CN114994310A - Biological nanopore detection method based on 3D DNA walker sensing and application of biological nanopore detection method in MUC1 detection - Google Patents
Biological nanopore detection method based on 3D DNA walker sensing and application of biological nanopore detection method in MUC1 detection Download PDFInfo
- Publication number
- CN114994310A CN114994310A CN202210587001.5A CN202210587001A CN114994310A CN 114994310 A CN114994310 A CN 114994310A CN 202210587001 A CN202210587001 A CN 202210587001A CN 114994310 A CN114994310 A CN 114994310A
- Authority
- CN
- China
- Prior art keywords
- muc1
- dna
- walker
- detection
- nanopore
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
- G01N33/54326—Magnetic particles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/483—Physical analysis of biological material
- G01N33/487—Physical analysis of biological material of liquid biological material
- G01N33/48707—Physical analysis of biological material of liquid biological material by electrical means
- G01N33/48721—Investigating individual macromolecules, e.g. by translocation through nanopores
Abstract
The invention provides a 3D DNA walker sensing-based biological nanopore detection method and application thereof in MUC1 detection. The detection method comprises the following steps: zn with terminal biotin 2+ Hybridizing the DNAzyme walking chain with the aptamer of the test object, and then fixing the hybrid with the biotin-modified hairpin substrate chain to Fe 3 O 4 On the particles, Zn is released when the analyte specifically interacts with the aptamer of the analyte 2+ DNAzymes in Zn 2+ Cleaving the hairpin substrate strand in the presence of the cleavage site to release the substrate strand DNA fragment; separation of Fe by magnet 3 O 4 After the particles are granulated, the released DNA fragments are detected through an alpha-HL biological nanopore so as to obtain the concentration of the substance to be detected. The biological nanopore detection method based on 3D DNA Walker sensing provided by the invention utilizes the characteristic that a 3D DNA Walker nano probe amplifies signals, is combined with biological nanopore detection, and can realize detection of biological nanoporesThe sensitivity and the signal-to-noise ratio of nanopore detection are greatly improved, and the minimum detection amount of MUC1 can reach 0.01 nM.
Description
Technical Field
The invention relates to the field of molecular biology and nucleic acid chemistry, in particular to a biological nanopore detection method based on 3D DNA walker sensing and application thereof in MUC1 detection.
Background
Biological nanopore single molecule detection is a emerging detection technology formed by cross fusion of multiple disciplines such as nanometer, biological, chemical and electronic information. alpha-Hemolysin (alpha-Hemolysin, alpha-HL) is a water-soluble protein monomer secreted by Staphylococcus aureus (Staphylococcus aureus) and having a molecular weight of 33.2kD, a mushroom-type heptamer protein nanopore having a molecular weight of 232.4kD can be assembled on a phospholipid bilayer, the total length of the pore is about 10nm, the nanopore is stable in structure, can be completely loaded in a double-layer lipid membrane without leakage of electricity, and is an ideal nanopore detection device. The alpha-HL nano-pore is divided into three areas of cap, cis and stem in the geometric structure, protein modification is carried out on different parts according to the molecular structure or the atomic map, protein nano-tubes with various performances can be designed and manufactured, so that the influence of space effect, charge effect and the like on the action of a channel and different detection substances is researched, and the real-time detection of different analytes on the single molecular level is realized. The analytes may include: inorganic ions, organic molecules, single stranded DNA/RNA, proteins, and the like.
However, the sensitivity and specificity of detection for some specific small molecule substances are limited, and how to amplify signals to improve the sensitivity and specificity of detection becomes a difficult problem for those skilled in the art to try to overcome.
In addition, breast cancer is the second leading disease of cancer deaths in women worldwide, with an estimated annual number of deaths of 626,279, second only to lung cancer. Early diagnosis is of great significance in breast cancer treatment and is a key factor for improving survival rate. Epithelial mucin 1 (epithalial mucin-1, muc1) is a membrane glycoprotein that is overexpressed in 90% of breast cancers and is a potent marker of breast cancer. The MUC1 detection documents reported at present mainly comprise enzyme-linked immunosorbent assay, surface enhanced Raman analysis, fluorescence analysis and electrochemical analysis. However, the existing method still has the defects of low sensitivity, low selectivity and high detection cost. Therefore, the development of MUC1 detection method with high sensitivity, good selectivity, mild reaction conditions and high cost effectiveness is urgent.
Disclosure of Invention
In view of this, in order to overcome the defects of the prior art, the invention provides a 3D DNA Walker sensing-based biological nanopore detection method and application thereof in MUC1 detection, wherein the method utilizes the characteristic that a 3D DNA Walker nanoprobe amplifies signals, is combined with biological nanopore detection, and can greatly improve the sensitivity and signal-to-noise ratio of nanopore detection.
The invention provides a biological nanopore detection method based on 3D DNA walker sensing, which comprises the following steps:
1) zn with terminal biotin 2+ -DNAzyme walking chain and test substance aptamer are hybridized, then fixed with biotin-modified hairpin substrate chain at Fe 3 O 4 On the particles;
2) the analyte and the aptamer of the analyte specifically interact to release Zn 2+ DNAzymes in Zn 2+ Cleaving the hairpin substrate strand in the presence of the cleavage site to release the substrate strand DNA fragment;
3) separation of Fe by magnet 3 O 4 A particle;
4) detecting a DNA fragment via hole signal by the released DNA fragment through the alpha-HL biological nanopore;
5) and obtaining the concentration of the substance to be detected.
The invention provides an application of a 3D DNA walker sensing-based biological nanopore detection method in MUC1 detection, which comprises the following steps:
A. zn with terminal biotin 2+ -DNAzyme walking strand and MUC1 aptamer hybridization, followed by immobilization of the same to biotin-modified hairpin substrate strands in Fe 3 O 4 On the surface of the particles,obtaining a 3D DNA walker nano probe;
B. the MUC1 to be detected and MUC1 aptamer in the 3D DNA walker nanoprobe interact specifically to release Zn 2+ DNAzymes in Zn 2+ Cleaving the hairpin substrate strand in the presence of the cleavage site to release the substrate strand DNA fragment;
C. separation of Fe by magnet 3 O 4 Particles;
D. detecting a DNA fragment via hole signal by the released DNA fragment through the alpha-HL biological nanopore;
E. MUC1 concentrations were obtained.
Further, the MUC1 aptamer is shown as SEQ No. 1; said Zn 2+ The DNAzyme walking chain is shown as SEQ No. 2; the biotin-modified hairpin substrate chain is shown as SEQ No. 3.
SEQ No.1：
GCAGTTGATCCTTTGGATACCCTGG；
SEQ No.2：
Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAGGGTATCCAAAGGATCTTCTCCGAGCCGGTCGAAATAGT；
SEQ No.3：
Biotin-TTTTTTTTTTTTGACGACGCGTCATCAAAGCTCATACTATrAGAAGAGACTGCCCTTATTACGCGTCGTC。
Further, the step A of preparing the 3D DNA walker nanoprobe comprises the following steps:
a.1 to obtain a stable hairpin structure, the hairpin substrate is heated at 95 ℃ for 10min and then gradually cooled to room temperature;
a.2, mixing a DNAzyme walking chain with an aptamer chain, and incubating for 2h in Tris-HCl buffer solution at 37 ℃ to obtain a double-stranded structure with the aptamer and the walking chain complementary;
a.3 adding Fe to the substrate chain and the pre-prepared aptamer walking chain respectively 3 O 4 Carrying out medium oscillation for 16 h; finally, free DNA was removed with a magnet and resuspended in Tris-HCl.
Further, the molar ratio of mixing the DNAzyme walking chain and the aptamer chain is 1: 1.2.
Further, the step B: MUC1 to be detected and the 3D DNA walker nanoprobeMUC1 aptamer-specific interactions to release Zn 2+ DNAzymes in Zn 2+ Cleavage of the hairpin substrate strand in the presence of a cleavage, hydrolytic cleavage at the scissors rA; the hairpin substrate strand is divided into two segments, remote from Fe 3 O 4 The DNA at the end is released.
Further, the DNA fragment to be detected is shown as SEQ No. 4.
SEQ No.4：GAAGAGACTGCCCTTATTACGCGTCGTC。
Further, the preparation of the alpha-HL biological nanopore comprises the following steps:
forming a DPhPC double-layer membrane of the diphytanoylphosphatidylcholine in the peek tube; the phospholipid double-layer membrane is divided into a cis-form cavity and a trans-form cavity; adding Tris-HCl conductive buffer solution containing KCl to two sides of the chamber; measuring the ionic current through the nanopore with an Ag/AgCl electrode; the alpha-hemolysin protein is injected near the cis-luminal pore, and the insertion of the alpha-HL biological nanopore is determined by a clear jump of the current value.
Further, detecting a DNA fragment via signal through the α -HL biological nanopore comprises the steps of:
adding a DNA solution to be detected into the cis-cavity; the channel current was measured by a patch-clamp amplifier Axon 200B equipped with a Digidata 1440A a/D converter; the signal is filtered at 5 kz.
Further, the numerical analysis and graphical representation of all current measurement data were analyzed using a Clampfit software and an origin 9.0 software, obtaining the average residence time values and average interval time values from the histograms formed by the analysis, and fitting the interval histograms to a single exponential function; the standard deviation I of the tapping current is obtained by carrying out Gaussian function fitting on the single-channel current baseline histogram 0 (ii) a Obtaining average signal amplitude and current blocking rate delta I/I from signal amplitude 0 。
The invention firstly prepares Zn with terminal biotin 2+ -DNAzyme walking strand and MUC1 aptamer hybridization, followed by immobilization of the same to biotin-modified hairpin substrate strands in Fe 3 O 4 On the pellets, and then MUC1 was added to the system. Due to the specific interaction of MUC1 with the aptamerReleasing Zn 2+ DNAzyme, then in Zn 2+ In the presence of DNAzyme, the hairpin substrate strand is cleaved, releasing the DNA fragment. By means of magnets holding Fe 3 O 4 The particles are separated and free DNA fragments are detected by nanopore technology.
The invention provides a method for detecting MUC1 based on a 3D DNA walker sensing biological nanopore. By means of Fe 3 O 4 Combining the MUC1 aptamer hybridized with the DNAzyme walking chain and the hairpin substrate chain to construct a nanoprobe to realize a signal amplification strategy. In the presence of MUC1 target, MUC1 bound to the aptamer, releasing the DNAzyme walking chain. In Zn 2+ In the presence of the DNA zyme, the walking chain cleaves the hairpin substrate chain, releasing free DNA. And detecting a via hole signal generated by the released DNA fragment through the alpha-HL nano hole. Thus, a set of sensing system with high sensitivity and high specificity is established.
Compared with the prior art, the invention has the beneficial effects that:
1. the biological nanopore detection method based on 3D DNA Walker sensing provided by the invention utilizes the characteristic that a 3D DNA Walker nano probe amplifies signals, is combined with biological nanopore detection, and can greatly improve the sensitivity and signal-to-noise ratio of nanopore detection. The minimum detection amount can reach 0.01 nM.
2. The novel method for detecting the single-molecule nanopore MUC1 based on the 3D DNA Walker nanoprobe is simple in sample preparation, convenient and fast to operate, low in cost and good in application prospect. Particularly, in the aspect of detection evaluation and treatment of MUC1 in human blood at present, the development of a convenient, low-cost and high-sensitivity detection means and method for controlling human health is urgently needed. The method provides a set of evaluation method for medical early diagnosis, and has wide application prospect.
Description of the drawings:
in order to more clearly illustrate the embodiments of the present invention, the drawings used in the description of the embodiments or the prior art will be briefly described below. It is clear that the drawings described below are embodiments of the invention, and that for a person skilled in the art, other drawings can be derived from them without inventive effort.
FIG. 1 is a schematic diagram of the principle of the 3D DNA Walker sensing-based biological nanopore detection MUC1 of the invention;
FIG. 2 is a single-channel current trace of MUC1 at different concentrations, with MUC1 concentrations ranging from 0.01-100nM (top to bottom);
FIG. 3 analysis of the linear relationship of MUC1 protein concentration to event frequency (data obtained at an applied voltage of 1M KCl +130 mV);
fig. 4 current traces of serum samples (left) and serum samples containing MUC1 (right).
The specific implementation mode is as follows:
in order to make the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the following description of the embodiments of the present invention with reference to the accompanying drawings is provided for a clear and complete description of the embodiments of the present invention. It is to be understood that the embodiments described are some, and not all embodiments of the invention. All other embodiments obtained by a person skilled in the art based on the examples of the present invention without any inventive step are within the scope of the present invention.
Example 1: construction of nanopore biosensors
1) Forming a phospholipid bilayer membrane:
preparing a solution A: mixing phospholipid 25mg with 2.5mL pentane;
50mL of ionic buffer required for the preparation of the experiment: 1M KCl, 10mM Tris (pH 7.5), filtered through 0.45M filter.
Solution A, which occupies 1. mu.L of the solution prepared by the tip, is dropped on the detection cell peek tube near the micron hole. After the configured solution A is volatilized, adding a small amount of ionic buffer solution into the cis compartment and the trans compartment respectively by using a liquid moving machine, and inserting a pair of Ag/Ag Cl electrodes connected with the patch clamp system into the ionic buffer solution of the cis compartment and the trans compartment respectively.
Observing whether a phospholipid bilayer membrane is formed or not, and if so, carrying out subsequent experiments; if not, the ionic buffer solution is gently and repeatedly pipetted from the well several times until a phospholipid bilayer membrane is formed. In the process of forming the phospholipid bilayer membrane, the formation quality is judged through membrane capacitance detection in a patch clamp system, and the mechanical strength of the phospholipid bilayer is inspected by utilizing membrane voltage.
2) Forming alpha-HL biological nanopore biosensors
In a peek tube, a layer of phospholipid bilayer molecules was formed in an orifice of approximately 100 μm in diameter, which divided into cis and trans chambers. Approximately 100. mu.L of a conducting buffer (1M KCl and 10mM Tris-HCl) was added to each side of the chamber. A pair of Ag/AgCl electrodes was used to connect the cis and trans nanopores. Self-assembled transmembrane heptameric protein channel with alpha-hemolysin protein (0.01-0.1ng/mL) added in cis. The current is amplified and measured by a patch clamp amplifier (Axon 200B) connected to a Digidata 1440A a/D converter, and the signal is filtered at 5 kHz.
Example 2: performance testing of alpha-HL biological nanopore biosensor
The performance of the nanopore biosensor is optimized and tested according to analysis parameters such as electrolyte, working voltage, Gaussian distribution, linear range, detection limit, blocking amplitude, blocking time and the like.
Example 3: preparation of 3D DNA Walker nanoprobe
To obtain a stable hairpin structure, 10. mu.M of hairpin substrate was heated at 95 ℃ for 10min and then gradually cooled to room temperature. 40 μ L of Zn 2+ -DNAzyme walking chain (10. mu.M) and 48. mu.L MUC1 aptamer (10. mu.M) were incubated in Tris-HCl buffer at 37 ℃ for 2h to obtain aptamer and walking chain complementary double-stranded structure; zn 2+ -DNAzyme running strand to aptamer strand mix molar ratio 1:1.2, Zn 2+ The DNAzyme strand is completely blocked by the aptamer strand. Then, 100. mu.L of hairpin substrate (20. mu.M) and 24. mu.L of pre-prepared aptamer walking chain (4.5. mu.M) were added to 1mg/mL streptavidin-modified Fe 3 O 4 And medium oscillation is carried out for 16 h. Finally, adsorbing Fe with a magnet 3 O 4 To remove free DNA, and then resuspend in Tris-HCl to obtain the 3D DNA Walker nanoprobe.
Example 4: cleavage of hairpin substrate strands
Prepared 3D DNA walker nanoprobe (1nM) and concentration to be detectedThe MUC1 of (1) was incubated in Tris-HCl buffer at 37 ℃ for 1 h. MUC1 and MUC1 aptamer in 3D DNA walker nano probe specifically interact to release Zn 2+ DNAzyme in the absence of Zn 2+ In this case, the DNAzyme is not activated and thus the hairpin substrate strand cannot be cleaved. And in Zn 2+ DNAzymes catalyze the hydrolytic cleavage of the hairpin substrate strand at the cleaved state rA in the presence of (20. mu.M). The hairpin substrate strand is divided into two fragments. Removing Fe by magnetic separation 3 O 4 One fragment was ligated and the DNA of the other fragment was detected using an alpha-HL bio-nanopore.
Example 5: nanopore indirect detection of MUC1
The aptamer in the 3D DNA Walker nanoprobe blocked the DNAzyme walking strand without MUC1 without cleaving the biotin-modified hairpin substrate, and thus the DNA fragment could not be released. No blocking current was observed in the laboratory with the application of 130 mV. In the presence of the target MUC1, when the aptamer binds to MUC1, the DNAzyme walking strand is cleaved and cleaves the biotin-modified hairpin substrate, and the released DNA fragment generates a blocking signal when tested with the α -HL biomicropore. To evaluate the sensitivity of nanopore sensors, the inventors examined the sensitivity of MUC1 at different concentrations under optimal conditions, testing the change in frequency of events caused by proteins, as shown in fig. 2, 3.
Example 6: nanopore electrographic and data analysis
A DPhPC bilayer film with a diameter of 100 μm was formed inside the peek tube. The lipid bilayer is divided into cis and trans compartments. Approximately 100. mu.L of 1M KCl and 10mM Tris-HCl buffer was added to each side of the two chambers. The ionic current through the nanopore was measured with an Ag/AgCl electrode. Alpha-hemolysin protein (0.01-0.1ng/mL) was injected near the cis-luminal pore and pore insertion was determined by a clear jump in current values. Once a stable single-well insertion is detected, the test DNA solution is added to the cis cavity. The channel current was measured by a patch clamp amplifier (Axon 200B) equipped with a Digidata 1440A a/D converter (Molecular Devices, Sunnyvale, USA). The signal is filtered at 5 kz. Clampfi was used for numerical analysis and graphical representation of all recorded datat software (Molecular Devices, Sunnyvale, USA) and origin 9.0 software. Average dwell time values and average interval time values are obtained from the histogram and the interval histogram is fitted to a single exponential function. The standard deviation I of the tapping current is obtained by carrying out Gaussian function fitting on the single-channel current baseline histogram 0 . Obtaining an average signal amplitude and a current blocking ratio (Δ I/I) from the signal amplitude 0 )。
Example 7: specificity verification of MUC1 with aptamers
In addition to sensitivity, the specificity of MUC1 with aptamers was verified. When BSA, CEA, PSA and thrombin with the concentration of 1nM are added to MUC1 with the concentration of 0.1nM respectively for detection comparison, the result shows that the specificity of MUC1 detection is not affected by other proteins.
Example 8: actual sample detection
In order to further evaluate the applicability of the method of the present invention in the analysis of real biological samples, the inventors have tested human serum of target samples with the method. Currently, the original serum samples produced current signals with low levels of noise-like peaks, but the addition of MUC1(0.1nM) produced a large number of specific characteristic peaks that could be readily distinguished from each other. (as shown in FIG. 4)
In conclusion, the novel 3D DNA Walker nanoprobe provided by the invention realizes the aim of indirectly detecting MUC1 by using the specific interaction of MUC1 and an aptamer. The method utilizes the characteristic that the 3D DNA Walker nano probe amplifies signals, compared with the method for simply detecting MUC1, the method can greatly improve the sensitivity and the signal-to-noise ratio of nanopore detection, the lower limit of detection can reach 0.01nM, and the method is better than the previously published result of detecting MUC1 by other methods.
It should be noted that the above-described embodiments may enable those skilled in the art to more fully understand the present invention, but do not limit the present invention in any way. Therefore, although the present invention has been described in detail with reference to the drawings and examples, it will be understood by those skilled in the art that the present invention may be modified and equally replaced without departing from the spirit and scope of the present invention, which should be covered by the appended claims.
Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.
SEQUENCE LISTING
<110> Chongqing Green Intelligent technology research institute of Chinese academy of sciences
<120> a 3D DNA-based DNA
Walker sensing biological nanopore detection method and application thereof in MUC1 detection
<130> preparation method and application of electrochemical luminescence aptamer sensor for detecting tumor marker MUC1
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 25
<212> DNA
<213> Artificial sequence
<400> 1
gcagttgatc ctttggatac cctgg 25
<210> 2
<211> 84
<212> DNA
<213> Artificial sequence
<400> 2
tttttttttt tttttttttt tttttttttt tttttttttt ttccagggta tccaaaggat 60
cttctccgag ccggtcgaaa tagt 84
<210> 3
<211> 70
<212> DNA
<213> Artificial sequence
<400> 3
tttttttttt ttgacgacgc gtcatcaaag ctcatactat ragaagagac tgcccttatt 60
acgcgtcgtc 70
<210> 4
<211> 28
<212> DNA
<213> Artificial sequence
<400> 4
gaagagactg cccttattac gcgtcgtc 28
Claims (10)
1. A3D DNA walker sensing-based biological nanopore detection method is characterized by comprising the following steps:
1) zn with terminal biotin 2+ Hybridizing the DNAzyme walking chain with the aptamer of the test object, and then fixing the hybrid with the biotin-modified hairpin substrate chain to Fe 3 O 4 On the particles;
2) the analyte and the aptamer of the analyte specifically interact to release Zn 2+ DNAzymes in Zn 2+ Cleaving the hairpin substrate strand in the presence of the cleavage site to release the substrate strand DNA fragment;
3) separation of Fe by magnet 3 O 4 A particle;
4) detecting a DNA fragment via hole signal by the released DNA fragment through the alpha-HL biological nanopore;
5) and obtaining the concentration of the substance to be detected.
2. The use of the 3D DNA walker sensing-based bio-nanopore detection method according to claim 1 in MUC1 detection, characterized in that said use comprises the steps of:
A. zn with terminal biotin 2+ -DNAzyme walking strand and MUC1 aptamer hybridization, followed by immobilization of the same to biotin-modified hairpin substrate strands in Fe 3 O 4 Obtaining a 3D DNA walker nano probe on the particles;
B. the MUC1 to be detected and MUC1 aptamer in the 3D DNA walker nanoprobe interact specifically to release Zn 2+ DNAzyme in Zn 2+ Cleaving the hairpin substrate strand in the presence of the cleavage site to release the substrate strand DNA fragment;
C. by means of magnetsSeparation of Fe 3 O 4 Particles;
D. detecting a DNA fragment via hole signal by the released DNA fragment through the alpha-HL biological nanopore;
E. MUC1 concentrations were obtained.
3. The use of the 3D DNA walker sensing-based bio-nanopore detection method according to claim 2 in MUC1 detection, wherein the MUC1 aptamer is represented as SEQ No. 1; said Zn 2+ The DNAzyme walking chain is shown as SEQ No. 2; the biotin-modified hairpin substrate chain is shown in SEQ No. 3.
4. The use of the 3D walker sensing-based bio-nanopore detection method according to claim 2 in MUC1 detection, wherein the step A of preparing the 3D DNA walker nanoprobe comprises the steps of:
a.1 to obtain a stable hairpin structure, the hairpin substrate is heated at 95 ℃ for 10min and then gradually cooled to room temperature;
a.2, mixing a DNAzyme walking chain with an aptamer chain, and incubating for 2h in a Tris-HCl buffer solution at 37 ℃ to obtain a double-chain structure with the aptamer and the walking chain being complementary;
a.3 adding Fe to the substrate chain and the pre-prepared aptamer walking chain respectively 3 O 4 Carrying out medium oscillation for 16 h; finally, free DNA was removed with a magnet and resuspended in Tris-HCl.
5. The use of the 3D walker sensing-based bio-nanopore detection method in the MUC1 detection according to claim 4, wherein the DNAzyme walking strand and the aptamer strand are mixed at a molar ratio of 1: 1.2.
6. The use of the 3D walker sensing-based bio-nanopore detection method according to claim 2 in MUC1 detection, wherein said step B: the MUC1 to be detected specifically interacts with MUC1 aptamer in the 3D DNA walker nanoprobe to release Zn 2+ DNAzymes in Zn 2+ Cleaving the hairpin substrate strand in the presence ofCutting, and hydrolyzing and cracking at the position of the scissor-shaped rA; the hairpin substrate strand is divided into two segments, remote from Fe 3 O 4 The DNA at the end is released.
7. The application of the 3D walker sensing-based biological nanopore detection method in MUC1 detection according to claim 2, wherein the DNA fragment to be detected is shown in SEQ No. 4.
8. The use of the 3D walker sensing-based bio-nanopore detection method according to claim 2 in MUC1 detection, wherein said α -HL bio-nanopore is prepared by the steps of:
forming a DPhPC double-layer membrane of the phosphatidylcholine diphytalid in the peek tube; the phospholipid double-layer membrane is divided into a cis-form cavity and a trans-form cavity; adding Tris-HCl conductive buffer solution containing KCl to two sides of the chamber; measuring the ionic current through the nanopore with an Ag/AgCl electrode; alpha-hemolysin protein was injected near the cis-luminal pore, and the insertion of the alpha-HL biomicropore was determined by a clear jump in current value.
9. The application of the 3D walker sensing-based bio-nanopore detection method in MUC1 detection according to claim 8, wherein the detection of DNA fragment via signals through the α -HL bio-nanopore comprises the steps of:
adding a DNA solution to be detected into the cis-cavity; the channel current was measured by a patch-clamp amplifier Axon 200B equipped with a Digidata 1440A a/D converter; the signal is filtered at 5 kz.
10. The use of the 3D walker sensing-based bio-nanopore detection method in MUC1 detection according to claim 9, wherein all the numerical analysis and graphical representations of the current measurement data are analyzed using a campfit software and an origin 9.0 software, and the mean residence time value and the mean interval time value are obtained from the histograms formed by the analysis, and the interval histograms are fitted to a single exponential function; by fitting a Gaussian function to a single channel current baseline histogramObtaining the standard deviation I of the tapping current 0 (ii) a Obtaining average signal amplitude and current blocking rate delta I/I from signal amplitude 0 。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210587001.5A CN114994310A (en) | 2022-05-26 | 2022-05-26 | Biological nanopore detection method based on 3D DNA walker sensing and application of biological nanopore detection method in MUC1 detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210587001.5A CN114994310A (en) | 2022-05-26 | 2022-05-26 | Biological nanopore detection method based on 3D DNA walker sensing and application of biological nanopore detection method in MUC1 detection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114994310A true CN114994310A (en) | 2022-09-02 |
Family
ID=83028786
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210587001.5A Pending CN114994310A (en) | 2022-05-26 | 2022-05-26 | Biological nanopore detection method based on 3D DNA walker sensing and application of biological nanopore detection method in MUC1 detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114994310A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116144770A (en) * | 2022-10-18 | 2023-05-23 | 湖南工程学院 | Probe set and method for detecting breast cancer circulating tumor nucleic acid based on DNA walker and branched-chain hybridization chain reaction |
-
2022
- 2022-05-26 CN CN202210587001.5A patent/CN114994310A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116144770A (en) * | 2022-10-18 | 2023-05-23 | 湖南工程学院 | Probe set and method for detecting breast cancer circulating tumor nucleic acid based on DNA walker and branched-chain hybridization chain reaction |
| CN116144770B (en) * | 2022-10-18 | 2023-12-15 | 湖南工程学院 | Probe set and method for detecting breast cancer circulating tumor nucleic acid based on DNA walker and branched-chain hybridization chain reaction |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | Precise capture and direct quantification of tumor exosomes via a highly efficient dual-aptamer recognition-assisted ratiometric immobilization-free electrochemical strategy | |
| Xue et al. | Solid-state nanopore sensors | |
| Tang et al. | Nanopore-based strategy for selective detection of single carcinoembryonic antigen (CEA) molecules | |
| Wu et al. | Aptamer-based detection of circulating targets for precision medicine | |
| Yin et al. | Aptamer recognition-trigged label-free homogeneous electrochemical strategy for an ultrasensitive cancer-derived exosome assay | |
| de la Escosura-Muñiz et al. | Nanochannels for diagnostic of thrombin-related diseases in human blood | |
| Wang et al. | 3D DNA walker-assisted CRISPR/Cas12a trans-cleavage for ultrasensitive electrochemiluminescence detection of miRNA-141 | |
| Xi et al. | Ultrasensitive detection of cancer cells combining enzymatic signal amplification with an aerolysin nanopore | |
| Matsumoto et al. | Current and emerging challenges of field effect transistor based bio-sensing | |
| Gu et al. | Single molecule sensing by nanopores and nanopore devices | |
| Zhu et al. | A label-free electrochemical aptasensor based on magnetic biocomposites with Pb2+-dependent DNAzyme for the detection of thrombin | |
| Xu et al. | An electrochemical biosensor based on nucleic acids enzyme and nanochannels for detecting copper (II) ion | |
| Wu et al. | The application of single molecule nanopore sensing for quantitative analysis | |
| Wang et al. | Electrochemical detection of thrombin based on aptamer and ferrocenylhexanethiol loaded silica nanocapsules | |
| Zhao et al. | A sensitive electrochemical aptasensor for Mucin 1 detection based on catalytic hairpin assembly coupled with PtPdNPs peroxidase-like activity | |
| Miao et al. | A multipedal DNA walker for amplified detection of tumor exosomes | |
| CN108802142B (en) | Method for detecting thrombin by using electrochemical biosensor based on magnetic biological composite material and lead ion dependent DNA enzyme | |
| Xu et al. | Aptamer biosensor for dopamine based on a gold electrode modified with carbon nanoparticles and thionine labeled gold nanoparticles as probe | |
| US20230220451A1 (en) | Analyte detection method | |
| Ren et al. | Single‐Molecule Binding Assay Using Nanopores and Dimeric NP Conjugates | |
| Zhang et al. | Chemically functionalized conical PET nanopore for protein detection at the single-molecule level | |
| Fang et al. | Unambiguous discrimination of multiple protein biomarkers by nanopore sensing with double-stranded DNA-based probes | |
| Wu et al. | Low-noise solid-state nanopore enhancing direct label-free analysis for small dimensional assemblies induced by specific molecular binding | |
| Chen et al. | A multifunctional label-free electrochemical impedance biosensor for Hg2+, adenosine triphosphate and thrombin | |
| Hua et al. | Quantum dots as immobilized substrate for electrochemical detection of cocaine based on conformational switching of aptamer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |