CN115005099A - Genetic transformation method of tartary buckwheat - Google Patents
Genetic transformation method of tartary buckwheat Download PDFInfo
- Publication number
- CN115005099A CN115005099A CN202210646308.8A CN202210646308A CN115005099A CN 115005099 A CN115005099 A CN 115005099A CN 202210646308 A CN202210646308 A CN 202210646308A CN 115005099 A CN115005099 A CN 115005099A
- Authority
- CN
- China
- Prior art keywords
- culture
- culture medium
- agrobacterium
- genetic transformation
- transformation method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/008—Methods for regeneration to complete plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/002—Culture media for tissue culture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Developmental Biology & Embryology (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to the field of plant tissue culture and genetic transformation, in particular to a genetic transformation method of tartary buckwheat, which comprises the following steps: (1) preparation of aseptic seedlings (2) culture of agrobacterium tumefaciens (3) explant preparation (4) infection and co-culture (5) adventitious bud induction culture (6) rooting culture. The method uses cotyledonary node as initial explant, establishes a rapid and effective regeneration system through direct organogenesis, does not undergo induction and differentiation of callus, simplifies the culture process, and can obtain tartary buckwheat regeneration plant in short time; the tissue culture seedling cultured by the method has high phenotype consistency and stably keeps the excellent characteristics of a parent.
Description
Technical Field
The invention relates to plant tissue culture and genetic transformation, in particular to a genetic transformation method of tartary buckwheat.
Background
Tartary buckwheat, a plant of the genus Fagopyrum of the family Polygonaceae of dicotyledonous species, is called "the King of five cereals" because of its rich nutritional value and pharmacological effect. The tartary buckwheat not only has higher contents of fat, protein, vitamins and mineral substances than wheat and rice, but also has the effects of reducing blood fat, reducing blood sugar and resisting aging, and various processed products are favored by consumers. The tartary buckwheat is cool and barren-resistant in nature, is planted in high and cold mountainous areas in the southwest of China, and plays an important role in local development.
The tartary buckwheat germplasm resources in China are rich, but the planting is dispersed and the scale is small, and the problems of variety degradation, low yield and the like exist. In addition, the tartary buckwheat is not suitable for cross breeding on the genetic background, the mutation breeding period is very long, and the current increasingly urgent breeding requirements are difficult to meet. With the rapid development of modern biotechnology, modern biotechnology means represented by gene editing has become an effective choice for crop improvement. Therefore, establishing a stable tartary buckwheat genetic transformation regeneration system technical platform becomes a key link for supporting research in the frontier field of tartary buckwheat. Although the development of the regeneration system and genetic transformation of the tartary buckwheat is advanced to some extent at home and abroad at present, the genetic transformation system of the tartary buckwheat is still not mature due to the problems of complex genotype, low survival rate of regenerated plants and the like, and the acquisition of transgenic lines is very difficult.
Limited by low tissue culture efficiency of the tartary buckwheat, the genetic transformation system of the tartary buckwheat cannot be established in a delayed way. Therefore, a stable and efficient tartary buckwheat genetic transformation system needs to be established, and an effective way for deeply developing tartary buckwheat biological basic research and molecular assisted breeding research is provided.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a genetic transformation method of tartary buckwheat, so as to at least achieve the excellent characteristics of simple culture process, high phenotypic consistency of tissue culture seedlings and capability of stably keeping a parent.
The purpose of the invention is realized by the following technical scheme:
a genetic transformation method of tartary buckwheat comprises the following steps:
(1) preparation of sterile seedlings: inoculating the sterilized tartary buckwheat seeds into an MS culture medium for culture to obtain aseptic seedlings;
(2) and (3) culturing agrobacterium: inoculating agrobacterium to an agrobacterium activation culture medium for activation to obtain agrobacterium infection liquid;
(3) preparing an explant: the aseptic seedling is cut flatly at a position 2-5mm below the cotyledon joint by using an aseptic blade, and the hypocotyl area and true leaf part are removed to obtain a cotyledon node explant;
(4) infection and co-culture: putting the cotyledonary node explant into the agrobacterium infection solution for dip dyeing, sucking water from the infected explant, putting the infected explant into a co-culture medium for dark culture, and obtaining a co-culture cotyledonary node explant;
(5) adventitious bud induction culture: inoculating the co-cultured cotyledon node explant to an adventitious bud induction culture medium for culture to obtain a subculture cluster bud;
(6) rooting culture: dividing the subculture cluster buds into single plants, and inoculating the single plants to a rooting culture medium for culture to obtain the tartary buckwheat transgenic plants.
Further, in the step (1), the MS culture medium comprises the following components: 25-35g/L, MS g/4-5 g/L of sucrose and 6-8g/L of agar powder; adjusting the pH value of the MS culture medium to be 5.6-6.0, wherein the culture conditions are 20-25 ℃, the illumination intensity is 5000-.
Further, in the step (1), the sterilization method specifically comprises the steps of sequentially soaking the tartary buckwheat seeds in 70% alcohol for 30s, cleaning with sterile water for 2-3 times, sterilizing with 0.1% mercuric chloride for 8min, cleaning with sterile water for 6-8 times, and then removing surface moisture.
Further, in the step (2), the agrobacterium is LBA 4404; the agrobacterium vector is pCHF 3-YFP; the components of the agrobacterium activating culture medium comprise 4-6g/L beef extract, 4-6g/L peptone, 0.5-2g/L yeast extract, 4-6g/L sucrose and 0.2-0.8g/L magnesium sulfate heptahydrate, and the pH value of the agrobacterium activating culture medium is adjusted to 7.0-7.5.
Further, in the step (2), the agrobacterium is prepared into agrobacterium liquid, and then inoculated on an agrobacterium activation culture medium for activation, wherein OD of the agrobacterium liquid 600 Is 0.4-0.6.
Further, in the step (4), the components of the co-culture medium comprise 30g/L, MS of sucrose and 4.74g/L of agar powder, 7g/L of agar powder and 100mg/L of acetosyringone; adjusting the pH value of the co-culture medium to 5.6-6.0, and culturing at 22 ℃ for 2-3d in the dark.
Further, in the step (5), the adventitious bud induction culture medium comprises 25-35g/L, MS powder of sucrose 4-5g/L, 6-8g/L agar powder, and 0.5-2.5 mg/L6-benzylaminopurine; adjusting the pH value of the adventitious bud induction culture medium to be 5.6-6.0, wherein the culture conditions are 20-25 ℃, the illumination intensity is 5000-6000lx, the illumination time is 14-16h/d, and the culture time is 15-25 d.
Further, the adventitious bud induction culture medium also comprises 50mg/L kanamycin and 50mg/L timentin.
Further, in the step (5), subculture is performed every 14 to 16 days during the period on the adventitious bud induction medium.
Further, in the step (6), the components of the rooting medium comprise 25-35g/L, MS of sucrose powder, 4-5g/L of agar powder, 6-8g/L of indolebutyric acid and 1-2mg/L of indolebutyric acid; adjusting the pH value of the rooting medium to be 5.6-6.0, wherein the culture conditions are 20-25 ℃, the illumination intensity is 5000-.
Furthermore, the rooting medium also comprises 40-60mg/L kanamycin and 40-60mg/L timentin.
The invention has the beneficial effects that:
1. the invention uses cotyledonary node as initial explant, establishes a rapid and effective regeneration system through direct organogenesis, does not need to induce and differentiate callus, simplifies the culture process, and can obtain tartary buckwheat regeneration plant in short time.
2. According to the invention, the regeneration efficiency of the tartary buckwheat cotyledon node is greatly improved by optimizing the culture medium for inducing the adventitious buds of the tartary buckwheat cotyledon node.
3. According to the invention, a transgenic positive strain is obtained by researching and optimizing a treatment mode and a culture condition in a transformation process through experiments, and a stable agrobacterium-mediated tartary buckwheat genetic transformation system is smoothly established.
4. The tissue culture seedling cultured by the method has high phenotype consistency and stably keeps the excellent characteristics of a parent.
Drawings
FIG. 1 is a diagram of the entire process from cotyledonary node to transgenic plant of the invention;
FIG. 2 is a graph showing the effect of different concentrations of hormone on the germination rate of cotyledonary nodes in example 1;
FIG. 3 shows the germination rates of Agrobacterium transformed in example 2 under different conditions;
FIG. 4 is the gel electrophoresis image of the PCR product of the regenerated plant of Fagopyrum tataricum in example 3, M-D2000 Marker; 1-a plasmid; 2-ddH 2 O; 3-10, regenerating single plants after transformation;
FIG. 5 is an alignment analysis of the sequencing results of the PCR products of Tartary buckwheat of example 3;
FIG. 6 is a fluorescence observation image of transgenic tartary buckwheat and wild tartary buckwheat leaves in example 4;
FIG. 7 shows the growth of the hypocotyl explants in adventitious bud induction medium in comparative example 1;
FIG. 8 is the expansion ratio of the hypocotyls in different shoot induction media in comparative example 1;
FIG. 9 shows the 20-day growth of hairy root explants in callus induction medium in comparative example 2;
FIG. 10 is the swelling ratio of the hairy root in different callus media in comparative example 2.
Detailed Description
The technical solutions of the present invention are further described in detail below with reference to the accompanying drawings, but the scope of the present invention is not limited to the following.
Example 1
Induction of adventitious buds of cotyledonary nodes
Preparation of sterile seedlings: selecting full-grain and insect-free tartary buckwheat seeds, soaking the seeds in deionized water at 42 ℃ for 30min, peeling the seeds with clean tweezers, and sterilizing and inoculating the seeds to an MS culture medium; wherein the sterilization mode comprises soaking in 70% ethanol for 30s in an ultra-clean bench, washing with sterile water for 3 times, soaking in 0.1% mercuric chloride for 8min, and washing with sterile water for 7 times. Placing the sterilized seeds on sterile filter paper to absorb water, placing the seeds into an MS culture medium, placing 10-13 seeds in each bottle, performing dark culture for 2-3d, and performing light culture for 10-15d, wherein the MS culture medium comprises 30g/L, MS of sucrose and 4.74g/L of agar powder and 7g/L of agar powder;
preparing an explant: selecting a pollution-free and healthy sterile seedling cultured for 15d in the step 1, performing plane cutting at a position 2mm below the cotyledon joint by using a sterile blade, and removing a hypocotyl area and a true leaf part to obtain a cotyledon node explant;
adventitious bud induction culture: inoculating cotyledonary nodes to adventitious bud induction culture media with different hormone concentrations, and culturing for 20d under the conditions that the illumination intensity is 5000lx and the illumination is 16 h/d; during this period, subculture was performed 1 time every 15 days.
The germination rate is counted and the best adventitious bud induction culture medium is determined, and the hormone proportion and the germination rate (bud induction rate) of the culture medium are shown in a table 1 and an attached figure 2 of the specification. As can be seen from Table 1, J 2 The germination rate of the culture medium is the highest and is 94.44%.
TABLE 1 Effect of regeneration Medium with different hormone ratios on germination Rate
Example 2
Genetic transformation of explants
Putting agrobacterium LBA4404 with plant expression vector pCHF3-YFP into YEB culture solution for culture (50mg/L rifampicin and 50mg/L kanamycin), wherein the used YEB culture medium comprises 5g/L beef extract, 5g/L peptone, 1g/L yeast extract, 5g/L sucrose and 0.5g/L magnesium sulfate heptahydrate, and NaOH is adjusted to pH 7.0-7.5; to be OD 600 Centrifuging for 10min when the concentration reaches 0.6-0.8, discarding the supernatant, and resuspending to OD with the resuspension solution 600 Values of 0.3, 0.5, 0.7, respectively, infested the outside of the treatment of step 1The time of the explant is respectively 8min, 12min and 16min, the explant is gently shaken from time to time, the infected explant is drained, and is placed in a co-culture medium filled with sterile filter paper for dark culture for 2-3 d; the co-culture medium contains 100mg/L acetosyringone.
Adventitious bud induction culture: selecting cotyledon node explants for co-culture for 2-3 d; inoculating the cotyledon node to an adventitious bud induction culture medium, wherein the adventitious bud culture medium is an MS basal culture medium, and 1mg/L of 6-benzylaminopurine (6-BA) is added, the illumination intensity is 5000lx, the illumination is 16h/d, and the culture is carried out for 20 d; during the period, subculture is carried out for 1 time every 15 d;
the germination rate after agrobacterium transformation was counted and the optimal treatment conditions were determined, and the germination rate is shown in fig. 3. As can be seen in FIG. 3, at OD 600 The value is 0.5, and the highest germination rate is 28.57% under the condition that the infection time is 16 min.
Rooting culture: dividing the cluster buds subjected to subculture elongation in the step (5) into single plants, inoculating the single plants into a rooting culture medium, and performing rooting induction to obtain tartary buckwheat transgenic plants finally; the rooting culture medium MS culture medium is used as a basic culture medium, IBA1.5mg/L, the illumination intensity of 5000-6000lx and the illumination of 16h/d are added, and the culture time is 15-25 d.
Example 3
DNA extraction of transgenic plant, PCR amplification of screening marker gene and product sequencing
And (3) placing the seedlings obtained by rooting into a mortar by taking a proper amount of tartary buckwheat leaves, and adding liquid nitrogen for fully grinding. 400 μ L of buffer FP1 and 6 μ L of RNaseA (10mg/L) were added, vortexed for 1min, and allowed to stand at room temperature for 10 min. Add 130. mu.L of buffer FP2, mix well and vortex for 1 min. Centrifuge at 12000rpm (13400 Xg) for 5min and transfer the supernatant to a new centrifuge tube. 0.7 times volume of isopropanol is added into the supernatant, and the mixture is fully mixed, so that flocculent genomic DNA can appear. Centrifuge at 12000rpm (-13400 Xg) for 2min, discard the supernatant and retain the pellet. Add 600. mu.L of 70% ethanol, vortex for 5sec, centrifuge at 12000rpm (. about.13400 Xg) for 2min, and discard the supernatant. 600 μ L of 70% ethanol was added again, vortexed and centrifuged for 2min at 12000rpm (-13400 Xg), and the supernatant was discarded. Opening the cover and inverting, standing at room temperature for 5-10min, and air drying the residual ethanol completely. Adding a proper amount of elution buffer TE, dissolving DNA in water bath at 65 ℃ for 10-60min, and reversely and uniformly mixing for several times to aid dissolution to finally obtain a DNA solution. 2 mu LDNA electrophoresis is taken to check the quality of DNA, and the DNA is stored at the temperature of minus 20 ℃.
And performing PCR amplification by using the DNA sample of the obtained independent individual plant as a template and a primer designed by a screening marker eYFP.
An amplification primer: eYFP-F: CATCCTGGTCGAGCTGGACG
eYFP-R：GGTCTTGTAGTTGCCGTCGTC
Amplification conditions: pre-denaturation at 98 deg.C for 3min, denaturation at 98 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 20s, and final extension at 72 deg.C for 5min under 32-33 circulation.
Target fragment: 296bp of
The PCR products were run on agarose gel electrophoresis, and the electrophoresis pattern is shown in FIG. 4. As can be seen from the electrophoretogram, 3 strains were positive transformants, and the positive rate of the regenerated strain was 37.5%.
The alignment analysis of the PCR product sequencing result is shown in FIG. 5, and it can be seen from FIG. 5 that the sequencing result of the PCR product completely matches the eYFP gene sequence.
Example 4
Fluorescence observation of transgenic tartary buckwheat and wild tartary buckwheat leaves
Observing the converted tartary buckwheat leaves and wild tartary buckwheat leaves by using a laser confocal microscope,
under the excitation of eYFP channel (515nm), obvious fluorescence can be observed; the blank was non-fluorescent, see FIG. 6. The result shows that the transferred exogenous gene is integrated into the genome of the leaf of the tartary buckwheat.
As can be seen from FIG. 3, the germination rate of cotyledonary node after Agrobacterium infection under the optimal condition is 28.57%, as can be seen from FIG. 4, the positive rate of the regeneration strain is 37.5%, and the transgenic efficiency is 10.71%.
Comparative example 1
Genetic transformation is carried out by taking upper and lower embryonic axes of tartary buckwheat as explants, and the specific method comprises the following steps:
(1) preparation of sterile seedlings: inoculating the disinfected tartary buckwheat seeds into an MS culture medium for culture to obtain aseptic seedlings;
(2) preparing an explant: cutting the epicotyl and the hypocotyl of the aseptic seedling into small sections of 0.5cm by using an aseptic blade to obtain epicotyl and hypocotyl explants;
(3) and (3) culturing agrobacterium: (ii) a Putting agrobacterium LBA4404 with a plant expression vector pCHF3-YFP plasmid into YEB culture medium for culturing (50mg/L rifampicin and 50mg/L kanamycin), wherein the used YEB culture medium comprises 5g/L beef extract, 5g/L peptone, 1g/L yeast extract, 5g/L sucrose and 0.5g/L magnesium sulfate heptahydrate, and NaOH is adjusted to pH 7.0-7.5;
(4) infection and co-culture: to Agrobacterium OD 600 Centrifuging for 10min when the concentration reaches 0.6-0.8, discarding the supernatant, and resuspending to OD with the resuspension solution 600 The values are 0.3, 0.45 and 0.6 respectively, the time for infecting the explants processed in the step 2 is 10min, 20min and 30min respectively, the explants are gently shaken from time to time, the infected explants are dried by suction, and are placed into a co-culture medium padded with sterile filter paper for dark culture for 2-3 d; the co-culture medium contains 100mg/L acetosyringone to obtain co-culture epicotyl and hypocotyl explants;
(5) adventitious bud induction culture: inoculating the cocultured epicotyl and hypocotyl explants to an adventitious bud induction medium for culture, and subculturing once every 15 d.
The experimental results are as follows: the above hypocotyls and hypocotyls as explants only formed callus on shoot induction medium J1-J10, with no differentiated shoots all the time, as shown in FIG. 7.
Comparative example 2
Taking hairy roots of tartary buckwheat as explants to carry out genetic transformation, and the specific method comprises the following steps:
(1) preparation of sterile seedlings: inoculating the disinfected tartary buckwheat seeds into an MS culture medium for culture to obtain aseptic seedlings;
(2) and (3) culturing agrobacterium: putting Agrobacterium A4 with plant expression vector pCHF3-YFP plasmid into TY culture medium for culturing (50mg/L rifampicin and 50mg/L kanamycin), wherein the TY culture medium comprises peptone 5g/L, yeast extract 3g/L, and 1M sterile CaCl 2 10ml/L；
(3) Preparing an explant: pruning the aseptic seedling by using aseptic scissors, and reserving cotyledon and hypocotyl to obtain an explant;
(4) infection and co-culture: putting the explant into the agrobacterium rhizogenes infection solution for dip dyeing, sucking water from the infected explant, putting the explant into a co-culture medium for dark culture to obtain a co-culture explant;
(5) hairy root induction culture: inoculating the co-culture explant to a hairy root induction culture medium for culture, and subculturing once in 15 days to obtain a hairy root;
(6) cutting the hairy roots into small sections of 1.5-2cm, putting the small sections into a callus induction culture medium for culture, and putting 5 explants in each bottle;
the hormone formulations of the callus induction medium used are shown in the following table:
the experimental results are as follows: on L1-L8 callus induction medium with hairy roots as explants, a small amount of callus was formed at 20 days, and the differentiation speed was slow, as shown in FIG. 9.
The foregoing is illustrative of the preferred embodiments of this invention, and it is to be understood that the invention is not limited to the precise form disclosed herein and that various other combinations, modifications, and environments may be resorted to, falling within the scope of the concept as disclosed herein, either as described above or as apparent to those skilled in the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.
Claims (10)
1. A genetic transformation method of tartary buckwheat is characterized by comprising the following steps:
(1) preparation of sterile seedlings: inoculating the sterilized tartary buckwheat seeds into an MS culture medium for culture to obtain aseptic seedlings;
(2) and (3) culturing agrobacterium: inoculating agrobacterium to an agrobacterium activation culture medium for activation to obtain agrobacterium infection liquid;
(3) preparing an explant: the aseptic seedling is cut flatly at a position 2-5mm below the cotyledon joint by using an aseptic blade, and the hypocotyl area and true leaf part are removed to obtain a cotyledon node explant;
(4) infection and co-culture: putting the cotyledonary node explant into the agrobacterium infection solution for dip dyeing, sucking water from the infected explant, putting the explant into a co-culture medium for dark culture, and obtaining a co-culture cotyledonary node explant;
(5) adventitious bud induction culture: inoculating the co-cultured cotyledon node explant to an adventitious bud induction culture medium for culture to obtain a subculture cluster bud;
(6) rooting culture: dividing the subculture cluster buds into single plants, and inoculating the single plants to a rooting culture medium for culture to obtain the tartary buckwheat transgenic plants.
2. The genetic transformation method according to claim 1, characterized in that: in the step (1), the MS culture medium comprises the following components: 25-35g/L, MS g/4-5 g/L of sucrose and 6-8g/L of agar powder; adjusting the pH value of the MS culture medium to be 5.6-6.0, wherein the culture conditions are 20-25 ℃, the illumination intensity is 5000-.
3. The genetic transformation method according to claim 1, characterized in that: in the step (1), the specific method for sterilization comprises the steps of soaking the tartary buckwheat seeds in 70% alcohol for 30s, cleaning with sterile water for 2-3 times, sterilizing with 0.1% mercuric chloride for 8min, cleaning with sterile water for 6-8 times, and removing surface water.
4. The genetic transformation method according to claim 1, characterized in that: in the step (2), the agrobacterium is LBA 4404; the agrobacterium vector is pCHF 3-YFP; the components of the agrobacterium activating culture medium comprise 4-6g/L beef extract, 4-6g/L peptone, 0.5-2g/L yeast extract, 4-6g/L sucrose and 0.2-0.8g/L magnesium sulfate heptahydrate, and the pH value of the agrobacterium activating culture medium is adjusted to 7.0-7.5.
5. The genetic transformation method according to claim 1, characterized in that: in the step (2), the agrobacterium is prepared into agrobacterium liquid and then inoculated on an agrobacterium activation culture medium for activation, and the OD of the agrobacterium liquid 600 Is 0.4-0.6.
6. The genetic transformation method according to claim 1, characterized in that: in the step (4), the components of the co-culture medium comprise 25-35g/L, MS powder of sucrose and 4-5g/L, 6-8g/L of agar powder and 220mg/L of acetosyringone 180-; adjusting the pH value of the co-culture medium to 5.6-6.0, and culturing at 20-22 deg.C in dark for 2-3 d.
7. The genetic transformation method according to claim 1, characterized in that: in the step (5), the adventitious bud induction culture medium comprises 25-35g/L, MS of sucrose, 4-5g/L of agar powder, 6-8g/L of agar powder and 0.5-2.5mg/L of 6-benzylaminopurine; adjusting the pH value of the adventitious bud induction culture medium to be 5.6-6.0, wherein the culture condition is 20-25 ℃, the illumination intensity is 5000-.
8. The genetic transformation method according to claim 1, characterized in that: the adventitious bud induction culture medium also comprises 40-60mg/L kanamycin and 40-60mg/L timentin.
9. The genetic transformation method according to claim 1, characterized in that: in step (5), subculture was performed every 14 to 16 days during the period on the adventitious bud induction medium.
10. The genetic transformation method according to claim 1, characterized in that: in the step (6), the components of the rooting culture medium comprise 25-35g/L, MS of sucrose and 4-5g/L of agar powder, 6-8g/L of agar powder and 1-2mg/L of indolebutyric acid; adjusting the pH value of the rooting medium to 5.6-6.0, wherein the culture conditions are 20-25 ℃, the illumination intensity is 5000-6000lx, the illumination time is 14-16h/d, and the culture time is 15-25 d.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210646308.8A CN115005099B (en) | 2022-06-09 | 2022-06-09 | Genetic transformation method of tartary buckwheat |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210646308.8A CN115005099B (en) | 2022-06-09 | 2022-06-09 | Genetic transformation method of tartary buckwheat |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115005099A true CN115005099A (en) | 2022-09-06 |
| CN115005099B CN115005099B (en) | 2023-05-12 |
Family
ID=83072598
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210646308.8A Active CN115005099B (en) | 2022-06-09 | 2022-06-09 | Genetic transformation method of tartary buckwheat |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115005099B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5416011A (en) * | 1988-07-22 | 1995-05-16 | Monsanto Company | Method for soybean transformation and regeneration |
| CN102352378A (en) * | 2011-10-23 | 2012-02-15 | 成都大学 | Genetic transformation method of tartary buckwheat lamina |
| CN103468739A (en) * | 2013-09-27 | 2013-12-25 | 河南农业大学 | Method for agrobacterium tumefaciens-mediated genetic transformation of dried radix rehmanniae |
| CN106047924A (en) * | 2016-06-15 | 2016-10-26 | 中国农业科学院生物技术研究所 | Method for inducing and quickly propagating hairy roots of tartary buckwheat |
| CN109837298A (en) * | 2019-04-08 | 2019-06-04 | 辽宁省农业科学院 | A kind of degeneration-resistant genetic conversion system of sweet cherry roots and its construction method |
-
2022
- 2022-06-09 CN CN202210646308.8A patent/CN115005099B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5416011A (en) * | 1988-07-22 | 1995-05-16 | Monsanto Company | Method for soybean transformation and regeneration |
| CN102352378A (en) * | 2011-10-23 | 2012-02-15 | 成都大学 | Genetic transformation method of tartary buckwheat lamina |
| CN103468739A (en) * | 2013-09-27 | 2013-12-25 | 河南农业大学 | Method for agrobacterium tumefaciens-mediated genetic transformation of dried radix rehmanniae |
| CN106047924A (en) * | 2016-06-15 | 2016-10-26 | 中国农业科学院生物技术研究所 | Method for inducing and quickly propagating hairy roots of tartary buckwheat |
| CN109837298A (en) * | 2019-04-08 | 2019-06-04 | 辽宁省农业科学院 | A kind of degeneration-resistant genetic conversion system of sweet cherry roots and its construction method |
Non-Patent Citations (3)
| Title |
|---|
| 金红等: "发根农杆菌A4对荞麦的遗传转化", 《西北大学学报(自然科学版)》 * |
| 陈利红等: "AtNHX1基因对荞麦的遗传转化及抗盐再生植株的获得", 《生物工程学报》 * |
| 黄凤兰等: "荞麦子叶节再生体系的建立", 《内蒙古农业科技》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115005099B (en) | 2023-05-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10006036B2 (en) | Methods for producing transgenic plants | |
| Yu et al. | Effects of carbenicillin and cefotaxime on callus growth and somatic embryogenesis from adventitious roots of papaya | |
| CN109937879B (en) | Induction method of warm yam transgenic hairy roots | |
| CN1352522A (en) | Method for superrapid transformation of monocotyledon | |
| CN116103337B (en) | Agrobacterium-mediated passion flower genetic transformation method | |
| CN107022561B (en) | Culture medium and culture method for cultivating transgenic corn | |
| CN107475287B (en) | Eggplant genetic transformation method | |
| CN111820128A (en) | Method for establishing dendrobium nobile genetic transformation system | |
| AU744496B2 (en) | Method of genetically transforming banana plants | |
| CN107012162B (en) | Agrobacterium-mediated cotton embryo tip rapid transformation method | |
| CN115005099B (en) | Genetic transformation method of tartary buckwheat | |
| CN113755521B (en) | Construction method of agrobacterium-mediated strawberry 'sweet Charles' genetic transformation system | |
| CN113637701B (en) | Method for establishing wild rice genetic transformation system | |
| CN112708634B (en) | Agrobacterium-mediated peanut rapid genetic transformation method | |
| CN110951776B (en) | Agrobacterium-mediated pepper genetic transformation method | |
| Hu et al. | Shoot Regeneration from Cultured Leaf Explants of Lycium barbarumand Agrobacterium-Mediated Transformation1 | |
| CN110024693B (en) | Tissue culture and rapid propagation method by utilizing stem tip meristem of coix lacryma-jobi | |
| Delis et al. | Differentiation of adventitious buds from Capsicum annuum L. hypocotyls after co-culture | |
| CN109845644B (en) | Method for removing pseudostellaria heterophylla fava bean wilting virus by using micro-stem tip and ultralow temperature | |
| CN111690679A (en) | Recombinant expression vector for cultivating cucumber male sterile line and construction method and application thereof | |
| CN110699377A (en) | Peanut transgenic method | |
| CN113234754B (en) | Efficient genetic transformation method taking abelmoschus manihot embryo as explant | |
| CN114410678B (en) | Method for establishing agrobacterium-mediated Chinese narcissus efficient genetic transformation system | |
| CN115581201A (en) | Diploid rose F induced by stem segment as explant 1 -61 plant regeneration method | |
| CN116515898A (en) | Agrobacterium-mediated genetic transformation method for red-bolt cabbage mustard |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |