degradation rate was calculated.

The results are shown in table 4, the wild type BhrPETase protein had no significant degradation efficiency for PET plastic bottles, degrading only 1.21% PET plastic bottles within 96 hours. Compared with the mutant proteins of 11 BhrPETase, the degradation efficiency of the mutant proteins on PET plastic bottles is obviously improved, and the mutant proteins are far higher than wild BhrPETase proteins. The degradation rate of the mutants M6, M8 and M10 of BhrPETase on PET plastic bottles exceeds 50%, wherein the degradation rate of the mutant M10 of BhrPETase on PET is up to 70%, which is nearly 70 times higher than that of the mutant M10 of BhrPETase on PET plastic bottles.

TABLE 4 degradation effects of BhrPETase mutants on PET Plastic bottles

Mutant	Degradation rate (%)
		Wild type	1.21
M1	13.57
		M2	24.63
M3	16.57
		M4	24.53
M5	45.67
		M6	65.24
M7	35.53
		M8	57.73
M9	26.46
		M10	70.12
M11	37.14

Example 5: compositions or enzyme preparations containing BhrPETase mutants

A cutinase enzyme protein was prepared by the method of example 1, and the enzyme protein was mixed with an enzyme protectant; the protective agent comprises an acid-base regulator and a freeze-drying protective agent.

The acid-base regulator is a conventional buffer solution capable of maintaining pH, such as malic acid-sodium malate buffer solution, acetic acid-sodium acetate buffer solution, citric acid-sodium citrate buffer solution, citric acid-sodium hydroxide-hydrochloric acid buffer solution and Tris-hydrochloric acid buffer solution. The buffer is used to maintain the cutinase enzyme protein at its optimal pH conditions to ensure its maximum catalytic activity.

The lyoprotectant is used to reduce chemical and/or physical instability of the cutinase enzyme protein during lyophilization and/or subsequent storage, including but not limited to sugars and their corresponding sugar alcohols, such as sucrose, lactose, trehalose, dextran, erythritol, arabitol, xylitol, sorbitol, mannitol; amino acids such as arginine or histidine; lyotropic salts such as magnesium sulfate; polyols such as propylene glycol, glycerol, poly (ethylene glycol) or poly (propylene glycol); and combinations of any of the foregoing.

Example 6: application of cutinase mutant

The cutinase mutant can be used for degrading and recycling polyesters, such as polyethylene terephthalate (PET), and can break ester bonds of the polyesters, so that the degradation of substances polymerized by the polyethylene terephthalate is realized, and the substances are changed from an insoluble state to a soluble state.

In particular, films polymerized from ethylene terephthalate can be treated using the cutinase mutants of the present invention.

The cutinase mutant can be used for treating textiles containing PET, and the treated polyester textiles can increase wearing comfort, increase water penetrability, reduce static electricity and improve hand feeling and softness.

The cutinase mutant can be used for improving the functional coating of PET-containing yarns or fabrics, and the cutinase mutant can be used for increasing the number of functional groups on the surfaces of the fabrics and the like by treating the yarns or fabrics, so that the functional coating agent is adsorbed.

The cutinase mutants may also be used in other known applications of lipases and cutinases, such as in the paper industry (patent document publication No. CN 106480771A), leather, wool and related industries (patent document publication No. CN 104673772A), as well as in other applications involving degreasing/degreasing. The immobilized cutinase mutants can be used as catalysts for organic synthesis (e.g., esterification, transesterification, or lipid hydrolysis) in the lipid and oil manufacturing industries.

Comparative example 1:

specific embodiments are the same as examples 1-2, except that mutants shown in Table 5 are obtained by mutating amino acids 60, 61, 62, 66, 69 and 73, respectively, and mutant enzyme proteins are prepared according to the method of example 2, and the protein concentration, enzyme activity, specific enzyme activity and half-life are measured; degradation of PET plastic bottles was performed as follows: 2 cm. Times.2 cm pieces of plastic bottle chips were added to 20mL pH8.0,0.1mmol/L phosphate buffer, 50mg of enzyme protein per g of substrate (i.e., 6079U/g of substrate, 5869U/g of substrate, 3467.5U/g of substrate, 5204U/g of substrate, 4916U/g of substrate, 4317U/g of substrate, respectively) were added, reacted in a thermostatic water bath shaker at 60℃for 96 hours, the reaction mixture was boiled for 15 minutes to inactivate enzymes, and centrifuged at 12,000rpm/min for 10 minutes to obtain a supernatant, which was analyzed by HPLC to calculate the degradation rate.

As shown in Table 5, the specific enzyme activities of the mutants of 6 BhrPETases were lower than that of the wild type BhrPETase, with the mutant C3 reduced from 123.25U/mg to 69.35U/mg. At the same time, the expression level of the mutant was also decreased to a different extent, for example, mutant C3 was decreased from 0.43mg/mL to 0.11mg/mL of the wild type. The thermal stability at 60℃of the 11 mutants of BhrPETase did not differ significantly. The degradation efficiency of the mutants of 6 BhrPETase on PET plastic bottles is not significantly changed from that of the wild BhrPETase protein.

TABLE 5 enzymatic Activity and concentration of BhrPETase mutants

Comparative example 2:

specific embodiments are the same as examples 1-2, except that phenylalanine at position 93 is also mutated into alanine, serine, threonine, valine and asparagine, mutants as shown in Table 6 are obtained, and enzyme proteins are prepared according to the method of example 2, and their protein concentration, enzyme activity, specific enzyme activity and half-life are measured; degradation of PET plastic bottles was performed as follows: 2 cm. Times.2 cm pieces of plastic bottle chips were added to 20mL pH8.0,0.1mmol/L phosphate buffer, 50mg of enzyme protein per g of substrate (i.e., 4862U/g of substrate, 4162U/g of substrate, 3946U/g of substrate, 6094.5U/g of substrate, 5533.5U/g of substrate, respectively) were added to the above reaction solution, reacted in a thermostatic water bath shaker at 60℃and 200rpm for 96 hours, the reaction solution was boiled for 15 minutes to inactivate enzymes, and centrifuged at 12,000rpm/min for 10 minutes to obtain a supernatant, which was subjected to HPLC analysis to calculate the degradation rate.

As shown in Table 6, the specific enzyme activities of the mutants of 5 BhrPETases were lower than that of the wild type BhrPETase, wherein mutant M1.3 was reduced from 123.25U/mg to 78.92U/mg. Meanwhile, the expression level and the thermal stability of the mutant are not significantly different. The degradation efficiency of the 5 mutants of BhrPETase on PET plastic bottles is not significantly changed from that of the wild BhrPETase protein.

TABLE 6 enzymatic Activity and concentration of BhrPETase mutants

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of Jiangnan

<120> cutinase mutant and its use in polyethylene terephthalate degradation

<130> GBAA220774B

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 259

<212> PRT

<213> artificial sequence

<400> 1

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Phe Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln His Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Phe Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 2

<211> 259

<212> PRT

<213> artificial sequence

<400> 2

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Gly Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln His Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Phe Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 3

<211> 259

<212> PRT

<213> artificial sequence

<400> 3

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Phe Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Pro Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln His Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Phe Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 4

<211> 259

<212> PRT

<213> artificial sequence

<400> 4

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Phe Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Ser Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln His Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Phe Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 5

<211> 259

<212> PRT

<213> artificial sequence

<400> 5

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Phe Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln Ser Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Phe Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 6

<211> 259

<212> PRT

<213> artificial sequence

<400> 6

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Phe Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln His Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Pro Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Phe Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 7

<211> 259

<212> PRT

<213> artificial sequence

<400> 7

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Phe Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln His Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Lys His

195 200 205

Phe Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 8

<211> 259

<212> PRT

<213> artificial sequence

<400> 8

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Phe Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln His Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Ile Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 9

<211> 259

<212> PRT

<213> artificial sequence

<400> 9

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Phe Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln His Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Phe Ala Pro Asn Lys Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 10

<211> 259

<212> PRT

<213> artificial sequence

<400> 10

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Gly Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln Ser Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Phe Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 11

<211> 259

<212> PRT

<213> artificial sequence

<400> 11

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Gly Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln Ser Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Ile Ala Pro Asn Ser Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 12

<211> 259

<212> PRT

<213> artificial sequence

<400> 12

Met Ser Asn Pro Tyr Gln Arg Gly Pro Asn Pro Thr Arg Ser Ala Leu

1 5 10 15

Thr Thr Asp Gly Pro Phe Ser Val Ala Thr Tyr Ser Val Ser Arg Leu

20 25 30

Ser Val Ser Gly Phe Gly Gly Gly Val Ile Tyr Tyr Pro Thr Gly Thr

35 40 45

Thr Leu Thr Phe Gly Gly Ile Ala Met Ser Pro Gly Tyr Thr Ala Asp

50 55 60

Ala Ser Ser Leu Ala Trp Leu Gly Arg Arg Leu Ala Ser His Gly Phe

65 70 75 80

Val Val Ile Val Ile Asn Thr Asn Ser Arg Leu Asp Gly Pro Asp Ser

85 90 95

Arg Ala Ser Gln Leu Ser Ala Ala Leu Asn Tyr Leu Arg Thr Ser Ser

100 105 110

Pro Ser Ala Val Arg Ala Arg Leu Asp Ala Asn Arg Leu Ala Val Ala

115 120 125

Gly His Ser Met Gly Gly Gly Ala Thr Leu Arg Ile Ser Glu Gln Ile

130 135 140

Pro Thr Leu Lys Ala Gly Val Pro Leu Thr Pro Trp His Thr Asp Lys

145 150 155 160

Thr Phe Asn Thr Pro Val Pro Gln Leu Ile Val Gly Ala Glu Ala Asp

165 170 175

Thr Val Ala Pro Val Ser Gln Ser Ala Ile Pro Phe Tyr Gln Asn Leu

180 185 190

Pro Ser Thr Thr Pro Lys Val Tyr Val Glu Leu Cys Asn Ala Thr His

195 200 205

Ile Ala Pro Asn Lys Pro Asn Ala Ala Ile Ser Val Tyr Thr Ile Ser

210 215 220

Trp Met Lys Leu Trp Val Asp Asn Asp Thr Arg Tyr Arg Gln Phe Leu

225 230 235 240

Cys Asn Val Asn Asp Pro Ala Leu Cys Asp Phe Arg Ser Asn Asn Arg

245 250 255

His Cys Gln

<210> 13

<211> 777

<212> DNA

<213> artificial sequence

<400> 13

atgagcaacc cgtatcagcg cggcccgaac ccgacccgca gcgcgctgac caccgatggc 60

ccgtttagcg tggcgaccta tagcgtgagc cgcctgagcg tgagcggctt tggcggcggc 120

gtgatttatt atccgaccgg caccaccctg acctttggcg gcattgcgat gagcccgggc 180

tataccgcgg acgcgagcag cctggcgtgg ttaggccgcc gcctggcgag ccatggcttt 240

gtggtgattg tgattaacac caacagccgc ctggattttc cggatagccg cgcgagtcag 300

ctgagcgcgg cgctgaacta tctgcgcacg agcagtccga gtgcggtacg ggcgcgcctg 360

gatgccaatc gcctggcggt cgcgggacac agcatgggcg gcggcgcgac cctgcgcatt 420

agcgaacaga ttccgaccct gaaagcgggc gtgccgctga ccccgtggca taccgataaa 480

acctttaaca ccccggtgcc gcagctgatt gtgggcgcgg aagcggatac cgtggcgccg 540

gtgagtcagc atgcgattcc gttttatcag aacctgccga gcaccacccc gaaagtgtat 600

gtggaactgt gcaacgcgac ccattttgcg ccgaacagcc cgaacgcggc gattagcgtg 660

tataccatta gctggatgaa actgtgggtg gataacgata cccgctatcg tcagtttctg 720

tgcaacgtga acgatccggc gctgtgcgat tttcgcagca acaaccgcca ttgtcag 777

Claims

1. A cutinase mutant characterized by comprising any of the following mutants:

m1: substitution of glycine at position 93 based on wild type cutinase;

m9: on the basis of wild type cutinase, the 93 rd position and the 184 th position are respectively replaced by glycine and serine;

m10: substitution of 93 rd, 184 th and 209 th sites with glycine, serine and isoleucine respectively based on wild cutinase;

m11: substitution of 93 rd, 184 th, 209 th and 213 th sites with glycine, serine, isoleucine and lysine based on wild cutinase;

the amino acid sequence of the wild type cutinase is shown as SEQ ID NO. 1.

2. A polynucleotide encoding the mutant of claim 1.

3. A nucleic acid construct or vector comprising the polynucleotide of claim 2.

4. A host cell expressing the mutant of claim 1 or comprising the polynucleotide of claim 2.

5. A method for producing the mutant according to claim 1, wherein,

a) Culturing the host cell of claim 4 under conditions suitable for expression of the mutant; and

b) Optionally recovering the mutant.

6. A product comprising the cutinase mutant of claim 1.

7. A process for degrading polyethylene terephthalate or a product comprising polyethylene terephthalate, characterized in that the mutant according to claim 1 is contacted with polyethylene terephthalate or a product comprising polyethylene terephthalate.

8. The method according to claim 7, wherein the reaction is carried out at pH 8.0.+ -. 0.5, 50-60 ℃ and 150-250 rpm.

9. Use of the mutant according to claim 1 for degrading polyethylene terephthalate or a product containing polyethylene terephthalate.

10. Use according to claim 9, characterized in that the product is a plastic product containing polyethylene terephthalate.

11. Use according to claim 10, characterized in that the plastic product comprises rigid or flexible packaging, agricultural films, bags, disposable items, textiles, non-wovens, floor coverings, plastic waste or fibre waste.