CN114990211A - Application of hsa _ circRNA _092369 and early-born infant retinopathy diagnostic reagent - Google Patents

Abstract

The invention relates to the technical field of medicines, in particular to application of hsa _ circRNA _092369 as retinopathy of prematurity. The research proves that the level of hsa _ circRNA _092369 of the patient with retinopathy of prematurity is reduced, and the level is obviously different from that of a normal control, so that the biomarker can be clinically used as a biomarker for diagnosing retinopathy of prematurity for diagnosing and differentially diagnosing the patient with retinopathy of prematurity. Also, downregulating hsa _ circRNA _092369 levels can construct a model for retinopathy of prematurity.

Description

Application of hsa _ circRNA _092369 and early-born infant retinopathy diagnostic reagent

Technical Field

The invention relates to the technical field of medicines, in particular to an application of hsa _ circRNA _092369 and an early childbirth retinopathy diagnostic reagent.

Background

Retinopathy of prematurity (ROP) refers to a premature infant who is under 36 weeks gestation, low birth weight, long-term oxygen intake, whose non-vascularized retina develops fibrohemangioma hyperplasia, contraction, and further causes tractional retinal detachment and blindness. Retinopathy of prematurity mostly occurs in premature infants, once the retinopathy occurs, the retinopathy rapidly progresses, the time window for effective treatment is narrow, and oxygen is strictly limited for premature infants, so that the retinopathy is the only effective preventive measure. As soon as possible, the condensation or laser light condensation is performed in time, and the success report that the further deterioration of the pathological changes is prevented is reported.

The key to the prevention and treatment of retinopathy of prematurity is early detection and timely treatment. However, the current ROP diagnosis is still mainly determined by fundus examination, before diagnosis, the thermotank medical history of a child patient needs to be clearly known, and whether allergic symptoms appear in the fundus-related nerve fiber layer or not is observed in the examination process; meanwhile, Doppler ultrasonic examination is required to be performed in time, and the methods can help doctors to make accurate diagnosis by combining. However, the existing method has poor detection timeliness and very complex diagnosis process, and is beneficial to more effective treatment of ROP if abnormality can be found earlier.

circRNA is a class of non-coding RNAs (ncrnas) with closed loop structures formed by a specific splicing mechanism, and numerous studies have revealed the potential value of circRNA as a diagnostic biomarker for Diabetic Retinopathy (DR), retinoblastoma and age-related macular degeneration. CircRNAs are also considered therapeutic targets for the treatment of retinal neovascular diseases. However, the research of using circRNA as the biomarker for diagnosing retinopathy of prematurity has not been reported yet.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide an application of hsa _ circRNA _092369 and an early-born retinopathy diagnostic reagent.

The present inventors have found that the expression level of hsa _ circRNA _092369 is inhibited in retinopathy of prematurity.

Therefore, the invention provides application of hsa _ circRNA _092369 as a marker in preparing a retinopathy diagnostic product for premature infants.

The invention also provides application of the reagent for detecting hsa _ circRNA _092369 in preparation of a retinopathy of prematurity diagnosis product.

The diagnostic product for retinopathy of prematurity can be used for early diagnosis of retinopathy of prematurity. In some embodiments, the retinopathy of prematurity diagnosis product is a diagnostic reagent, a diagnostic tool and/or a diagnostic kit, which is not limited in the present invention.

Further, the present invention also provides a diagnostic product for retinopathy of prematurity, which comprises any one of the following I) to IV):

I) and hsa _ circRNA _ 092369;

II), a detection probe for hsa _ circRNA _ 092369;

III), aptamers to hsa _ circRNA _ 092369;

IV), a chip for detecting hsa _ circRNA _ 092369.

The reagent for detecting hsa _ circRNA _092369 provided by the invention can be used for carrying out qualitative detection and/or quantitative detection on hsa _ circRNA _ 092369. In the invention, the detection is mainly carried out by a PCR (polymerase chain reaction) or constant-temperature amplification method, wherein the PCR method is a common PCR method and can also be RT-qPCR, qRT-PCR or real-time quantitative PCR; the isothermal amplification comprises NASBA, RCA, HAD, RPA, LAMP, ERA or NERA, the target substance for PCR or isothermal amplification detection can be hsa _ circRNA _092369, partial segment of hsa _ circRNA _092369, or product obtained by transcription of the two, and the invention is not limited to this.

In some embodiments, the detection primer of hsa _ circRNA _092369 comprises an upstream primer shown as SEQ ID NO.1 and a downstream primer shown as SEQ ID NO. 2. Wherein, the sequence shown in SEQ ID NO.1 is: GTATGCATACTACCTTGTACTGGTT, SEQ ID NO:2 is shown as follows: GACTATTGAAACCTGGAGAAACT are provided.

The chip for detecting hsa _ circRNA _092369 of the present invention may carry the primer of the present invention, or may carry other substances that can be used for detecting hsa _ circRNA _092369, and the present invention is not limited thereto.

The diagnostic product of the invention also comprises a total RNA extraction reagent, a reverse transcription reagent and an RT-qPCR detection reagent.

The total RNA extraction reagent is a total RNA extraction reagent of PBMCs, and in some embodiments, the total RNA extraction is performed by a Trizol method.

The invention also provides a method for diagnosing retinopathy of prematurity, which comprises detecting the expression level of hsa _ circRNA _092369 in a sample.

In the embodiment of the invention, the RT-PCR method is adopted for the detection, and whether the sample is from a retinopathy of prematurity patient is judged according to the retinopathy of prematurity expression quantity. The samples are peripheral blood PBMCs.

The invention provides a method for auxiliary diagnosis and detection of a patient with retinopathy of prematurity in need of treatment, wherein the method for judging whether a sample is from the patient with retinopathy of prematurity comprises the following steps: taking a PBMC sample of peripheral blood of a detection object, carrying out qRT-PCR detection by taking beta-actin as an internal reference, taking the ratio of hsa _ circRNA _ 092369/beta-actin as 0.0002775 as a cut off value, and if the ratio is lower than the cut off value, the detection object is a high-risk group of retinopathy of prematurity requiring treatment, and suggesting to further combine with means such as fundus examination and the like for accurate diagnosis. The expression level of hsa _ circRNA _092369 in a patient with retinopathy of prematurity is obviously lower than that of a normal control, so that the knocking-down and knocking-out of the expression of hsa _ circRNA _092369 or the inhibition of the activity of hsa _ circRNA _092369 can be used for constructing a retinopathy model of prematurity.

The invention provides application of hsa _ circRNA _092369 as a target point in construction of a retinopathy of prematurity model. In some embodiments, the retinopathy of prematurity model is an animal model or a cellular model

The invention also provides a reagent for constructing a retinopathy of prematurity model, which comprises any one of the following i) to iii):

i) (iii) a reagent that knockdown or knockdown hsa _ circRNA _ 092369;

ii), an agent that inhibits the activity of hsa _ circRNA _ 092369;

iii) a substance that increases the level or activity of an hsa _ circRNA _092369 inhibitor.

In the present invention, the model is an animal model or a cell model. The reagent for knocking out or knocking down hsa _ circRNA _092369 can be a reagent for transfecting or transforming cells, and the invention is not limited to the reagent; the agent that inhibits the activity of hsa _ circRNA _092369 of the invention is capable of reducing the activity of hsa _ circRNA _ 092369. The substance for improving the level or activity of the hsa _ circRNA _092369 inhibitor can be a small molecule compound or a substance for over-expressing or activating the hsa _ circRNA _092369 inhibitor by a genetic engineering means. The invention is not limited in this respect.

The invention also provides a method of constructing a model of retinopathy of prematurity by treatment with an agent according to the invention to increase the level or activity of hsa _ circRNA _ 092369. The treatment includes transformation or transfection.

The research proves that the hsa _ circRNA _092369 level of the retinopathy of prematurity patient is obviously reduced, has obvious difference with a normal control, and can be clinically used as a biomarker for diagnosing the retinopathy of prematurity for diagnosing and differentially diagnosing the retinopathy of prematurity patient. Also, downregulating hsa _ circRNA _092369 levels can construct a model for retinopathy of prematurity.

Drawings

To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described as follows:

FIG. 1 shows a heat map generated by hierarchical cluster analysis of differentially expressed circular RNA between Control (Control) and retinopathy of prematurity (ROP) PBMCs; the color scale shows the relative expression levels of circRNA in different samples, red for up-regulation and green for down-regulation;

FIG. 2 shows a volcanic plot of differentially expressed circRNA in PBMCs from retinopathy of prematurity patients; wherein, the green straight line in the figure is used for dividing corresponding fold change and P-values, the fold change is adjusted up or down by 2 times, and P is less than 0.05;

FIG. 3 shows the results of the detection of PBMCs target circRNA after qPCR amplification; data are shown as means ± SD (Control: n1 ═ 5, ROP: n2 ═ 5),. P <0.05,. P <0.01,. P < 0.001; wherein A, B in FIG. 3 respectively show the detection results; the sample size is 10 samples including Control n 1-5 and ROP n 2-5;

FIG. 4 shows RT-qPCR detection of expression of hsa _ circRNA _092369 in different grouped PBMCs; in the figure, Control is 23 to n 1; ROP n2 ═ 24; p <0.01, P < 0.001;

FIG. 5 shows the ROC curve for hsa _ circRNA _ 092369; AUC is 0.9239.

Detailed Description

The invention provides application of hsa _ circRNA _092369 as a diagnostic marker of retinopathy of prematurity, and a person skilled in the art can realize the application by appropriately improving process parameters by taking the contents into consideration. It is specifically noted that all such substitutions and modifications will be apparent to those skilled in the art and are intended to be included herein. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

circRNA (circlar RNA): the RNA is a special non-coding RNA molecule, has a closed ring structure, is not influenced by RNA exonuclease, is more stable in expression and is not easy to degrade. The invention provides a circular non-coding RNA for early diagnosis of retinopathy of prematurity, which is of great significance for detecting the onset of retinopathy of prematurity. Molecular marker hsa _ circRNA _092369 for early diagnosis of retinopathy of prematurity.

In the invention, hsa _ circRNA _092369 corresponds to hsa _ circ _0000095, wherein the former is named as Arraystar Human circRNAAArray V2(8x15K, Arraystar) chip, and the latter is named as circbase.

Hsa _ circ _0000095| NM _001199691| TMEM56-RWDD3, the sequence of which is shown in SEQ ID No. 3:

GTTGAAGAAATATGGAGATCAACACAAAACTGCTCATCAGTGTTACCTGTATCAGCTTTTTCACCTTTCAGCTTCTTTTCTACTTTGTAAGTTACTGGTTTTCAGCAAAAGTTTCTCCAGGTTTCAATAGTCTCAGCTTCAAAAAGAAGATTGAATGGAACTCAAGGGTAGTATCCACATGCCATTCTTTGGTGGTTGGTATTTTTGGCCTGTACATTTTCTTATTCGATGAGGCTACTAAAGCTGATCCACTTTGGGGTGGTCCATCACTTGCAAACGTGAATATTGCTATTGCCTCAGGCTACCTCATTTCTGATTTGTCCATTATAATTTTGTATTGGAAAGTGATTGGTGACAAATTTTTTATAATGCATCATTGTGCGTCCCTGTATGCATACTACCTTGTACTG

the test materials adopted by the invention are all common commercial products and can be purchased in the market. The invention is further illustrated by the following examples:

example 1 establishment of circRNA expression Profile for retinopathy of prematurity

1. Collecting samples:

the study was approved by the ethical committee of the xiang ya-two hospital, central university, and was in line with the declaration of helsinki. Informed consent was obtained from the participants' guardians and explained the nature and possible consequences of the study. From 12 months to 1 month at 2022 in 2020, a total of 57 premature infants were enrolled in yaja xiang, university in south china. Of these, 29 infants diagnosed with ROP required further treatment (screening 5, validation 24), such as intravitreal injection of anti-VEGF drugs and laser photocoagulation, and the test groups were included following the international classification of retinopathy of prematurity (ICROP, 2005), i.e. when the infant had: 1. aggressive posterior pole ROP, 2. additive lesion, or 3. type I ROP with/without additional lesion. For ethical reasons, to avoid additional blood draws, samples of control peripheral blood PBMCs were collected at the last blood draw prior to leaving the NICU. Exclusion criteria included: 1. AIDS, syphilis, hepatitis or cytomegalovirus infection; 2. major systemic diseases such as congenital metabolism, blood diseases, etc.; 3. congenital cataract, glaucoma, defects and other ocular abnormalities; 4. professional systemic malformations, 5. drugs that are in the duration of abnormal coagulation states, or that may affect metabolic states.

2. PBMCs extraction:

subjects collected 1.0-1.5 ml venous blood in the morning in an ethylenediaminetetraacetic acid (EDTA) anticoagulation tube and sent to the laboratory within 2 hours. Adding an equal amount of PBS solution according to a ratio of 1:1, gently mixing, adding the PBS solution into a centrifuge tube containing an equal amount of Ficoll-Paque PLUS (GE Healthcare, NJ, USA), centrifuging at 400g and 20min under acceleration 1 and deceleration 1(no break), sucking white membrane layer PBMCs, adding PBS to 10-15ml, centrifuging at 300g and 10min under acceleration 9 and deceleration 9, sucking supernatant, adding 1ml of TRIzol reagent (Invitrogen, Carlsbad, USA), mixing, transferring into a 1.5ml freezing tube, quickly freezing for 30min by liquid nitrogen, storing at-80 ℃, and transporting by dry ice for analysis of circRNA biomarkers.

3. RNA extraction:

0.2ml of chloroform was added to 1ml of the TRIZOL reagent homogenate sample, and the cap was closed. After manually shaking the tube vigorously for 15 seconds, the tube is incubated at 15 to 30 ℃ for 2 to 3 minutes. Centrifugation was carried out at 12,000 Xg for 15 minutes at 4 ℃. After centrifugation, the mixed liquid will be separated into a lower red phenol chloroform phase and an upper colorless aqueous phase. The RNA was partitioned in the aqueous phase in its entirety. The volume of the aqueous phase was approximately 60% of the TRIZOL reagent added during homogenization. The aqueous phase was transferred to a fresh centrifuge tube. The aqueous phase was mixed with isopropanol to precipitate the RNA therein, the amount of isopropanol added being 1ml of TRIZOL reagent added at this point in each sample homogenate plus 0.5ml of isopropanol. After mixing, incubation was carried out at 15 to 30 ℃ for 10 minutes, and then centrifugation was carried out at 12,000 Xg at 4 ℃ for 10 minutes. At this point the invisible RNA pellet before centrifugation will form a gelatinous pellet at the bottom and on the side walls of the tube. The supernatant was removed and at least 1ml of 75% ethanol was added to each 1ml sample of TRIZOL reagent homogenate to wash the RNA pellet. After shaking, the mixture was centrifuged at 7,500 Xg for 5 minutes at 4 ℃. The ethanol solution was removed, the RNA pellet was air dried for 5-10 minutes, and dried by vacuum centrifugation. Note that the RNA pellet is not completely dried, otherwise the solubility of the RNA is greatly reduced. The A260/280 ratio of the partially lysed RNA sample will be less than 1.6. When RNA was dissolved, RNase-free water was added and the mixture was repeatedly blown with a gun several times, followed by incubation at 55 to 60 ℃ for 10 minutes. The RNA solution obtained was stored at-70 ℃. Prior to further studies, RNA integrity was checked by denaturing agarose gel electrophoresis.

4. RNA quality detection:

1g of agarose was dissolved in 72ml of water, cooled to 60 ℃ and 10ml of 10 XMOPS electrophoresis buffer and 18ml of 37% formaldehyde solution (12.3M). And pouring a gel plate, and reserving a sample adding hole to add at least 25 mu l of solution. After the gel is formed, the comb is taken down, the gel plate is placed in an electrophoresis tank, and sufficient 1 XMOPS electrophoresis buffer solution is added until the surface of the gel is covered by a plurality of millimeters. 3 mu g of RNA is taken, 3 times of formaldehyde sample dye liquor is added, and EB is added in the formaldehyde sample dye liquor until the final concentration is 10 mu g/ml. The samples were denatured by incubation for 5 minutes at 70 ℃. Loading into a gel hole, and performing electrophoresis at a voltage of 5-6V/cm until the bromophenol blue indicator enters the gel by at least 2-3 cm. The bands of 28S and 18S ribosomal RNA are very bright and dense (the size depends on the type of species used to extract the RNA), and the density of the upper band is approximately 2 times that of the lower band. It is also possible to observe a smaller, slightly diffused band, which consists of low molecular weight RNA (tRNA and 5S ribosomal RNA). Between the 18S and 28S ribosomal bands, a diffuse piece of EB staining material is typically seen, possibly consisting of mRNA and other heteroRNAs. If DNA contamination occurs during RNA preparation, it will occur above the 28S ribosomal RNA band, i.e., a higher molecular weight diffuse migrating species or band. Degradation of RNA is manifested as a dispersion of bands of ribosomal RNA.

5. cRNA synthesis and labeling:

RNase R was used to remove linear RNA and enrich for circRNA. Using the random primer method, circRNA was amplified and reverse transcribed (Arraystar Super RNA Labeling kit) into fluorescently labeled cRNA according to the kit instructions. The labeled cRNA was purified by RNeasy Mini Kit (Qiagen). The concentration and activity of labeled cRNA was measured using NanoDrop ND-1000.

6. Chip hybridization and data analysis:

the labeled cRNA probe and chip (Arraystar Human Circular RNA Array 2.0) were hybridized under standard conditions. The fluorescence intensity of the chip was scanned using an Agilent Scanner G2505C, and the experimental data was saved in a conversion manner. The detected circRNA has statistical significance when the fold change is more than or equal to 2.0 and the P is less than 0.05.

7. As a result:

in 10 PBMCs samples (5 control groups, 5 patient groups), the on-chip targets included 13617, and the circRNAs with too low fluorescence intensity were filtered as shown in FIG. 1, wherein the circRNAs with significant differences in expression (Fold Change ≧ 2 and Pvalue <0.05) included 54 up-regulated targets and 143 down-regulated targets (FIG. 2).

Example 2qRT-PCR validation

12 target circRNAs with significantly different expression were selected from the expression profile established in example 1 and verified again in 10 samples using qRT-PCR. The differential expression of 12 circRNAs in two PBMCs was statistically different and the trend of the change was consistent with that of the chip, hsa _ circRNA _003986, hsa _ circRNA _061346, hsa _ circRNA _082319, hsa _ circRNA _103399, and hsa _ circRNA _003140 were up-regulated relative to the control group; hsa _ circRNA _007366, hsa _ circRNA _020959, hsa _ circRNA _092369, hsa _ circRNA _103554, hsa _ circRNA _103555, hsa _ circRNA _103556, and hsa _ circRNA _103557 were down-regulated relative to the control (fig. 3). Then, 4 circRNAs with statistical differences, hsa _ circRNA _061346, hsa _ circRNA _092369, hsa _ circRNA _103554and hsa _ circRNA _003140, were selected for further validation (FIG. 3).

Example 3

The sample size was further expanded by qRT-PCR to verify the expression level of hsa _ circRNA _092369 in PBMCs and to test its diagnostic value.

1. Sample collection and total RNA extraction were performed as before.

2. cDNA Synthesis and qRT-PCR:

the total RNA was transcribed into cDNA by SuperScript III reverse transcriptase kit (Invitrogen, Carlsbad, Calif., USA). The cDNA may be placed in an ice bath for later use or stored at-20 ℃. The circRNA sequences were downloaded via the circbase database or UCSC genome browser, and primers were designed for the target and internal reference sequences using Primer design software Primer 5.0 (Table 1). qPCR assays were performed using 2 × PCRMaster Mix (Arraystar). The 384 well plates were placed on a QuantStaudio 5 real-time PCR system (Applied Biosystems, Foster City, Calif., USA) for reaction. The conditions were 95 ℃ for 10 minutes; after 40 PCR cycles (95 ℃, 10 seconds; 60 ℃, 60 seconds), a melting curve of the PCR product is established after the amplification reaction is finished.

TABLE 1 circRNA primer sequences

The data were calculated using a dual standard curve method. The measured data are expressed in terms of median ± interquartile range, and U-test was performed using Mann-whitney. P values <0.05 are statistically different (table 2).

3. As a result:

expression levels of hsa _ circRNA _092369 were tested in 47 PBMCs samples (24 preterm retinal patient samples, 23 control group samples, age-gender matched). The results showed that there was a statistical difference in the expression level of hsa _ circRNA _092369 in the two groups of peripheral blood PBMCs samples (FIG. 4).

TABLE 2P value levels of hsa _ circRNA _092369

circRNA	Diagnostic value (circRNA/beta-actin)	P value
			hsa_circRNA_092369	<0.0002775	<0.0001

To further test the effectiveness of hsa _ circRNA _092369 in diagnosing retinopathy of prematurity in peripheral blood PBMCs, we plotted a Receiver Operating Characteristics (ROC) curve (fig. 5). The area under the ROC curve for diagnosing retinopathy of prematurity in PBMCs samples found for hsa _ circRNA _092369 was 0.9239. When the diagnostic value of hsa _ circRNA _092369 in PBMCs was set to <0.0002775, the sensitivity and specificity of the diagnosis was 79.17/91.30 (%) (FIG. 5).

The above is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, a plurality of modifications and embellishments can be made without departing from the principle of the present invention, and these modifications and embellishments should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Xiangya II Hospital of Zhongnan university

<120> application of hsa _ circRNA _092369 and reagent for diagnosing retinopathy of early childbirth

<130> MP22016893

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtatgcatac taccttgtac tggtt 25

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gactattgaa acctggagaa act 23

<210> 3

<211> 410

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gttgaagaaa tatggagatc aacacaaaac tgctcatcag tgttacctgt atcagctttt 60

tcacctttca gcttcttttc tactttgtaa gttactggtt ttcagcaaaa gtttctccag 120

gtttcaatag tctcagcttc aaaaagaaga ttgaatggaa ctcaagggta gtatccacat 180

gccattcttt ggtggttggt atttttggcc tgtacatttt cttattcgat gaggctacta 240

aagctgatcc actttggggt ggtccatcac ttgcaaacgt gaatattgct attgcctcag 300

gctacctcat ttctgatttg tccattataa ttttgtattg gaaagtgatt ggtgacaaat 360

tttttataat gcatcattgt gcgtccctgt atgcatacta ccttgtactg 410

Claims (10)

1. The application of hsa _ circRNA _092369 as a marker in the preparation of a retinopathy of prematurity diagnosis product.

2. A diagnostic product for retinopathy of prematurity comprising reagents for detecting hsa _ circRNA _ 092369.

3. The diagnostic product of claim 2, wherein the reagent for detecting hsa _ circRNA _092369 comprises any one of the following I) to IV):

I) and hsa _ circRNA _ 092369;

II), a detection probe for hsa _ circRNA _ 092369;

III), aptamers to hsa _ circRNA _ 092369;

IV), a chip for detecting hsa _ circRNA _ 092369.

4. The diagnostic product of claim 3, wherein the detection primer hsa _ circRNA _092369 comprises a primer pair shown in SEQ ID No. 1-2.

5. The diagnostic product of any one of claims 2 to 4, further comprising a total RNA extraction reagent, a reverse transcription reagent and a qRT-PCR detection reagent.

6. The application of hsa _ circRNA _092369 as a target point in constructing a retinopathy of prematurity model.

7. The use according to claim 6, wherein the model of retinopathy of prematurity is an animal model or a cellular model.

8. A reagent for constructing a retinopathy of prematurity model, which comprises any one of the following i) to iii):

i) (iii) a reagent that knockdown or knockdown hsa _ circRNA _ 092369;

ii), an agent that inhibits the activity of hsa _ circRNA _ 092369;

iii) a substance that increases the level or activity of an hsa _ circRNA _092369 inhibitor.

9. A method of constructing a model of retinopathy of prematurity by treating with a reagent according to claim 8 to reduce the level or activity of hsa _ circRNA _ 092369.

10. The method of claim 9, wherein the treatment comprises transformation or transfection.

Images