CN114990164B

CN114990164B - Intermediate complex subunit inhibitors and uses thereof

Info

Publication number: CN114990164B
Application number: CN202210685944.1A
Authority: CN
Inventors: 李湘盈; 谢思; 赵欣滢; 吴帆
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2022-06-16
Filing date: 2022-06-16
Publication date: 2023-12-05
Anticipated expiration: 2042-06-16
Also published as: CN114990164A

Abstract

The present disclosure relates to methods of promoting differentiation of hematopoietic stem cells or blood progenitor cells into erythrocytes or their precursors, comprising the step of contacting the hematopoietic stem cells or blood progenitor cells with an inhibitor that inhibits the expression and/or activity of the tail subunit of an mediator complex. The disclosure also relates to the use of an inhibitor that inhibits the expression and/or activity of the tail subunit of the mediator complex in the manufacture of a medicament for treating a disease associated with dyshematopoietic function in a subject, and to the use of an agent that detects the expression and/or activity of the tail subunit of the mediator complex in the manufacture of a kit for diagnosing or prognosing a disease associated with dyshematopoietic function in a subject.

Description

Intermediate complex subunit inhibitors and uses thereof

Technical Field

The present invention relates to the use of inhibitors that inhibit the expression and/or activity of tail subunits of an mediator complex, such as MED16, to promote differentiation of hematopoietic stem cells or blood progenitor cells into erythrocytes or their precursors, and in the treatment of related diseases.

Background

Hematopoiesis is conserved during vertebrate evolution. Hematopoietic Stem Cells (HSCs) are present in adult bone marrow, can sustain sustained production of all blood cells, and in a steady state act as progenitor cells that can develop into multiple or single lineages. Progenitor cells produce blood precursors responsible for single lineage differentiation and mature blood cell production, including bone marrow cells (monocytes, macrophages and neutrophils), erythrocytes, megakaryocytes and lymphocytes (Bryder, D. Et al, I.L. specific stem cells: the paradigmatic tissue-specific stem cells.Am J Pathol 169, 338-346). Erythropoiesis is the process by which Hematopoietic Stem Cells (HSCs) proliferate and differentiate to produce mature Red Blood Cells (RBC) (Orkin, S.H. and Zon, L.I. Hematopsis: an evolving paradigm for stem cell biology. Cell132,631-644; dzierzak, E. And Philissen, S.Erythropois: development and differentiation. Cold Spring Harb Perspect Med, a 01601). The body regulates the number of RBCs within a narrow normal range with a variety of complex mechanisms (Hattangadi, S.M. et al From stem cell to red cell: regulation of erythropoiesis at multiple levels by multiple proteins, RNAs, and chromatin modifications. Blood 118, 6258-6268).

Once hematopoietic function is deregulated, various diseases and developmental disorders, such as myelodysplastic syndrome (MDS), can result. MDS occurs primarily in patients around 70 years of age with a prevalence of up to 4-5 per 10 thousands of individuals per year (Cazzola, M.Myelodysplasic Syndromes. N Engl J Med 383, 1358-1374). MDS is a common myeloid malignancy, defined as myelodysplasia, cytopenia, inefficiency in hematopoiesis, and progression to acute myelogenous leukemia (Chen, B.Y. et al, SETD2 deficiency accelerates MDS-associated leukemogenesis via S100a9 in NHD13 mice and predicts poor prognosis in MDS.blood 135, 2271-2285). Some mutant driver genes, including those involved in RNA splicing, transcriptional regulation, control of DNA repair, DNA methylation, signaling, histone modification, and the adhesion complex, can lead to MDS (Ogawa, s.genetics of mds.blood 133, 1049-1059). There are several methods of treating MDS, such as allogeneic stem cell transplantation and drug therapy. Despite the remarkable improvement in the pathophysiology of MDS in recent years, more effort is still required to find new biomarkers to make therapeutic progress (Cazzola, M, as cited above).

During hematopoiesis, cell-specific transcription factors are relied upon to regulate their activity to finely self-renew and differentiate. Transcription factors use co-regulatory factors to communicate information through the general transcriptional machinery and ensure proper and appropriate output of specific gene expression programs (Aranda-Orgilles, b. Et al, MED12 regulatory HSC-Specific Enhancers Independently of Mediator Kinase Activity to Control Hematopsis. Cell Stem Cell 19, 784-799).

The mediator complex (mediator complex) is an evolutionarily conserved complex that functions as a key co-regulator of transcription factor activity and a functional bridge between enhancers and promoters. The mediators are large polyprotein complexes (Allen, B.L. and Taatjes, D.J. the Mediator Complex: a central integrator of trans-script, molecular cell biology 16,155-166; jeronimo, C. And Robert, F.the Mediator Complex: at the Nexus of RNA Polymerase II trans-script, trends in cell biology 27,765-783;Soutourina,J.Transcription regulation by the Mediator complex.Nature reviews.Molecular cell biology 19,262-274;Soutourina,J.Mammalian Mediator as a Functional Link between Enhancers and Promoters.Cell 178,1036-1038; andre, K.M. et al, mediator Roles Going Beyond trans-script, trends Genet 37, 224-234). Mediators play an important role in various basic processes such as transcription initiation, elongation, pause release, phase separation and chromatin structure (Allen, b.l. and Taatjes, d.j., as cited above). However, the contribution of each module and each subunit to the mediator function has not been explored to a great extent.

The nuclear mediator (head and intermediate module, and backbone subunit MED 14) is sufficient to exert mediator functions in vitro (Cevher, M.A. et al Reconstitution of active human core Mediator complex reveals a critical role of the MED, subarit. Nat Struct Mol Biol 21, 1028-1034). Unlike nuclear mediators, the tail module of mediators is the primary target of transcription factors, which can lead to inducible gene regulation. Subunits of the tail module may function in an environmentally dependent manner as activators or repressors of transcription functions (Ding, N.et al, mediator links epigenetic silencing of neuronal gene expression with x-linked membrane transcription 31,347-359; tsutsui, T.et al, mediator complex recruits epigenetic regulators via its two cyclin-dependent kinase subunits to repress transcription of immune response genes. The Journal of biological chemistry 288,20955-20965; chen, X.et al, med23 serves as a gatekeeper of the myeloid potential of hematopoietic stem cells. Nature communications 9,3746; liu, Z.et al, med MED23cooperates with RUNX, to drive osteoblast differentiation and bone development communications 7,11149; sun, Y.et al, the Mediator subunit Med contributes to controlling T-cell activation and prevents automated communication 5,5225; yin, J. However, the role of the tail module is largely unknown, especially in the role it plays during cellular development.

Subunits of the mediator act synergistically with different transcription factors, interactions with transcription factors and stability of the module are attributable to MED16. In yeast, MED16 deletions can split the mediator into two stable sub-complexes (Saleh, M.M. et al Connection of core and tail Mediator modules restrains transcription from TFIID-dependent proteins 17, e 1009529). MED16 has been shown to have a potential role in antioxidant gene expression in the human Cell system (Sekine, H.et al, the Mediator Subunit MED Transmission NRF2-Activating Signals into Antioxidant Gene expression. Mol Cell Biol 36,407-420; lu, Y.et al, activation of NRF2 ameliorates oxidative stress and cystogenesis in autosomal dominant polycystic kidney disease. Sci Transl Med 12). MED16 can interact with STAT1 to modulate ifnγ -induced mhc ii expression, thereby activating T cells in macrophages (Kiritsy, m.c. et al A genetic screen in macrophages identifies new regulators of IFNgamma-inducible MHCII that contribute to T cell activation. Ehife 10). Recently, it was found that low expression of MED16 in papillary thyroid carcinomas leads to an increase in TGF-beta signaling and radioiodine resistance (Gao, H. Et al, mediator complex subunit is Down-regulated in papillary thyroid cancer, leading to increased transforming growth factor-beta signaling and radioiodine resistance. The Journal of biological chemistry 295,10726-10740). However, the function of MED16 or other mediator tail modules in the hematopoietic system during cellular development, especially under physiological and pathological conditions, is unknown.

Disclosure of Invention

The inventors have surprisingly found that subunits of the tail module of the mediator complex inhibit the development of erythrocytes and myeloid lineage cells during hematopoietic development. Inhibition of subunits of the tail module, such as MED16 (e.g., knockdown of its expression) can promote differentiation of hematopoietic stem cells and blood progenitor cells into erythrocytes, validating their use as therapeutic targets for diseases associated with hematopoietic dysfunction, such as MDS. Furthermore, high expression of subunits of the tail module of the mediator complex, such as MED16, can serve as biomarkers for diseases associated with abnormal hematopoietic function, such as MDS, for diagnosis and prognosis of patients.

Accordingly, in a first aspect, the present disclosure relates to a method of promoting differentiation of hematopoietic stem cells or blood progenitor cells into erythrocytes or their precursors, the method comprising the step of contacting the hematopoietic stem cells or blood progenitor cells with an inhibitor of the expression and/or activity of the tail subunit of the mediator complex.

Erythroid development is an important branch of hematopoietic development, where erythrocytes are the most abundant cell type in the blood, and at the same time the most abundant cells in the human body, and during the 120-day life cycle of erythrocytes, they are able to shuttle through various tissues and organs in the body to perform the physiological function of delivering oxygen. In adults, mature erythrocytes are the final differentiation product derived from HSCs. The classical hematopoietic differentiation model proposed by Weissman study group considers HSCs to undergo a series of lineage-selective fate decisions with increasingly limited potential, hematopoietic stem cells producing multipotent progenitors (Multipotent progenitor, MPP) that produce lymphocyte progenitors (Lymphocyte progenitor cell, LPP) or myeloid progenitors (Myeloid progenitor cell, myP), myP granulocyte macrophage progenitors (Granulocyte macrophage progenitor cell, GMP) or megakaryocyte-erythroid progenitors (megakaryotes-erythroid progenitor, MEP), ultimately dedicated to erythropoiesis (Dzierzak and Philipsen 2013,An,Schulz et al.2014).

Traditionally, erythropoiesis is divided into three phases: early erythropoiesis, erythroid terminal differentiation and reticulocyte maturation. Early erythropoiesis involves typing of multilineage progenitor cells into erythroid progenitor cells, followed by proliferation and differentiation into early erythroid progenitor colony forming units (Burst forming unit-erythroid, BFU-E) and late erythroid progenitor colony forming units (Colony forming unit-erythroid, CFU-E), which are subdivided into protoerythroid cells (Pro erythrobalast, pro). Erythroid terminal differentiation begins with Pro differentiating into promyelocytes (Basophilic erythroblast, baso), followed by polychromatic erythroblasts (Polychromatic erythroblast, poly), and subdividing into primary erythroblasts (Orthochromatic erythroblast, ortho), which gradually become reticulocytes (reticulocite), with many changes occurring during erythroid terminal differentiation. The erythroid cells decreased in volume, increased hemoglobin synthesis, undergone membrane recombination and chromatin concentration, and then enucleated (Hattangadi, wong et al 2011, wong, hattangadi et al 2011). In the final stage of erythropoiesis, reticulocytes mature into erythrocytes, lose intracellular organelles, reduce cell volume and surface area, and reorganize the erythrocyte membrane. Therefore, the development of erythroid systems requires a fine and complex regulation, which is strictly regulated by a number of factors.

In some embodiments, wherein the blood progenitor cells are selected from the group consisting of multipotent progenitor cells (MPPs), myeloid progenitor cells (MyP), megakaryocyte-erythroid progenitor cells (MEPs), or erythroid progenitor cells.

In some embodiments, the precursor cells of the erythrocytes are selected from the group consisting of early erythroid progenitor colony forming units (BFU-E), late erythroid progenitor colony forming units (CFU-E), pro-erythrocytes (Pro), promyelocytes (Baso), erythroblasts (Ortho), and reticulocytes.

The transcription mediator complex in mammals comprises 33 subunits, which are structurally divided into modules of head, middle, tail and CDK8 kinase. MED14 serves as a backbone of a transcription mediator complex, and has a function of promoting interactions between modules and stabilizing the complex. The head subunit comprises MED6, MED8, MED11, MED17, MED18, MED20 and MED22, the middle subunit comprises MED1, MED4, MED7, MED9, MED10, MED19, MED21, MED26 and MED31, the tail subunit comprises MED15, MED27, MED28, MED29, MED30, MED16, MED23, MED24 and MED25, and the CDK8 kinase module comprises MED12/12L, MED/13L, CCNC, CDK8/19. The subunits of the head and middle modules form a functional and structural core through MED14, interacting with Pol ii; the CKD8 kinase module inhibits interaction of the transcription mediator complex with Pol ii by interacting with the core mediator, initiation of transcription being accompanied by dissociation of the CDK8 kinase from the transcription mediator complex, the tail having variability, comprising subunits that interact with activators and inhibitors (Tsai et al, 2014). Studies have shown that MED25 of the tail module releases the Polycomb inhibition by blocking PRC2 binding to the HFN4a gene (Englert et al 2015)

In some embodiments, the tail subunit of the mediator complex may be selected from one or more of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30. In some embodiments, the tail subunit of the mediator complex may include any of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30. In other embodiments, the tail subunits of the mediator complex may include two or more of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30.

In some preferred embodiments, the tail subunit of the mediator complex comprises MED16.

In some embodiments, the inhibitor may be selected from the group consisting of an inhibitory RNA molecule, a coding sequence thereof, a vector comprising the coding sequence, and a small molecule compound.

In some embodiments, the inhibitory RNA molecule or its coding sequence (DNA sequence) may be single-stranded or double-stranded. In some embodiments, wherein the inhibitory RNA molecule may be selected from siRNA, shRNA, and microRNA.

Any carrier may be suitable for use in the present disclosure. In some embodiments, the vector may be an expression vector. The expression vector may be any suitable recombinant expression vector. Suitable vectors include vectors designed for propagation and amplification or for expression or both, such as plasmids and viruses. For example, the vector may be selected from the pUC series (Fermentas Life Sciences, glen Burnie, md.), the pBluescript series (Stratagene, laJolla, calif.), the pET series (Novagen, madison, wis.), the pGEX series (Pharmacia Biotech, uppsala, sweden) and the pEX series (Clontech, palo Alto, calif.). Phage vectors such as λGT10, λGT11, λ ZapII (Stratagene), λEMBL4, and λNM1149 can also be used.

In some embodiments, the vector is a viral vector. In some embodiments, the vector is a retroviral vector, a DNA vector, a murine leukemia virus vector, an SFG vector, a plasmid, an RNA vector, an adenovirus vector, a baculovirus vector, an Epstein Barr virus vector, a papovavirus vector, a vaccinia virus vector, a herpes simplex virus vector, an adeno-associated virus vector (AAV), a lentiviral vector, or any combination thereof. In some embodiments, the vector is selected from the group consisting of lentiviral vectors and adeno-associated viral vectors.

In some embodiments of the first aspect of the disclosure, the method is an in vitro aspect. In other embodiments, the method is an in vivo method, e.g., performed in a subject.

In a second aspect, the present disclosure relates to a method of treating or preventing a disease associated with abnormal hematopoietic function in a subject. In some embodiments, the method comprises the step of administering to the subject an inhibitor that inhibits the expression and/or activity of a tail subunit of an mediator complex.

The terms "patient" and "subject" are used interchangeably herein and in their conventional sense to refer to an organism suffering from or susceptible to a condition that can be prevented or treated by administration of a viral vector or viral particle or composition of the invention, and include humans and non-human animals.

In some embodiments, the subject is a non-human mammal (e.g., chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like). In some embodiments, the subject is a primate, e.g., a non-human primate. In some embodiments, the subject is a human.

Herein, the term "treatment" includes: (1) Inhibiting a condition, disease, or disorder, i.e., arresting, reducing, or delaying the progression of the disease or its recurrence or the progression of at least one clinical or sub-clinical symptom thereof; or (2) alleviating the disease, i.e., causing regression of at least one of the condition, disease, or disorder, or a clinical or subclinical symptom thereof.

Herein, the term "preventing" a condition, disease, or disorder includes: preventing, delaying or reducing the incidence and/or likelihood of the occurrence of at least one clinical or subclinical symptom of a condition, disease or disorder developing in a subject who may have or be susceptible to the condition, disease or disorder but who has not yet experienced or exhibited the clinical or subclinical symptom of the condition, disease or disorder.

In other embodiments, the method comprises:

a. isolating hematopoietic stem cells or blood progenitor cells from a subject or a sample from a subject;

b. contacting the hematopoietic stem cells or blood progenitor cells with an inhibitor that inhibits the expression and/or activity of the tail subunit of the mediator complex;

c. infusing the contacted hematopoietic stem cells or blood progenitor cells obtained in b back into the subject.

In some embodiments, the sample from the subject is selected from a bone marrow sample and peripheral blood.

In a third aspect, the present disclosure relates to an inhibitor of the expression and/or activity of a tail subunit of an mediator complex for use in a method of treating a disease associated with dyshematopoietic function in a subject. In some embodiments, the method comprises the step of administering to the subject an inhibitor that inhibits the expression and/or activity of a tail subunit of an mediator complex.

In other embodiments, the method comprises:

In a fourth aspect, the present disclosure relates to the use of an inhibitor that inhibits the expression and/or activity of a tail subunit of an mediator complex in the manufacture of a medicament for treating a disease associated with dyshematopoietic function in a subject.

In some embodiments, the medicament is for use in a method comprising administering to the subject an inhibitor that inhibits the expression and/or activity of a tail subunit of an mediator complex.

In other embodiments, the medicament is for use in a method comprising:

In some embodiments of the second, third, fourth aspects of the disclosure, the disease associated with abnormal hematopoietic function may be selected from myelodysplastic syndrome (MDS) and leukemia, such as Chronic Myelogenous Leukemia (CML) or Acute Myelogenous Leukemia (AML).

Chronic Myelogenous Leukemia (CML) is a cancer of leukocytes which is characterized by increased and unregulated growth of myeloid cells in the bone marrow, and accumulation of these cells in the blood. CML is a clonal bone marrow stem cell disease in which proliferation of mature granulocytes (neutrophils, eosinophils, and basophils) and their precursors is found, interfering with normal erythropoiesis, resulting in reduced erythrocyte numbers and hematopoietic inadequacies.

Acute Myelogenous Leukemia (AML) is a myeloid blood cell cancer characterized by abnormal cell rapid growth. Similarly, these cells accumulate in bone marrow and blood and interfere with normal hematopoiesis.

In some embodiments of the second, third, and fourth aspects of the present disclosure, the tail subunit of the mediator complex may be selected from one or more of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30. In some embodiments, the tail subunit of the mediator complex may include any of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30. In other embodiments, the tail subunits of the mediator complex may include two or more of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30.

In some embodiments of the second, third, and fourth aspects of the disclosure, the inhibitor may be selected from the group consisting of an inhibitory RNA molecule, a coding sequence thereof, a vector comprising the coding sequence, and a small molecule compound.

In some embodiments, the inhibitory RNA molecule or its coding sequence (DNA sequence) may be single-stranded or double-stranded. In some embodiments, the inhibitory RNA molecule may be selected from siRNA, shRNA, and microRNA.

In some embodiments of the second, third, and fourth aspects of the disclosure, the subject may be a human or a non-human primate.

In a fifth aspect, the present disclosure relates to a method of diagnosing a disease associated with abnormal hematopoietic function in a subject, the method comprising:

a. contacting an agent that detects expression and/or activity of a tail subunit of an mediator complex with a sample from the subject;

b. quantifying the expression and/or activity of tail subunits of an mediator complex in said sample,

wherein the sample comprises hematopoietic stem cells or blood progenitor cells, wherein a high expression and/or activity of the tail subunit of the mediator complex in the sample from the subject, as compared to a healthy subject, is indicative of the presence or risk of the disease.

In a sixth aspect, the present disclosure relates to an agent for detecting expression and/or activity of a tail subunit of an mediator complex for use in a method of diagnosing a disease associated with dyshematopoietic function in a subject, the method comprising:

a. contacting the agent with a sample from the subject;

In a seventh aspect, the present disclosure relates to the use of a reagent for detecting the expression and/or activity of a tail subunit of an mediator complex for the manufacture of a kit for diagnosing a disease associated with dyshematopoietic function in a subject, said kit being used in a method of:

a. contacting the agent with a sample from the subject;

In an eighth aspect, the present disclosure relates to a method of prognosis of a patient suffering from a disease associated with abnormal hematopoietic function, the method comprising:

wherein the sample comprises hematopoietic stem cells or blood progenitor cells, wherein a high expression and/or activity of the tail subunit of the mediator complex in the sample from the patient compared to a healthy subject is indicative of a poor prognosis.

In a ninth aspect, the present disclosure relates to an agent for detecting expression and/or activity of a tail subunit of an mediator complex for use in a method of prognosis of a patient suffering from a disease associated with hematopoietic dysfunction, the method comprising:

a. contacting the reagent with a sample from the patient;

In a tenth aspect, the present disclosure relates to the use of a reagent for detecting the expression and/or activity of a tail subunit of an mediator complex for the preparation of a kit for prognosis of a patient suffering from a disease associated with dyshematopoietic function, the kit being for use in a method of:

a. contacting the reagent with a sample from the patient;

In some embodiments of the fifth to tenth aspects of the disclosure, the sample from the subject is selected from the group consisting of a bone marrow sample and peripheral blood.

In some embodiments of the fifth to tenth aspects of the disclosure, the disease associated with abnormal hematopoietic function may be selected from myelodysplastic syndrome (MDS) and leukemia, such as Chronic Myelogenous Leukemia (CML) or Acute Myelogenous Leukemia (AML).

In some embodiments of the fifth to tenth aspects of the present disclosure, the tail subunit of the mediator complex may be selected from one or more of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30. In some embodiments, the tail subunit of the mediator complex may include any of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30. In other embodiments, the tail subunits of the mediator complex may include two or more of MED15, MED16, MED23, MED24, MED25, MED27, MED28, MED29, and MED 30.

In some embodiments of the fifth to tenth aspects of the disclosure, the reagent may be a detection reagent for a method selected from the group consisting of: flow cytometry, ELISA, immunohistochemical analysis, PCR-based quantitative methods, in situ hybridization, transcriptome analysis, microarray-based gene expression profiling.

In some embodiments, the agent may be an antibody that specifically binds to any of the tail subunits of the mediator complex. In some embodiments, the antibody is conjugated to a detectable moiety, e.g., the detectable moiety may be selected from biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, or a fluorescent, phosphorescent, or chemiluminescent molecule. Detectable moieties for diagnostic purposes include, for example, fluorescent labels, radiolabels, enzymes, nucleic acid probes, contrast agents, and the like.

In other embodiments, the agent is a nucleotide sequence, such as a primer or probe, that hybridizes to at least a portion of a nucleotide sequence (e.g., a gene sequence or an mRNA sequence) encoding any of the tail subunits of the mediator complex.

In some embodiments of the fifth to tenth aspects of the disclosure, the subject may be a human or a non-human primate.

In an eleventh aspect, the present disclosure relates to a pharmaceutical composition comprising an inhibitor that inhibits the expression and/or activity of the tail subunit of an intermediate complex, and optionally a pharmaceutically acceptable carrier (carrier) and/or excipient, for use in treating a disease associated with hematopoietic dysfunction in a subject.

The term "pharmaceutically acceptable" means that the carrier or excipient is compatible with the other ingredients of the composition and not deleterious to the recipient thereof and/or that such carrier or adjuvant is approved or available for inclusion in a pharmaceutical composition for parenteral administration to a human.

In some embodiments, the disease associated with abnormal hematopoietic function may be selected from myelodysplastic syndrome (MDS) and leukemia, such as Chronic Myelogenous Leukemia (CML) or Acute Myelogenous Leukemia (AML).

Drawings

Fig. 1: FIG. 1A. Knockdown efficiency of lentiviral infection encoding MED16 shRNA (shMED 16-1). FIG. 1B Fluorescence Activated Cell Sorting (FACS) surface marker analysis of cells. CD235 ⁺ Cell percentage statistical plot (left). shSCR and shMED16 transduced cultured CD34 ⁺ Representative FACS analysis plot of cells on day 5 (right). FIG. 1℃ Details Fluorescence Activated Cell Sorting (FACS) surface marker analysis of cells. shSCR, shMED15 and shMED23 transduced cultured CD34 ⁺ Representative FACS analysis plot of cells on day 5. FIG. 1D FACS surface marker analysis of cells. The enucleated reticulocytes were CD235a ⁺ Hoechst ^- . Statistical plot of percentage of enucleated reticulocytes (left). shSCR and shMED16 transduced cultured CD34 ⁺ Representative FACS analysis plot of cells on day 12 (right).

FIG. 2 shows CD34 ⁺ Annexin V staining results in cells.

FIG. 3 shows the results of colony formation assay. FIG. 3A shows shSCR and shMED16 transduced cultured CD34 ⁺ Cell colony counts of the intermediate-early erythroid progenitor colony forming unit (Burst forming unit-erythroid, BFU-E) and the late erythroid progenitor colony forming unit (Colony forming unit-erythroid, CFU-E). FIG. 3B shows a statistical plot of colony areas for BFU-E and CFU-E.

Fig. 4: figure 4a knockdown efficiency of med16 siRNA nuclear transfection. Fig. 4B. Representative FACS surface marker analysis of cells.

Fig. 5: fig. 5a color of shscr and shMED16 transduced K562 cell pellet. The benzidine staining in the k562 cells is shown in fig. 5b. Fig. 5C representative FACS surface marker analysis of cells.

Fig. 6: fig. 6A. Knockdown efficiency in human primary hematopoietic stem and progenitor cell systems from Peripheral Blood Mononuclear Cells (PBMCs) and bone marrow mononuclear cells (BMMNCs). Fig. 6B representative FACS surface marker analysis of cells (left). CD235 ⁺ Statistical plot of cell percentages (right). Data represent mean ± SD; the p-value was determined by the two-tailed student t-test (p < 0.001, p < 0.01, p < 0.05).

Figure 7 shows the gating strategy for flow cytometry in transplantation experiments.

Figure 8 shows the results of MED16 knockdown promoting in vivo myeloid and erythroid lineage reconstruction: fig. 8A representative FACS surface marker analysis (left) and statistical plot (right) of erythroid cells from bone marrow, n=4 mice. Fig. 8B, statistical plot of representative FACS surface marker analysis (left) and (right) of myeloid lineage cells from bone marrow, n=4 mice.The myeloid cell is hCD33 ⁺ And (3) cells. Fig. 8C, statistical plot of representative FACS surface marker analysis (left) and (right) of B cells from bone marrow, n=4 mice. B cells are hCD19 ⁺ And (3) cells. Fig. 8D, representative FACS surface marker analysis (left) and statistical plot (right) of T cells from bone marrow, n=4 mice. T cell hCD3 ⁺ And (3) cells. Data represent mean ± SEM; the p-value was determined by the two-tailed student t-test (p < 0.001, p < 0.01, p < 0.05).

Fig. 9: fig. 9A representative FACS surface marker analysis and statistics of myeloid cells (upper) and B cells (lower) from spleen (left), n=4 mice. Fig. 9B, representative FACS surface marker analysis and statistics of myeloid cells (upper) and B cells (lower) from peripheral blood (left), n=4 mice. Data represent mean ± SEM; the p-value was determined by the two-tailed student t-test (p < 0.001, p < 0.01, p < 0.05).

Fig. 10 shows that MED16 inhibits innate immune gene expression on day 0: FIG. 10A shows a heat map of the differentially expressed genes on day 0 (|fold change| >1.5, p-value < 0.05). FIG. 10B. Respective enrichment of GO terms for up-regulated (top) and down-regulated (bottom) genes. Gsea analysis showed MED16 knockdown of the enriched IL-22 profile, which was associated with stressed hematopoiesis on day 0. The right heat map represents the IL-22 signature gene set.

FIG. 11 shows CD34 from day 4 of culture of the human primary hematopoietic stem and progenitor cell system ⁺ Bulk RNA-seq analysis of shSCR/shMED16 of cells. FIG. 11A shows a heat map of the differentially expressed genes on day 4 (|fold change|)>1.5 p value<0.05). The right bar represents the different groups. FIG. 11B enrichment of GO terminology from up-and down-regulated genes of (a). Figure 11c. Gsea analysis demonstrated MED16 knockdown enriches stress hematopoietic at day 4. FIG. 11D shows a heat map of representative erythroid genomes (left) and innate immune genomes (right).

FIG. 12 shows that MED16 inhibits expression of innate immunity genes and erythroid genes in scRNA-seq. Fig. 12a.t-SNE plot shows 8 cell clusters of shSCR (n=17674) and shMED16 (n=14935) cells combined on day 4. FIG. 12B representative marker genes in different clusters. FIG. 12C.t-SNE shows cell clusters based on cell cycle.

FIG. 13 shows single cell RNA-seq analysis of shSCR/shMED16 cells of human primary hematopoietic stem and progenitor cell systems on day 4 of culture. FIG. 13A. Separate enrichment of GO terminology for red cell line and myeloid cell line up-regulated genes. Fig. 13B is a histogram showing the proportion of erythroid cells, myeloid cells, and other cell populations identified. FIG. 13C represents the expression of genes in different clusters between shSCR and shMED 16.

Fig. 14: FIG. 14A CD34 from cord blood in MED16 overexpression culture ⁺ Representative FACS surface marker analysis of cells on day 12. The enucleated reticulocytes were CD235a ⁺ Hoechst ^- . FIG. 14B qRT-PCR analysis of relative expression of MED16 gene after MED16 overexpression in human primary hematopoietic stem and progenitor cell systems from cord blood.

Fig. 15: figure 15A differential expression of MED16 in cd34+ cells in healthy subjects and MDS patients. FIG. 15B CD34 of healthy subjects of different subtypes and MDS patients ⁺ Expression level of MED16 in cells. Expression microarray data was downloaded from GEO database (GSE 19429). FIG. 15C CD34 from healthy subjects and AML and MDS patients from different databases ⁺ Differential expression of mediator subunits of different modules in cells.

Fig. 16: figure 16A. QPCR analysis of MED16 expression in bone marrow mononuclear cells from healthy subjects (n=9) and MDS patients (n=11). Figure 16b representative FACS surface marker analysis of patient cells after med16 knockdown. FIG. 16C CD235 after MED16 knockdown ⁺ Cell statistics. Figure 16d color of patient cell particles after med16 knockdown. Data represent mean ± SD; the p value was determined by a two-tailed student's t-test (p < 0.0001, p < 0.001, p < 0.01, p < 0.05).

FIG. 17 shows a representative up-regulated gene list after MED16 knockdown.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

In this document, the terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to").

The above features and advantages of the present invention and additional features and advantages of the present invention will be more clearly understood hereinafter from the following detailed description of embodiments taken in conjunction with the accompanying drawings.

The embodiments described herein with reference to the drawings are illustrative, explanatory and are intended to be generally understood. The embodiments should not be construed as limiting the scope of the invention. The same or similar elements and elements having the same or similar functions are denoted by the same reference numerals throughout the description.

The sequences of the respective shRNA and siRNA used in the examples of the present application are as follows.

shMED16-1(SEQ ID NO:1)：

TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCGACATTGACAAGGTCATGATTAGTGAAGCCACAGATGTAATCATGACCTTGTCAATGTCGATGCCTACTGCCTCGG

shMED16-2(SEQ ID NO:2)：

TCGAGAAGGTATATTGCTGTTGACAGTGAGCGATGGCTGCACAATGGTGTGAAATAGTGAAGCCACAGATGTATTTCACACCATTGTGCAGCCATTGCCTACTGCCTCGG

shMED15(SEQ ID NO:3)：

TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCGACAAGAACGAAGACAGAAATAGTGAAGCCACAGATGTATTTCTGTCTTCGTTCTTGTCGGTGCCTACTGCCTCGG

shMED23(SEQ ID NO:4)：

TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCGCCTGCTTATTACCAGCCTATTAGTGAAGCCACAGATGTAATAGGCTGGTAATAAGCAGGCGTGCCTACTGCCTCGG

Control shRNA (shSCR; SEQ ID NO: 5):

TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGG

real-time quantitative PCR primers:

q-MED16-F1：5'-GCTGCACAATGGTGTGAAACT-3'(SEQ ID NO:6)

q-MED16-R1：5'-AGAACTTGACTCGGGAGAACTT-3'(SEQ ID NO:7)

q-18S-F：5'-CAGCCACCCGAGATTGAGCA-3'(SEQ ID NO:8)

q-18S-R：5'-TAGTAGCGACGGGCGGTGTG-3'(SEQ ID NO:9)

examples

Example 1 intermediate Complex tail subunit inhibits bone marrow and erythroid development

To investigate the function of the mediator complex tail module in hematopoietic development, the human cd34+ primary hematopoietic stem and progenitor cell system from umbilical cord blood (beijing cord blood hematopoietic stem cell bank) was first used. Transfection of lentiviral vector pGIPZ-EGFP encoding shRNA for knock-down of tail module subunit or control shRNA (shSCR) into human CD34 ⁺ Primary hematopoietic stem cells and progenitor cells, and cell expansion and differentiation culture. The cell culture system was modified by published methods (Lee, H.Y. et al, PPAR-alpha and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal. Nature 522, 474-477) as follows.

Amplification stage (days 0-4): cells were grown at 10 in SFEM II medium (Beijing Zeping Technology) containing CC100 cytokine (Beijing Zeping Technology) and 2% penicillin/streptomycin ⁵ Culturing for 4 days at the concentration of individual cells/mL;

differentiation stage (days 5-14): cells were cultured in IMDM (Gibco) based differentiation medium containing 5ng/mL rIL-3 (Stem cell Technologies), 100ng/mL rhSCF (Stem cell Technologies) and 6U/mL rhEpo (Shenyang sansheng pharmaceutical, inc.).

Cells were transfected with shRNA (shred 16-1) or control shRNA (shrsc) that mediated the tail module subunit MED16 knockdown during the expansion phase of cell culture (day 2 of culture) and MED16 mRNA expression levels in cells were detected during the differentiation phase (day 5 of culture). The results indicate that a decrease in MED16 mRNA levels was detected after transfection of shMED16-1 compared to the control group (fig. 1A). Cells were assayed for CD235a expression by flow cytometry using anti-CD 71 antibodies (eBioscience, cat.# 12-0719-42) and CD235a antibodies (eBioscience, cat.# 17-9987-42) on days 4 through 14 of culture. The results indicate that MED16 knockdown cells showed a significant increase in CD235a expression compared to the control group, indicating that the erythrocyte differentiation process of hematopoietic stem and progenitor cells was significantly affected (fig. 1B). The flow gating chart in fig. 1B shows representative results on day 5.

Significant increases in CD235a were also shown on day 5 by shRNA knockdown of other tail subunits of the mediator complex, such as MED15 (shred 15) and MED23 (shred 23) (fig. 1C).

The effect on erythroid enucleation after MED16 knockdown was further examined. Similarly, cells were transfected with shRNA (shred 16-1) or control shRNA (shrscr) that mediated MED16 knockdown during the expansion phase of cell culture (day 2), and erythrocyte enucleation was detected on days 9 to 14 using anti-CD 235a antibodies and Hoechest 33342 staining. The results showed that the knockdown of MED16 promoted the process of enucleation of erythroid cells (fig. 1D), indicating that the knockdown of MED16 promoted the process of erythroid development and did not affect the normal production of erythrocytes. The flow gating chart in fig. 1D shows representative results on day 12.

It was also tested whether knockdown of the mediator tail subunit would affect apoptosis. The test method is as follows: shRNA transfection was performed as described above. On day 5 of culture, apoptosis was tested using an Annexin V-PE staining kit (Beyotime Biotechnology). Specifically, take 10 ⁵ CD34 ⁺ Cells were gently suspended by adding 195. Mu.l Annexin V-PE conjugate. Subsequently, 5. Mu.l of Annexin V-PE and 10. Mu.l of propidium iodide staining solution were added and gently mixed. Incubate for 15 minutes in the dark at room temperature and then place in an ice bath. Apoptosis was detected using flow cytometry. The results indicate that the knockdown of MED16 subunit did not affect apoptosis (fig. 2).

Colony formation assays were further performed, shRNA transfection was performed as described above, and day 5 of culture was followed for CD34 ⁺ Cells were cultured in MethoCult M4435 medium at a density of 100 cells/mL and 2 mL/well. Early erythroid progenitor colony forming units (Burst forming unit-erythroid, BFU-E) and late erythroid after 14 days of cultureCell colony count of the progenitor cell clone-forming unit (Colony forming unit-erythroid, CFU-E). The results show that the percentage of BFU-E and CFU-E in colonies was up-regulated after knocking down MED16 compared to control shRNA (FIG. 3A), while the single colony areas of BFU-E and CFU-E were unchanged (FIG. 3B). The single colony area of BFU-E and CFU-E indicates their ability to self-renew. The above results indicate that knockdown of MED16 promotes erythroid development of cd34+ hematopoietic stem/progenitor cells, but does not promote their colony formation and self-renewal capacity.

These results indicate that knockdown of an mediator complex tail module, such as MED16, MED15 or MED23, promotes bone marrow cell and erythrocyte development, and in particular accelerates erythrocyte development. And it does not affect the self-renewal capacity of erythroid progenitors.

Example 2 knockdown of MED16 promotes erythrocyte development

The role of MED16 in erythropoiesis was further investigated using siRNA mediated knockdown methods. The advantage of siRNA mediated knockdown over relatively long-term shRNA mediated knockdown is that it takes only 24-72 hours to effectively down-regulate gene expression, allowing for faster studies of cellular changes.

To examine the effect of MED16 knockdown on cell differentiation, cell culture was performed in the expansion and differentiation stages as described in example 1, and siRNA oligonucleotides (Sigma, s19494/s19495/s19493 equivalent mix) were transfected into CD34 in the differentiation stage (day of culture) ⁺ Among primary hematopoietic stem and progenitor cells, control transfected cells served as controls. Cell differentiation was assessed on day 8 of culture. Similar to the results of MED16 shRNA, MED16 siRNA effectively down-regulates MED16 expression at mRNA level (fig. 4A) and promotes erythroid differentiation of hematopoietic stem and progenitor cells (fig. 4B).

To investigate whether inhibition of MED16 generally promotes erythropoiesis, MED16 was also knocked down in the human erythroleukemia cell line K562 cells (purchased from ATCC). The cell line is a CML-like cell line that can undergo megakaryocyte differentiation and erythrocyte differentiation under different chemical induction (Polfus, L.M. et al, white-Exome Sequencing Identifies Loci Associated with Blood Cell Traits and Reveals a Role for Alternative GFI1B Splice Variants in Human Hematopsis. Am J Hum Genet 99, 481-488). The lentiviral vector pGIPZ-EGFP encoding the shRNA knockdown MED16 (shMED 16-1) was transfected into K562 cells cultured in vitro. 5 days after MED16 knockdown, the color of the cell pellet was clearly observed to become redder (FIG. 5A), and flow cytometry analysis of the cells showed increased CD235A expression of the cells (FIG. 5C).

Benzidine staining experiments were also performed on the cells. Briefly, 10 samples were removed from each sample 5 days after shRNA transfection ⁵ The K562 cells were centrifuged at 200rpm for 5 minutes, fixed in chilled methanol at room temperature for 2 minutes, and then naturally dried. 1 piece of benzidine (Sigma, cat#D5905) was dissolved in 10. Mu. L H added ₂ O ₂ To each sample was added 300 μl in 10mL PBS and left at room temperature for 1 hour. After washing with water, the slides were blocked and observed under a microscope. Benzidine staining results demonstrated that cells showed more hemoglobin accumulation after transfection of shMED16-1 knockdown MED16 compared to cells transfected with control shRNA (fig. 5B).

To test whether adult erythrocyte development requires MED16, tests were also performed using the human primary peripheral blood mononuclear cell system and the bone marrow mononuclear cell system. Bone marrow mononuclear cells and peripheral blood mononuclear cells were collected from Beijing university Hospital. After transfection of MED16 shRNA (shMED 16-1 or shMED 16-2) into cells, the knockdown efficiency was up to 70% (FIG. 6A). Cells with MED16 knockdown showed promotion of erythrocyte development (fig. 6B). These results indicate that inhibition of MED16 can generally promote erythroid cell development in vitro.

EXAMPLE 3 MED16 knockdown promotes in vivo reconstitution of myeloid and erythroid lineages

To determine the effect of MED16 on the reduction of hematopoietic development, human CD34 from cord blood was used ⁺ Primary hematopoietic stem and progenitor cell systems bone marrow transplantation experiments were performed in experimental animals. Cord blood is from (Beijing cord blood hematopoietic stem cell bank). Specifically, 10 from umbilical cord blood was transplanted to each mouse ⁵ CD34 ⁺ GFP ⁺ Cells, wherein the cells have been as in example 1The treatment was with control shRNA (shSCR) or MED16 shRNA (shMED 16-1).

NOD.Cg-Prkdcscid Il2rgtm1Vst/Vst mice (Beijing Vitalstar Biotechnology Co., ltd., 4 weeks old, females) were used and irradiated 24 hours (1.3 Gy) prior to implantation. Mice were sacrificed 14 weeks after transplantation. Peripheral blood was collected from the mouse orbit. And bone marrow and spleen suspensions were prepared by washing and cell dissociation in 1mL PBS. The samples were stained in a total volume of 200. Mu.l of staining buffer. Staining was performed at 1:100 dilution of each antibody. The antibody groups used were as follows: human CD45-APC-A750 (Beckman, cat. # A71119), CD33-APC (BioLegend, cat. # 366606), CD19-PE (Biosciences, cat. # 340720), CD3-PC5.5 (Beckman, cat. # A66327), CD71-PE (eBioscience, cat. # 12-0719-42), CD235a-APC (eBioscience, cat. # 17-9987-42), and mouse CD45-PC7 (BioLegend, cat. # 103114). The test was performed using a CytoFLEX flow cytometer. FIG. 7 shows a gating strategy for flow cytometry.

The results show that bone marrow cells of mice showed a higher percentage of erythroid cells (fig. 8A) and the percentage of myeloid cells was up-regulated (fig. 8B) 14 weeks after MED16 knockdown compared to control mice. The percentages of B cells and T cells were not significantly changed (fig. 8C, fig. 8D). Due to the low efficiency of cell engraftment after spleen and peripheral blood transplantation, there was no change in the percentages of erythroid and myeloid cells in spleen and peripheral blood (fig. 9A, fig. 9B). These results indicate that inhibition of MED16 promotes reconstitution of myeloid and erythroid lineages in vivo.

EXAMPLE 4 MED16 inhibits the expression of innate immunity genes and erythroid genes

As shown in the examples above, human primary hematopoietic stem and progenitor cells from MED16 knockdown have the property of promoting their development to erythroid progenitor cells, characterized by high expression levels of CD235 a. To reveal other molecular features associated with this phenotype, transcriptome analysis was performed using mRNA isolated from MED16 knockdown or control human primary hematopoietic stem and progenitor cell systems.

Specifically, CD34 on day 0 and day 4 after transfection of control shRNA (shSCR) or MED16 shRNA (shMED 16-1) was extracted with TRIzol (Invitrogen Company) ⁺ RNA from a cell sample. For RNA-seq, quality was assessed by Agilent 2100 Bioanalyzer. Mu.g of total RNA was used to prepare an RNA-seq library (Illumina, RS-122-2201). Two biological replicates of each sample were sequenced in HiSeq X-Ten (PE 150, illumina) of Novogene (Beijing). CD34 from MDS on day 0, day 4 of culture ⁺ Primary read counts of RNA-seq for shSCR and shMED16 samples of cells and bone marrow mononuclear cells. After checking the data quality using FastQC, paired-end reads were mapped to the hg19 version of the ginseng genome by Hisat2 (Kim, D. Et al, HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12, 357-360) and read counts were performed using HTSeq (Anders, S. Et al, HTSeq- -a Python framework to work with high-throughput sequencing data.Bioinformation 31, 166-169). The file format and index file were hidden using samtools (Li, H. Et al The Sequence Alignment/Map formats and SAMtools. Bioinformatics 25, 2078-2079). Read counts were normalized to TPM (per million transcripts) (Wagner, G.P. et al, measurement of mRNA abundance using RNA-seq data: RPKM measure is inconsistent among samples. Thery Biosci 131, 281-285) as a measure of RNA transcription. The DESeq2 (Love, M.I. et al Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.genome Biol 15,550) package was used to calculate the differentially expressed genes if they exceeded a threshold (|fold change|) >1.5 and FDR<0.05 It is considered significant). The heat and volcanic maps were performed using version R with ggplot2 or pheeatmap software package version 4.0.2.

The results indicated 831 up-regulated genes and 2033 down-regulated genes were observed on day 0 of MED16 knockdown (fold change >1.5, p < 0.05) (fig. 10A). Gene ontology analysis of the up-regulated genes showed that many of the basic biological processes of innate immunity were significantly represented, while the down-regulated genes showed normal cellular function (FIG. 10B).

Gene ontology enrichment analysis was performed by the Metascape (Zhou, Y. Et al Metascape provides a biologist-oriented resource for the analysis of systems-level data sets, nature communications 10,1523) on-line tool use. Gene ontology biological processes (GO) or Kyoto Encyclopedia of Genes and Genomes pathways (KEGG) were subjected to a GeneChip enrichment analysis (GSEA) using GSEA software (Subramannian, A. Et al Gene set enrichment analysis: a knowledges-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A102,15545-15550). Analysis confirmed that HSC lineage gene signatures, cytokine gene signatures and IL22 signature enrichment (Raundhal, M.et al, block of IL-22signaling reverses erythroid dysfunction in stress-induced and Nature immunology 22, 520-529) were associated with stress hematopoiesis (FIG. 10C) (Zhao, J.L.et al, conversion of danger signals into cytokine signals by hematopoietic Stem and progenitor cells for regulation of stress-induced preserved tissue Cell 14,445-459; zhao, J.L. And Baltimore, D.Regulation of stress-induced preserved tissue culture 22,286-292; anderson, G.et al, K.L.Regulation of stress-induced preserved tissue culture 27, 279-287).

More importantly, 198 up-regulated genes and 244 down-regulated genes were found on day 4 of MED16 knockdown (fold change >1.5, p < 0.05) (fig. 11A). Gene ontology analysis of up-regulated genes in the MED16 knockdown day 4 human primary hematopoietic stem and progenitor cell system also showed significant expression of the innate immune gene process. In addition, hemoglobin metabolic processes are presented. This was confirmed by Gene Set Enrichment Analysis (GSEA), which is consistent with the phenotype (fig. 11B, fig. 11C). The representative gene list also indicates the cellular hemoglobin metabolic process (fig. 11D).

To further characterize the role of MED16 knockdown in erythropoiesis, MED16 knockdown human CD34 on day 4 of in vitro differentiation ⁺ The scRNA-seq analysis was performed in cells or cells transfected with control shRNA (FIGS. 12A-C). Analysis of the RNA expression levels in the different clusters indicated the difference between control shRNA and MED16 knockdown cells. The gene ontology analysis of the up-regulated genes in the erythrocyte clusters showed erythrocyte differentiation characteristics, and the gene ontology analysis of the up-regulated genes in the GMP cell clusters showed the regulation of cytokine production characteristics (fig. 13A). Erythrocyte genes (e.g., GYPA, SLC4 A1) are up-regulated in erythrocytes. Innate immunity genes (e.g., GRN, S100 A9) was up-regulated in GMP cells (fig. 13B).

The results indicate that MED16 knockdown was associated with an increase in the percentage of erythroid cells, consistent with the phenotype (fig. 13C). Taken together, these results indicate that reduced MED16 results in the acquisition of erythrocyte genetic and innate immune genetic characteristics, while inhibition of MED16 expression promotes the erythrocyte differentiation process.

Example 5 high expression of MED16 as a biomarker for MDS, providing a potential therapeutic target for MDS

It was found in the study that reduced MED16 promoted erythroid differentiation (see examples 1-4). Furthermore, lentivirus pCDH-MCS-T2A-copGGFP-MSCV overexpressing MED16 was transfected into human CD34+ primary hematopoietic stem and progenitor cells as described in example 1, demonstrating that MED16 overexpression can inhibit erythroid enucleation (FIGS. 14A, 14B).

To study the role of MED16 in MDS, primary BM CD34 from 183 MDS patients was first used ⁺ Microarray-based gene expression profiling data of cells to investigate whether MED16 expression is correlated with disease and its prognosis (Chen, B.Y. et al, cited above; pellagatti, A. Et al, deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells, leukemia 24,756-764; rhyasen, G.W. et al, targeting IRAK1 as a therapeutic approach for myelodysplastic synrome.cancer cell 24,90-104) (FIG. 15A). Microarray data or RNA-seq data from GSE19429, GSE15061 and Genomic Data Commons (GDC) for MDS patients https:// gdc.cancer.gov/about-data/publications/laml_2012). All patient samples were provided by the Beijing university people's hospitals. All procedures were approved by the relevant ethics committee and written informed consent was obtained for all participants.

The results indicate that MDS patients show higher MED16 expression than healthy persons. The results were consistent across populations of different genotypes (fig. 15B). MED16 showed significantly higher expression in MDS patients in different databases compared to other subunits of the mediator complex (fig. 15C).

Subsequently, quantitative polymerase chain reaction (qPCR) analysis was performed on MDS patient samplesThe specific method is as follows. Collection 10 ⁶ Cells were seeded and centrifuged at 2000rpm for 5 minutes; adding 500 mu L Trizol, mixing, and standing at room temperature for 2-3 min; 100 μl of chloroform was added, mixed well, and centrifuged at 13000rpm at 4deg.C for 10 minutes; after centrifugation, the supernatant was taken into a fresh EP tube, isopropanol was added and mixed upside down at-20℃for 20 minutes. Centrifugation at 13000rpm at 4℃for 10 min; the supernatant was discarded, 500. Mu.l of 75% ethanol was added, and centrifuged at 13000RPM at 4℃for 10 minutes; the supernatant was discarded, and 20. Mu.l of RNase-free water was added for later use. Real-Time PCR was detected by the LightCycler 480Real-Time PCR System (Roche). Each experiment was independently repeated at least 3 times for each sample. The relative expression level was normalized to 18S rRNA expression.

The results demonstrate that MED16 expression in MDS patient samples is significantly higher than in healthy subjects (fig. 16A). The above results suggest that inhibition of MED16 in hematopoietic progenitor cells from patients with MDS may restore normal erythropoiesis. Thus, lentiviral vectors encoding MED16 shRNA were transfected into bone marrow mononuclear cells from MDS patients and liquid culture differentiation assays were performed. MED16 knockdown in patient 1 (women with MDS multiple lineage dysplasia (MDS-MLD)) results in phase III (CD 235) at day 4 of differentiation ⁺ CD71 ⁺ ) While cells transfected with control shRNA are partially blocked at less mature stage II (CD 235 ^- CD71 ⁺ ). And, the cell pellet became redder after MED16 knockdown (fig. 16B-D). MED16 knockdown in patient 2 and patient 3 also showed promotion of erythrocyte differentiation (fig. 15C).

On day 4 of differentiation, the effect of MED16 knockdown on erythrocyte differentiation was tested using the RNA seq method of cell samples. RNA was extracted from bone marrow mononuclear cell samples of MDS cultured on day 0, day 4 after transfection of control shRNA (shSCR) or MED16 shRNA (shMED 16) with TRIzol (Invitrogen Company). For RNA-seq, the experimental procedure is as described in example 3. Analysis showed that MED16 knockdown increased expression of innate immune genes and erythrocyte genes compared to cells transduced with control shRNA (fig. 17). Taken together, these results indicate that MED16 knockdown restores erythrocyte differentiation in primary cell samples of MDS, indicating MED16 is a potential target for the treatment of MDS.

Sequence listing

<110> university of Beijing

<120> mediator complex subunit inhibitors and uses thereof

<130> C22P1388

<160> 9

<170> patent in version 3.5

<210> 1

<211> 110

<212> DNA

<213> artificial sequence

<220>

<223> shMED16-1

<400> 1

tcgagaaggt atattgctgt tgacagtgag cgccgacatt gacaaggtca tgattagtga 60

agccacagat gtaatcatga ccttgtcaat gtcgatgcct actgcctcgg 110

<210> 2

<211> 110

<212> DNA

<213> artificial sequence

<220>

<223> shMED16-2

<400> 2

tcgagaaggt atattgctgt tgacagtgag cgatggctgc acaatggtgt gaaatagtga 60

agccacagat gtatttcaca ccattgtgca gccattgcct actgcctcgg 110

<210> 3

<211> 110

<212> DNA

<213> artificial sequence

<220>

<223> shMED15

<400> 3

tcgagaaggt atattgctgt tgacagtgag cgccgacaag aacgaagaca gaaatagtga 60

agccacagat gtatttctgt cttcgttctt gtcggtgcct actgcctcgg 110

<210> 4

<211> 110

<212> DNA

<213> artificial sequence

<220>

<223> shMED23

<400> 4

tcgagaaggt atattgctgt tgacagtgag cgcgcctgct tattaccagc ctattagtga 60

agccacagat gtaataggct ggtaataagc aggcgtgcct actgcctcgg 110

<210> 5

<211> 110

<212> DNA

<213> artificial sequence

<220>

<223> control shRNA

<400> 5

tcgagaaggt atattgctgt tgacagtgag cgcaggaatt ataatgctta tctatagtga 60

agccacagat gtatagataa gcattataat tcctatgcct actgcctcgg 110

<210> 6

<211> 21

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 6

gctgcacaat ggtgtgaaac t 21

<210> 7

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 7

agaacttgac tcgggagaac tt 22

<210> 8

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 8

cagccacccg agattgagca 20

<210> 9

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 9

tagtagcgac gggcggtgtg 20

Claims

1. A method of promoting differentiation of hematopoietic stem cells or blood progenitor cells into erythrocytes or their precursors, the method comprising the step of contacting the hematopoietic stem cells or blood progenitor cells with an inhibitor that inhibits the expression and/or activity of the tail subunit MED16 of the mediator complex.

2. The method according to claim 1, wherein the blood progenitor cells are selected from the group consisting of multipotent progenitor cells (MPP), myeloid progenitor cells (MyP), megakaryocyte-erythroid progenitor cells (MEPs) or erythroid progenitor cells, and/or

The precursor cells of the erythrocytes are selected from the group consisting of early erythroid progenitor colony forming units (BFU-E), late erythroid progenitor colony forming units (CFU-E), pro-erythrocytes (Pro), promyelocytes (Baso), erythroblasts (Ortho) and reticulocytes.

3. The method according to claim 1 or 2, wherein the inhibitor is selected from the group consisting of an inhibitory RNA molecule, a coding sequence thereof, a vector comprising said coding sequence and a small molecule compound.

4. A method according to claim 3, wherein the inhibitory RNA molecule is selected from siRNA, shRNA and microRNA.

5. A method according to claim 3, wherein the vector is a viral vector.

6. The method according to claim 4, wherein the vector is a viral vector.

7. The method according to claim 5 or 6, wherein the viral vector is selected from the group consisting of lentiviral vectors and adeno-associated viral vectors.

8. Use of an inhibitor that inhibits the expression and/or activity of the tail subunit MED16 of an mediator complex in the manufacture of a medicament for treating or preventing myelodysplastic syndrome (MDS) or Chronic Myelogenous Leukemia (CML) in a subject.

9. Use according to claim 8, wherein the inhibitor is selected from the group consisting of inhibitory RNA molecules, coding sequences thereof, vectors comprising said coding sequences and small molecule compounds.

10. Use according to claim 9, wherein the inhibitory RNA molecule is selected from siRNA, shRNA and microRNA.

11. Use of a reagent for detecting expression and/or activity of tail subunit MED16 of an mediator complex in the preparation of a kit for diagnosing MDS in a subject, the kit for use in a method of:

a. contacting the agent with a sample from the subject;

b. Quantifying the expression and/or activity of MED16 in the sample,

wherein the sample comprises hematopoietic stem cells or blood progenitor cells, wherein a high expression and/or activity of MED16 in the sample from the subject, as compared to a healthy subject, is indicative of the presence or risk of MDS.

12. Use of an agent that detects the expression and/or activity of tail subunit MED16 of an mediator complex in the preparation of a kit for prognosis of a patient with MDS, the kit being for use in a method of:

a. contacting the reagent with a sample from the patient;

b. quantifying the expression and/or activity of MED16 in the sample,

wherein the sample comprises hematopoietic stem cells or blood progenitor cells, wherein a high expression and/or activity of MED16 in the sample from the patient compared to a healthy subject is indicative of a poor prognosis.

13. Use according to claim 11 or 12, wherein the reagent is a detection reagent for a method selected from the group consisting of: flow cytometry, ELISA, immunohistochemical analysis, PCR-based quantitative methods, in situ hybridization, transcriptome analysis, microarray-based gene expression profiling.

14. A pharmaceutical composition comprising an inhibitor of the expression and/or activity of tail subunit MED16 of an intermediate complex, and optionally a pharmaceutically acceptable carrier and/or excipient, for use in treating MDS or CML in a subject.