CN114984224A

CN114984224A - Application of biomarker-targeted agent in preparation of medicine for relieving/treating neuropathic pain

Info

Publication number: CN114984224A
Application number: CN202210673118.5A
Authority: CN
Inventors: 许海玉; 张彦琼; 吴丹; 张俊红; 赵春晖; 王萍
Original assignee: Institute of Materia Medica of CAMS
Current assignee: Institute of Materia Medica of CAMS
Priority date: 2022-06-14
Filing date: 2022-06-14
Publication date: 2022-09-02
Anticipated expiration: 2042-06-14
Also published as: CN114984224B

Abstract

The present disclosure relates to the use of an agent targeting a biomarker, which is Cebpb, in the preparation of a medicament for the treatment/alleviation of neuropathic pain. By inhibiting the overexpression of Cebpb, the expression of Clec7a is reduced, and the phosphorylation levels of Syk, ERK and JNK and the cell apoptosis induced by related proteins such as NLRP3, GSDMD and the like are inhibited, so that the drug effect of relieving/treating neuropathic pain is exerted.

Description

Application of biomarker-targeted agent in preparation of medicine for relieving/treating neuropathic pain

Technical Field

The disclosure relates to the technical field of biomedicine, in particular to application of a biomarker-targeted agent in preparation of a medicine for relieving/treating neuropathic pain.

Background

NP (Neuropathic pain) is pain caused or caused by primary damage or dysfunction of the nervous system, manifested as spontaneous persistent pain, ectopic pain or hyperalgesia, which is one of the most common clinical conditions, long lasting and difficult to cure, and seriously affects the quality of life of patients. The pathogenesis of NP is complex involving multiple aspects of the peripheral and central nervous systems and is not yet fully elucidated. Most of the clinical treatment medicines are simple symptomatic treatment, and the used medicines are mostly aimed at a single target point, so that the effect is not obvious and the adverse reaction is more. In recent years, a number of studies have found that neuroinflammation induced by pro-inflammatory cytokines is a major cause of NP production and progression. Therefore, based on inflammatory cytokines, the research on the NP production and analgesic mechanism has important theoretical value and practical significance.

The small interfering RNA has strict sequence specificity, high efficiency and biological heredity, can specifically and efficiently block the expression of homologous genes in vivo, promote the degradation of homologous mRNA, induce cells to show the phenotype of specific gene deletion, and has simple operation and high specificity. The present disclosure provides an agent targeting a molecular marker for inhibiting the expression of a gene to thereby alleviate/treat chronic neuropathic pain.

Disclosure of Invention

The application of the biomarker-targeted agent in preparation of a medicine for relieving/treating neuropathic pain is provided, the biomarker-targeted agent reduces the expression of a target gene C/EBP beta, and remarkably reduces the expression of Clec7a, so that the phosphorylation levels of Syk, ERK and JNK and apoptosis of cells induced by related proteins such as NLRP3 and GSDMD are inhibited, and the drug effect of relieving/treating neuropathic pain is exerted.

To achieve the above objects, in one aspect, the present disclosure provides use of an agent targeting a biomarker, which is Cebpb, in the preparation of a medicament for treating/alleviating neuropathic pain.

According to the present disclosure, wherein the biomarker targeting agent comprises an inhibitor of Cebpb.

According to the present disclosure, wherein the inhibitor of Cebpb comprises at least one of siRNA, shRNA, antisense oligonucleotide, and loss-of-function gene of Cebpb gene.

According to the disclosure, wherein the inhibitor of Cebpb is at least one of an interfering molecule, a nucleic acid inhibitor, a binding molecule, a small molecule compound directed against the Cebpb gene or a gene upstream or downstream thereof.

According to the disclosure, wherein the siRNA comprises siCebpb,

the nucleic acid sequences of the sense strand and the antisense strand of the siCebpb are shown as SEQ ID NO.1 and SEQ ID NO. 2:

AGAACGAGCGGCUGCAGAATT SEQ ID NO.1，

UUCUGCAGCCGCUCGUUCUTT SEQ ID NO.2；

the shRNA comprises shCebpb, and the nucleic acid sequences of a sense strand and an antisense strand of the shCebpb are shown as SEQ ID NO.3 and SEQ ID NO. 4:

GGATCCAGAACGAGCGGCTGCAGAAGACTCGAGAGAACGGATATAGAGGAAATCTTTTTT SEQ ID NO.3,

GAATTCAGAACGAGCGGCTGCAGAAGACTCGAGTCTTCTGCAGCCGCTCGTTCT SEQ ID NO.4。

according to the present disclosure, the dosage form of the drug includes at least one of tablets, capsules, pills, powders, granules, suspensions, oral solutions, powder injections, and injections.

The present disclosure provides a pharmaceutical composition for treating/relieving neuropathic pain, which contains siRNA and/or shRNA as an effective ingredient, wherein the siRNA is siCebpb,

AGAACGAGCGGCUGCAGAATT SEQ ID NO.1，

UUCUGCAGCCGCUCGUUCUTT SEQ ID NO.2。

GGATCCAGAACGAGCGGCTGCAGAAGACTCGAGAGAACGGATATAGAGGAAATCTTTTTT SEQ ID NO.3,

GAATTCAGAACGAGCGGCTGCAGAAGACTCGAGTCTTCTGCAGCCGCTCGTTCT SEQ ID NO.4。

according to the present disclosure, a pharmaceutically acceptable carrier is further included in the pharmaceutical composition; the volume ratio of the effective components to the pharmaceutically acceptable carrier is 1: (0.5-1.5).

According to the present disclosure, wherein the pharmaceutically acceptable carrier comprises at least one of a liposome, a cationic polymer, and a nanomaterial.

According to the disclosure, the concentration of the siRNA and/or shRNA as an effective ingredient is 20-80. mu.M.

Through the technical scheme, the disclosure provides application of a biomarker-targeted agent in preparation of a medicine for relieving/treating neuropathic pain, wherein the biomarker-targeted agent inhibits over-expression of Cebpb transcription factors, reduces expression levels of Clec7a genes, phosphorylation levels of Syk, ERK and JNK, expression levels of cell apoptosis-related proteins NLRP3, GSDMD, IL-1 beta, IL-18 and the like, remarkably alleviates occurrence of cell apoptosis, forms a complete pathway for inhibiting upstream transcription factors, downstream inflammatory factors and cell apoptosis, and exerts the drug effect of relieving/treating neuropathic pain.

Additional features and advantages of the present disclosure will be set forth in the detailed description which follows.

Drawings

The accompanying drawings, which are included to provide a further understanding of the disclosure and are incorporated in and constitute a part of this specification, illustrate embodiments of the disclosure and together with the description serve to explain the disclosure without limiting the disclosure. In the drawings:

FIG. 1 shows that overexpression of Clec7a correlates with genes associated with cell apoptosis in the CCI model.

FIG. 2 is a graph showing that siRNA inhibition of Clec7a expression reduced cellular apoptosis in the spinal cord of CCI rats.

Fig. 3 is a graph showing that siRNA inhibited expression of Clec7 a.

Fig. 4 is a Tunel staining verification diagram of inhibition of Clec7a expression by siRNA.

FIG. 5 is a verification chart showing that C/EBP β is a transcription factor of Clec7 a.

FIG. 6 is a Tunel staining pattern of siCebpb inhibiting C/EBP β expression reducing cellular apoptosis.

FIG. 7 is a graph showing the results of inhibition of C/EBP β expression by shCebpb.

FIG. 8 is a Tunel staining pattern of shCebpb inhibiting C/EBP β expression to reduce cell apoptosis.

Detailed Description

The following describes in detail specific embodiments of the present disclosure. It should be understood that the detailed description and specific examples, while indicating the present disclosure, are given by way of illustration and explanation only, not limitation.

In one aspect, the disclosure provides the use of an agent that targets a biomarker, which is Cebpb, in the preparation of a medicament for the treatment/alleviation of neuropathic pain.

Optionally, the biomarker targeting agent comprises an inhibitor of Cebpb.

Optionally, the inhibitor of Cebpb comprises at least one of siRNA, shRNA, antisense oligonucleotide and loss of function gene of Cebpb gene.

Optionally, the inhibitor of Cebpb is at least one of an interfering molecule, a nucleic acid inhibitor, a binding molecule, a small molecule compound directed against the Cebpb gene or a gene upstream or downstream thereof.

Optionally, the siRNA comprises siCebpb,

AGAACGAGCGGCUGCAGAATT SEQ ID NO.1，

UUCUGCAGCCGCUCGUUCUTT SEQ ID NO.2。

GGATCCAGAACGAGCGGCTGCAGAAGACTCGAGAGAACGGATATAGAGGAAATCTTTTTT SEQ ID NO.3，

GAATTCAGAACGAGCGGCTGCAGAAGACTCGAGTCTTCTGCAGCCGCTCGTTCT SEQ ID NO.4。

optionally, the dosage form of the medicament comprises at least one of tablets, capsules, pills, powder, granules, suspensions, oral solutions, powder injections and injections.

In another aspect, the present disclosure provides a pharmaceutical composition for treating/relieving neuropathic pain, which contains siRNA and/or shRNA as an effective ingredient,

the siRNA is siCebpb, and the nucleic acid sequences of a sense strand and an antisense strand of the siCebpb are shown in SEQ ID NO.1 and SEQ ID NO. 2:

AGAACGAGCGGCUGCAGAATT SEQ ID NO.1，

UUCUGCAGCCGCUCGUUCUTT SEQ ID NO.2。

GGATCCAGAACGAGCGGCTGCAGAAGACTCGAGAGAACGGATATAGAGGAAATCTTTTTT SEQ ID NO.3,

GAATTCAGAACGAGCGGCTGCAGAAGACTCGAGTCTTCTGCAGCCGCTCGTTCT SEQ ID NO.4。

optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier; the volume ratio of the effective components to the pharmaceutically acceptable carrier is 1: (0.5-1.5).

Optionally, the pharmaceutically acceptable carrier comprises at least one of a liposome, a cationic polymer, and a nanomaterial.

Optionally, the concentration of the siRNA and/or shRNA as an active ingredient is 20-80. mu.M.

The present disclosure is further illustrated by the following examples, but is not to be construed as being limited thereby.

Example 1

This example illustrates that Cebpb can be a target for the alleviation or treatment of NP.

The detection of the gene chip of the present disclosure was performed by shanghai GMINIX biotechnology using Affymetrix gene chip rat gene 2.0ST array; transcriptome sequencing was performed by the biotechnology company, kinoform, and sequencing libraries were generated using the nebnex ultra RNA library of Illumina (NEB, usa).

The CCI (chronic constriction in nerve) model used in this disclosure is one of the most commonly used animal models in NP studies, and it has been widely used in research because of ectopic pain and thermal hyperalgesia caused by compression of nerves by 4 loose ligatures on one sciatic nerve trunk. Studies have shown that CCI models are often associated with strong local neuroinflammation, including intra-neural edema, neural structural disorders, and immune cell infiltration, with significantly reduced mechanical paw withdrawal thresholds in the CCI model group compared to Sham (Sham) rats (fig. 1A).

First, gene chip (n-3, pooled) and transcriptome sequencing (n-4) were performed based on spinal cord samples from Sham and CCI rats. The results show that these two tests identified 602 (361 up-regulated genes and 241 down-regulated genes) and 1304 (667 up-regulated genes and 637 down-regulated genes) differential genes between the Sham and CCI groups, respectively (fig. 1B and C). Then, based on FC value (Fold change) and P value, the top differential genes in the two batches of results were selected, merged, and further the genes that have been studied more in NP were excluded by literature research, and finally the target gene was focused on Clec7a (FC 6.5039 and 12.2381, respectively). High expression of Clec7a in the CCI model was further verified by immunofluorescence experiments (n-4), qPCR (n-6), Western Blot (n-6) (fig. 1D-F).

In transcriptome sequencing data, the FC value ranked first was NLRP3, a gene primarily involved in the classical pathway of cellular apoptosis. Pearson correlation analysis was performed on the expression of cell apoptosis-related genes NLRP3, IL1 beta and IL18 in the CCI model and the correlation with the expression of the target gene Clec7 a. The results show that the expression of Clec7a mRNA is significantly and positively correlated with the expression of NLRP3, IL1 β and IL18 (fig. 2).

Example 2

In vivo experiments prove that Clec7a can be used as a target for alleviating or treating NP, and the NP is further alleviated by knocking down the expression of Clec7a by injecting siClec7a into a sheath.

Inhibition of NLRP 3-induced cellular apoptosis to alleviate NP: using the siRNA interference (small interfering RNA) method, whether it is possible to inhibit Clec7a by inhibiting NLRP 3-induced apoptosis in cells was examined by intrathecally injecting siClec7a into CCI rats to locally knock down Clec7a expression, thereby alleviating NP. The experimental animals were divided into 5 groups (Sham, Sham + si-NC, CCI + si-NC, CCI + siClec7a, NC is Negative control, Negative control). The nucleic acid sequences of the sense and antisense strands of si-NC are shown in SEQ ID NO.5 and 6, and the nucleic acid sequences of the sense and antisense strands of siClec7a are shown in SEQ ID NO.7 and 8.

5-UUCUCCGAACGUGUCACGUTT-3 SEQ ID NO.5，

5-ACGUGACACGUUCGGAGAATT-3 SEQ ID NO.6；

5-GAGUUCAUUGAAAGCCAAATT-3 SEQ ID NO.7，

5-UUUGGCUUUCAAUGAACUCTT-3 SEQ ID NO.8；

In ethology, the mechanical paw withdrawal threshold was significantly reduced in CCI group rats compared to Sham group; the mechanical paw withdrawal threshold was significantly elevated in CCI + siClec7a group compared to CCI + si-NC group, with a significant reduction in pain (n-10) (fig. 3A); at the molecular level, by Western Blot (n ═ 9), immunohistochemistry (n ═ 6) experiments, it was shown that: the intrathecal injection of siClec7a significantly reduced the expression of Clec7a in rat spinal cord; the expression of cell apoptosis related proteins NLRP3, GSDMD and the like is obviously reduced by reducing the phosphorylation levels of Syk, ERK and JNK; ELISA experiments showed that intrathecal injection of siClec7a inhibited Clec7a expression, significantly reduced the expression of inflammatory factors IL1 β and IL18 in CCI rat serum (n ═ 9) (FIGS. 3B-E). The Tunel staining test, a method for detecting the occurrence of apoptosis in cells or tissues, can also visually reflect the occurrence of apoptosis, and the results show that the inhibition of Cle c7a expression significantly reduces the occurrence of apoptosis (n ═ 6) in the spinal cord of CCI rats (FIGS. 3F and 4).

Example 3

It was confirmed that C/EBP β is a transcription factor of Clec7 a: first, TFSEARCH Search software: (http:// www.cbrc.jp/research/db/TFSEARHtml), C/EBP β was predicted to share 17 possible binding sites on the 2000bp front Clec7a promoter region (fig. 5A); to further confirm the specific binding sites, the present disclosure performed dual-luciferase reporter experiments, transfecting Clec7a promoter reporter vectors (0-500bp, 0-100bp, 0-1500bp, 0-2000bp) of different lengths on HEK293T cellsAnd then detecting luciferase activity. The results showed that deletion of the remaining binding sites but retaining the first two binding sites (0-500bp) did not affect luciferase activity, i.e. did not affect the transcriptional activity of C/EBP β (n ═ 3) in all reporter vectors (fig. 5B); the main binding site of C/EBP beta on Clec7a is shown to be within 0-500bp of promoter, then the predicted binding site sequence within 0-500bp (-483bp to-467 bp) is mutated and constructed into a vector, HEK293T cells are transfected, and luciferase activity is detected. The results show that the transcriptional activity of C/EBP β on Clec7a decreased 3.5-fold (n ═ 3) after mutation (fig. 5C), indicating that C/EBP β may be a transcription factor for Clec7a, positively regulating Clec7a transcription.

And (3) verifying the binding of C/EBP beta and an endogenous Clec7a promoter region: CHIP analysis was performed by CHIP-qPCR experiments in wild-type BV2 microglia and apoptosis model cells (LPS + ATP treatment) using C/EBP β antibodies or IgG negative controls, and qPCR experiments were performed on the pulled down DNA-protein design primers Clec7a-CHIP-q1, Clec7a-CHIP-q2 and Clec7a-CHIP-q 3. The sequences of the sense strand and the antisense strand of the Clec7a-CHIP-q1 primer are shown as SEQ ID NO.7 and 8, the sequences of the sense strand and the antisense strand of the Clec7a-CHIP-q2 primer are shown as SEQ ID NO.9 and 10, and the sequences of the sense strand and the antisense strand of the Clec7a-CHIP-q3 primer are shown as SEQ ID NO.11 and 12.

Clec7a-CHIP-q1

F：5-ATGGGCCAGGGTCATCTTCC-3 SEQ ID NO.9，

R：5-GCAGCGAGTGAGAGCCTTC-3 SEQ ID NO.10；

Clec7a-CHIP-q2

F：5-TGTTCTCCTTGTTGACTTACAGC-3 SEQ ID NO.11，

R：5-GCACTGGCTTCATTCTTCTGGA-3 SEQ ID NO.12；

Clec7a-CHIP-q3

F：5-TTCGCTTTGTGTCGCTGGAG-3 SEQ ID NO.13，

R：5-TATAACTGCCTGGAGTCGG-3 SEQ ID NO.14；

The results show that the target gene Clec7a of C/EBP β was significantly increased in the apoptosis model cells compared to wild-type cells (fig. 5D and E), indicating that C/EBP β is able to bind to the Clec7a promoter region and activate Clec7a transcription.

Example 4

This example demonstrates that siCebpb can inhibit the over-expression of C/EBP β, and thus inhibit the over-expression of Clec7a, reduce the occurrence of apoptosis, and alleviate/treat NP.

The CCI rats were injected intrathecally with siRNA and the experimental animals were divided into 5 groups in total (Sham, Sham + si-NC, CCI + si-NC, CCI + siCebpb).

In the behavioural field, the mechanical paw withdrawal threshold of CCI group rats was significantly reduced compared to Sham group; the mechanical paw withdrawal threshold was significantly elevated in the CCI + siCebpb group compared to the CCI + si-NC group, with a significant reduction in pain (n-10) (fig. 6A);

at the molecular level, by Western Blot (n ═ 9), immunohistochemistry (n ═ 6) experiments, it was shown that: the intrathecal injection of siCebpb significantly reduces the expression of C/EBP beta in the spinal cord of the rat; and significantly reduces the expression of Clec7a and the phosphorylation levels of Syk, ERK and JNK, and the expression of cell apoptosis-related proteins NLRP3, GSDMD and the like (FIGS. 6B-C);

the results of the Tunel staining experiments showed that inhibition of C/EBP β expression significantly reduced the occurrence of cellular focal death (n ═ 6) in the spinal cord of CCI rats (fig. 6D).

Example 5

This example demonstrates that shCebpb can knock down C/EBP β and reduce cellular apoptosis by reverting experiments, thereby alleviating or treating NP.

Construction of lentiviral vector pLV.1: experimental procedure (T4 ligase approach): (1) synthesizing single-stranded DNA fragments of sense and antisense; (2) annealing the single-stranded DNA fragment into a double strand; (3) the target gene is connected to the carrier fragment by T4 ligase at 22 ℃ for 30min, and the process is shown in the table 1; (4) transforming DH5 alpha competent cells, selecting a single colony, and carrying out PCR identification; (5) sequencing positive bacteria; (6) comparing the sequencing result, extracting the plasmid from the bacteria with the correct sequence and preserving the strain.

TABLE 1T 4 ligase enzyme Line systems

TABLE 2 Experimental reagents

Name (R)	Brand	Goods number
			HiPure Tissue DNA Mini Kit (genome extraction Kit)	Magen	D3121-03
Primer (Primer)	Hongxn corporation
			PrimeSTAR Max DNA Polymerase (PCR enzyme)	TAKARA	R045A
Clonexpress II One Step Cloning Kit (recombinase)	Novonza Co Ltd	C112-01
			T4 DNA Ligase (T4 Ligase)	Takara	2011A
Hipure Plasmid EF Midi Kit (Zhongti Plasmid)	Magen	P1113-03
			Hipure Gel Pure DNA Mini Kit (Gel recovery Kit)	Magen	D2111-02
Anhydrous ethanol	Guangzhou chemical reagent
			Agarose (agarose)	BIOWEST	G10

TABLE 3 Experimental instruments

The sense and antisense strands of the shRNA sequence are shown in SEQ ID NO.3 and 4, and the plasmid vector information is shown in Table 4.

GGATCCAGAACGAGCGGCTGCAGAAGACTCGAGAGAACGGATATAGAGGAAATCTTTTTT SEQ ID NO.3

GAATTCAGAACGAGCGGCTGCAGAAGACTCGAGTCTTCTGCAGCCGCTCGTTCT SEQ ID NO.4

TABLE 4

Full name of plasmid	pLV.1-shCebpb
		Plasmid size (bp)	7906bp
Cloning of empty vectors	pLV.1
		Promoters	H1 promoter
Replicon systems	Ori，f1 ori，SV40 ori
		Eukaryotic cell selection for resistance	Puror (puromycin resistance)
Prokaryotic cell selection for resistance	AmpR (ampicillin resistance)
		Fluorescent label	EGFP (enhanced green fluorescence)
Cloning of enzyme sites	BamHI and EcoRI
		Length of inserted gene	66bp
Insertion sequence	shRNA sequence for mus Cebpb

Construction of pLVSO5-Clec7a vector: (1) synthesizing gene primers, and carrying out PCR (polymerase chain reaction) to call a CDS (coding sequence) of the gene; (2) carrying out enzyme digestion on the vector; (3) connecting the target gene to the carrier fragment by T4 ligase at 22 ℃ for 30 min; (4) transforming DH5 alpha competent cells, selecting single colonies, and performing PCR identification; (5) sequencing positive bacteria; (6) comparing the sequencing result, extracting the plasmid from the bacteria with correct sequence and preserving the strain.

TABLE 5T 4 ligase enzyme Line systems

The experimental reagent and the experimental instrument are shown in tables 2 and 3, and the inserted gene sequence is shown in SEQ ID NO.15

gaattcCGCCACCatggacgaagatggatatactcaattagacttcggcactcgaaacatccacaaaagacctgtaaaatcagagaaaggaagcccagctccatcttctcgttggcggtccattgcggtagctttaggaatcctgtgcttgctcacagtagtggtcgcagcagtgctgggtgccctagcatttcggagattcaattcagggagatatccagaggagaaagacaacttcccatcaagaaataaggagaaccacaaacccacagaaccatctttagatgagaaggtggctccctccaaggcatcccaaactacaggcgtcttttctggaccttgccttcccaattggatcatgcatgccaagagctgttatctatttagcttctcagaaaattcctggtatggaagtaggagacactgttcccagctaggagctcatctattgaagatagacaatgcaaaagaatttgagttcattgaaagccaaacatcttctcaccgtgttaactcattctggataggtctatctcgcaatcagagtgaagggccgtggttctgggaggatggatcagcatttacccccaactcgtttcaagtcagaaatacagctccccaagaaagcttaccccacaattgtgtttggatccatgggtcagaggtctacaaccaaatgtgcattgcttcctcattcactatctgtgagaaggaactgtaaggatcc SEQ ID NO.15

TABLE 7 plasmid vector information

By adopting a lentivirus transduction method, a pLV.1-shCebpb vector for knocking down C/EBP beta, a pLVSO5-Clec7a vector for over-expressing Clec7a and corresponding negative control vectors pLV.1-NC and pLVSO5-NC are respectively constructed based on lentivirus vectors pLV.1 and pLVSO5, and are injected into CCI rats intrathecally.

In the behaviours, compared with the Sham group, the mechanical paw withdrawal threshold of rats in the CCI group is significantly reduced, which indicates that the NP model is successfully constructed; compared with the CCI + pLV.1-NC + pLVSO5-NC group, the mechanical foot-shortening threshold of the C/EBP beta knocking-down group is obviously increased, and the pain is obviously relieved; the mechanical paw withdrawal threshold of the Clec7a over-expression group was significantly reduced, and pain was aggravated; and the mechanical foot-shortening threshold of the Clec7a group, which is knocked down by C/EBP beta and over-expressed, is not obviously different from that of the CCI group. The results indicate that overexpression of Clec7A reversed the pain threshold increase (n-10) due to knock-down of C/EBP β (fig. 7A); at the molecular level, by Western Blot (n ═ 9) experiments, it was shown that: intrathecally injecting corresponding lentivirus vector, significantly reducing the expression of C/EBP beta in rat spinal cord and increasing the expression of Clec7a (FIG. 7B); tunel staining experiment results show that the injection of pLV.1-shCebpb can inhibit the expression of C/EBP beta, thereby remarkably reducing the occurrence of cell apoptosis in the spinal cord of CCI rats; whereas, overexpression of Clec7a by injecting plgso 5-Clec7a vector reversed this phenomenon (n-9) (fig. 8). Therefore, the shCebpb can inhibit C/EBP beta, further inhibit the expression of Clec7a, and reduce the occurrence of cell apoptosis in CCI rat spinal cord.

Through the technical scheme, the Cebpb gene can be used as a target point of NP treatment, C/EBP beta is used as an upstream transcription factor of Clec7a gene, a reagent targeting a biomarker can inhibit the over-expression of the transcription factor, the phosphorylation levels of the biomarker Clec7a gene, Syk, ERK and JNK, the expression levels of cell apoptosis-related proteins NLRP3, GSDMD, IL-1 beta, IL-18 and the like are further reduced, the occurrence of cell apoptosis is remarkably reduced, a complete pathway for inhibiting the upstream transcription factor, the downstream inflammatory factor and the cell apoptosis is formed, and the important role is played in NP.

The preferred embodiments of the present disclosure are described in detail with reference to the accompanying drawings, however, the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present disclosure within the technical idea of the present disclosure, and these simple modifications all belong to the protection scope of the present disclosure.

It should be noted that, in the above embodiments, the various features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various possible combinations will not be further described in the present disclosure.

In addition, any combination of various embodiments of the present disclosure may be made, and the same should be considered as the disclosure of the present disclosure, as long as it does not depart from the spirit of the present disclosure.

Sequence listing

<110> institute of traditional Chinese medicine of Chinese academy of traditional Chinese medicine

<120> use of biomarker-targeting agents for the preparation of a medicament for the treatment/alleviation of neuropathic pain

<130> 24297ICMM

<141> 2022-05-25

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA/RNA

<213> Artificial Sequence

<400> 1

agaacgagcg gcugcagaat t 21

<210> 2

<211> 21

<212> DNA/RNA

<213> Artificial Sequence

<400> 2

uucugcagcc gcucguucut t 21

<210> 3

<211> 60

<212> DNA

<213> Artificial Sequence

<400> 3

ggatccagaa cgagcggctg cagaagactc gagagaacgg atatagagga aatctttttt 60

<210> 4

<211> 54

<212> DNA

<213> Artificial Sequence

<400> 4

gaattcagaa cgagcggctg cagaagactc gagtcttctg cagccgctcg ttct 54

<210> 5

<211> 21

<212> DNA/RNA

<213> Artificial Sequence

<400> 5

uucuccgaac gugucacgut t 21

<210> 6

<211> 21

<212> DNA/RNA

<213> Artificial Sequence

<400> 6

acgugacacg uucggagaat t 21

<210> 7

<211> 21

<212> DNA/RNA

<213> Artificial Sequence

<400> 7

gaguucauug aaagccaaat t 21

<210> 8

<211> 21

<212> DNA/RNA

<213> Artificial Sequence

<400> 8

uuuggcuuuc aaugaacuct t 21

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

atgggccagg gtcatcttcc 20

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 10

gcagcgagtg agagccttc 19

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 11

tgttctcctt gttgacttac agc 23

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 12

gcactggctt cattcttctg ga 22

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

ttcgctttgt gtcgctggag 20

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 14

tataactgcc tggagtcgg 19

<210> 15

<211> 727

<212> DNA

<213> Artificial Sequence

<400> 15

gaattccgcc accatggacg aagatggata tactcaatta gacttcggca ctcgaaacat 60

ccacaaaaga cctgtaaaat cagagaaagg aagcccagct ccatcttctc gttggcggtc 120

cattgcggta gctttaggaa tcctgtgctt gctcacagta gtggtcgcag cagtgctggg 180

tgccctagca tttcggagat tcaattcagg gagatatcca gaggagaaag acaacttccc 240

atcaagaaat aaggagaacc acaaacccac agaaccatct ttagatgaga aggtggctcc 300

ctccaaggca tcccaaacta caggcgtctt ttctggacct tgccttccca attggatcat 360

gcatgccaag agctgttatc tatttagctt ctcagaaaat tcctggtatg gaagtaggag 420

acactgttcc cagctaggag ctcatctatt gaagatagac aatgcaaaag aatttgagtt 480

cattgaaagc caaacatctt ctcaccgtgt taactcattc tggataggtc tatctcgcaa 540

tcagagtgaa gggccgtggt tctgggagga tggatcagca tttaccccca actcgtttca 600

agtcagaaat acagctcccc aagaaagctt accccacaat tgtgtttgga tccatgggtc 660

agaggtctac aaccaaatgt gcattgcttc ctcattcact atctgtgaga aggaactgta 720

aggatcc 727

Claims

1. Use of an agent targeting a biomarker, wherein the biomarker is Cebpb, in the manufacture of a medicament for the treatment/alleviation of neuropathic pain.

2. The use of claim 1, wherein the biomarker targeting agent comprises an inhibitor of Cebpb.

3. The use of claim 2, wherein the inhibitor of Cebpb comprises at least one of an siRNA, an shRNA, an antisense oligonucleotide and a loss of function gene of the Cebpb gene.

4. The use of claim 2, wherein the inhibitor of Cebpb is at least one of an interfering molecule, a nucleic acid inhibitor, a binding molecule, a small molecule compound directed against the Cebpb gene or a gene upstream or downstream thereof.

5. The use of claim 3, wherein the siRNA comprises siCebpb,

AGAACGAGCGGCUGCAGAATT SEQ ID NO.1，

UUCUGCAGCCGCUCGUUCUTT SEQ ID NO.2；

GGATCCAGAACGAGCGGCTGCAGAAGACTCGAGAGAACGGATATAGAGGAAATCTTTTTT SEQ ID NO.3，

GAATTCAGAACGAGCGGCTGCAGAAGACTCGAGTCTTCTGCAGCCGCTCGTTCT SEQ ID NO.4。

6. the use of claim 1, wherein the pharmaceutical formulation comprises at least one of a tablet, a capsule, a pill, a powder, a granule, a suspension, an oral solution, a powder injection and an injection.

7. A pharmaceutical composition for treating/relieving neuropathic pain, comprising siRNA and/or shRNA as an active ingredient, wherein the siRNA comprises siCebpb,

AGAACGAGCGGCUGCAGAATT SEQ ID NO.1，

UUCUGCAGCCGCUCGUUCUTT SEQ ID NO.2。

the shRNA comprises shCebpb, and the nucleic acid sequences of a sense strand and an antisense strand of the shCebpb are shown in SEQ ID NO.3 and SEQ ID NO. 4:

GGATCCAGAACGAGCGGCTGCAGAAGACTCGAGAGAACGGATATAGAGGAAATCTTTTTT SEQ ID NO.3，

GAATTCAGAACGAGCGGCTGCAGAAGACTCGAGTCTTCTGCAGCCGCTCGTTCT SEQ ID NO.4。

8. the pharmaceutical composition of claim 7, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier; the volume ratio of the effective components to the pharmaceutically acceptable carrier is 1: (0.5-1.5).

9. The pharmaceutical composition of claim 8, wherein the pharmaceutically acceptable carrier comprises at least one of a liposome, a cationic polymer, and a nanomaterial.

10. The pharmaceutical composition according to claim 7, wherein the concentration of the siRNA and/or shRNA as an active ingredient is 20-80 μ M.