CN114958986A - Identification method for gene polymorphism typing and application thereof - Google Patents

Abstract

The invention discloses an identification method for gene polymorphism typing and application thereof, comprising the following steps: s1, respectively designing two specific primers ASP1 and ASP2 corresponding to different polymorphic sites and a universal reverse primer LSP according to gene sequences of the different polymorphic sites in a sample to be detected; s2, embedding an additional sequence GC-add and AT-add in the specific primers ASP1 and ASP2 respectively, and matching the 3' terminal base of the specific primers ASP1 and ASP2 with different polymorphic sites in the sample to be detected respectively; s3, preparing a PCR reaction system, adding corresponding reagents, and carrying out AS-PCR amplification reaction; and S4, after the amplification reaction is finished, analyzing through a melting curve, and completing the genotyping identification of the sample to be detected. The invention successfully eliminates the heterogeneous amplification phenomenon in the detection of heterozygous genotype samples by balancing the amplification efficiency of ASP1 and ASP2 by adjusting the length of GC-add or AT-add sequences and the embedding position in the primers.

Description

Identification method for gene polymorphism typing and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to an identification method for genotyping of gene polymorphism and application thereof.

Background

Allelic Polymorphism (AP) is widely present in genomes of various species and is associated with various traits, so AP typing detection is widely used in fields such as genetic disease diagnosis, drug development, crop breeding and purity identification. Allele Specific amplification PCR (AS-PCR) is a main technical means for AP typing, three primers are designed, wherein two Allele Specific Primers (ASP) only have difference (are respectively complementary with corresponding polymorphic sites) at 3' terminal bases, one Allele Specific reverse Primer (LSP) is shared, PCR reaction is carried out in the same reaction system to generate two products with difference at AP sites, and the AP typing identification of samples is completed by identifying whether the two products exist. The method for detecting AP typing by using AS-PCR based on fluorescent signals has the advantages of accuracy, rapidness, high flux, low cost, no pollution, low equipment requirement and easiness in operation. Generally, there are two main ways to generate the fluorescent signal:

one method is a fluorescent probe method, and many types of fluorescent probes are currently used for detecting AS-PCR products, most of which are based on the FRET (Fluorescence Resonance Energy Transfer) principle, namely, a fluorescent group and a quenching group of a probe are close to each other and are in a quenching state before the products are produced, and the fluorescent group and the quenching group are separated by combining or hydrolyzing the probe and the products after the products are produced, so that a fluorescent signal is generated. The other method is a fluorescent dye method, wherein a fluorescent dye such as SybrGreenI can be specifically combined with double-stranded DNA to generate fluorescence, the fluorescence is added into a reaction system, and the progress of the PCR reaction can be monitored in real time by detecting the intensity of a fluorescent signal after each cycle.

Although the cost of the fluorescent dye method is lower than that of the fluorescent probe method, the fluorescent dye and the double-stranded DNA are indiscriminately combined, and when different double-stranded DNA exists in a reaction system, products cannot be distinguished in the reaction only by a real-time fluorescent signal. Since the fluorescent dye has a characteristic of specifically binding to the double-stranded DNA and emitting light without generating a fluorescent signal when not bound, heating the reaction system after the PCR reaction is finished, gradually denaturing and dissociating the double-stranded DNA product into single strands in the process of heating to the temperature close to the denaturation temperature, the fluorescence intensity in the process is taken as the Y axis, the temperature is taken as the X axis to plot, the Melting Curve (MC) of the double-stranded DNA can be obtained, the Derivative Melting Curve (DMC) of the double-stranded DNA can be obtained by plotting the single Derivative of the fluorescence intensity and the temperature in the process with the Y axis and the temperature with the X axis, and the information of the Melting temperature Tm (Tm), the number of Melting peaks, the position of Melting peaks, the peak height and the like which are the temperatures when half of the double-stranded DNA is dissociated can be obtained from the DMC. The DMC forms, Tm, the number positions of melting peaks and the like of different double-stranded DNAs are different, so that different double-stranded DNAs can be distinguished through melting curve analysis. Ririe et al (Product differentiation by analysis of DNA layering the polymerase chain reaction. analytical biochemistry.1997; 245(2):154-60.) double-stranded DNA of the same length with different GC contents, the same GC contents with different lengths, and the same length with the same GC contents but different GC distributions can be resolved by melting curves using melting curve analysis with SybrGreenI as a fluorescent dye.

Melting curve analysis can be used for AP typing identification, but when the difference between alleles is very small, such as Single Nucleotide Polymorphism (SNP) or several base Insertion Deletion polymorphism (InDel), the difference in melting temperature (Δ Tm) between allele-specific amplification products is very small. Since SybrGreenI inhibits PCR reaction at high concentration, it can only be used at low concentration, resulting in that the dye cannot bind to all positions of double-stranded DNA, the dye that has detached from the low-melting region during the heating of the melt will re-bind to the part of the high-melting region to which the fluorescent dye has not bound, i.e. a dye rearrangement occurs, resulting in that a slight change in fluorescence signal intensity cannot be detected, or the region containing the polymorphic site is not bound to the fluorescent dye, resulting in no change in fluorescence intensity of the region before and after dissociation. This may result in the Δ Tm of the two mutants being too small to be distinguished in the typing of the homozygous mutant, or only one melting peak being generated in the typing of the heterozygous mutant to be misjudged as homozygous material. Although the dye rearrangement phenomenon can be solved by adding high concentration of SybrGreenI dye for melting curve analysis after PCR reaction, it leads to increase of operation steps and aerosol contamination due to decap.

The High-resolution Melting Curve (HRM) can complete the allele typing of small difference by Melting Curve analysis in a single closed container, namely the temperature increase in the dissociation process of the double-stranded DNA is lower than 0.1 ℃/s, and at least 10 collected data points are per DEG C. HRM assay may use fluorescent probes instead of SybrGreenI, for example, using the property that guanine nucleotides can quench fluorophores, PCR amplifying the target DNA using fluorophore-labeled primers, obtaining fluorescently labeled DNA products and performing HRM analysis (C.N. guide et al. amplification culture with labeled primers: a closed-tube method for differentiating fluorophores and heterologous oligonucleotides, clinical chemistry.2003; 49(3): 396.); or other fluorescent dyes are used for replacing SybrGreenI to perform HRM analysis compared with fluorescent probes which need specific design and are higher in synthesis cost.

T.T. Wittwer et al (High-Resolution by amplification on a long analysis using LCGreen. clinical chemistry. 2003; 49(6):853-60.) use a fluorescent dye LCGreen for High Resolution melting curve analysis, which does not inhibit PCR reaction at High concentration and therefore does not undergo dye rearrangement during melting curve determination, thereby achieving HRM determination in a single closed vessel. In genotyping work, the same sample HRM gave larger differences in Tm values, and heterozygous samples were successfully identified. Although the resolution of HRM is high, the GC content difference of PCR products with different genotypes is extremely small, for example, two genotypes of G/C and A/T in an SNP sample can not necessarily obtain better typing effect or need manual intervention for judgment, and if the Tm value difference between polymorphic amplification products can be further increased on the basis of HRM, accurate judgment of the typing result is more facilitated, especially the manual intervention is reduced to realize high-throughput automatic judgment.

Germer et al (Single-tube genotyping with oligonucleotide probes. genome Research,1999,9(1):72-78.) established the Tm-shift genotyping technique to complete genotyping by adding a GC-rich sequence at the 5' end of an ASP to increase the Δ Tm between the two amplified products. J.Wang et al (High-throughput SNP genotyping by single-tube PCR with Tm-shift primers. Biotechnology. 2005; 39(6):885-93.) established Tm-shift SNP Advanced technique to complete genotyping by adding a different length of GC-rich sequence to the 5' ends of two ASPs to increase the Δ Tm between the two amplification products. Although these two techniques can use melting curves to accomplish SNP typing, they still suffer from several drawbacks: (1) the two melting peaks of the heterozygous genotype sample have overlarge difference, namely, the phenomenon of heterogeneous amplification exists; (2) tm-shift SNP Advanced intends to eliminate heterogeneous amplification by adding GC-rich sequences to two ASPs, but the phenomenon still exists in partial target gene SNP site typing detection, and the two ASPs are added with GC-rich sequences to cause lower Delta Tm, and two melting peaks of a heterozygous genotype are close to each other to form a continuous melting peak, which is not beneficial to interpretation; (3) the detection object does not relate to the A/T and G/C polymorphic site test with small difference of melting curves.

In view of the above, it is necessary to provide an identification method for genotyping gene polymorphisms to solve the above technical problems.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides an identification method for gene polymorphism typing and application thereof. The heterogeneous amplification phenomenon in the detection of heterozygous genotype samples was successfully eliminated by balancing the amplification efficiency of ASP1 and ASP2 by adjusting the length of GC-add or AT-add sequences and the position of the insert in the primers.

An object of the present invention is to provide an identification method for genotyping a gene polymorphism.

An identification method for genotyping a gene polymorphism, comprising the steps of:

s1, respectively designing two specific primers ASP1 and ASP2 corresponding to different polymorphic sites and a universal reverse primer LSP according to gene sequences of the different polymorphic sites in a sample to be detected;

s2, embedding an additional sequence in the specific primers ASP1 and ASP2 respectively, and matching the 3' terminal base of the specific primers ASP1 and ASP2 with different polymorphic sites in the sample to be detected respectively;

s3, preparing a PCR reaction system, adding corresponding reagents, and carrying out AS-PCR amplification reaction;

and S4, after the amplification reaction is finished, analyzing through a melting curve, and completing the genotyping identification of the sample to be detected.

Further, in step S1, the specific primers ASP1 and ASP2 are located upstream of the polymorphic site or downstream of the polymorphic site.

Further, in step S2, the additional sequence is inserted at a position that is 10 bases in the shortest distance from the 3 'end of the specific primer and may be located at the 5' end of the specific primer in the farthest distance.

Further, in step S2, the additional sequence is selected from one of GC-add or AT-add.

Further, the GC-add was added to the specific primer ASP1, and the AT-add was added to the specific primer ASP 2.

Further, the GC-add and the AT-add are AT the same or different distances between the insertion site and the 3' terminal base on the specific primers ASP1 and ASP2, respectively.

Further, the GC-add and the AT-add may be the same or different lengths.

Further, the GC-add and the AT-add are composed of AT least one of:

1) a nucleotide base;

2) a nucleotide base analog;

3) a chemically modified nucleotide base.

Furthermore, the length of the GC-add is 3-40 bp, and the ratio of guanine bases (G) to cytosine bases (C) in the GC-add is not less than 60%.

Furthermore, the length of the AT-add is 3-40 bp, and the proportion of the adenine base (A) and the thymine base (T) in the AT-add is not less than 60%.

Further, in step S3, the PCR reaction system includes two specific primers ASP1 and ASP2 corresponding to the different polymorphic sites, a universal reverse primer LSP, a buffer system, DNA polymerase, dNTPs, sample DNA to be detected, and a fluorescent dye.

Still further, the fluorescent dye includes a fluorescent dye that can specifically bind or intercalate with double-stranded DNA and generate a fluorescent signal.

Further, the sample DNA to be detected includes double-stranded DNA, single-stranded DNA, linear DNA, circular DNA, and cDNA obtained by transcription from RNA.

Further, in step S4, the heating rate in the heating process for melting the double-stranded DNA is not less than 1.5 ℃/min during the analysis of the melting curve.

Further, the AS-PCR amplification reaction may be performed in a single tube, and typing detection of two or more target genes may be simultaneously performed in the single tube.

Further, the identification of the genetic polymorphism typing is the identification of a multiple allele polymorphism typing.

Furthermore, in the identification process of the multiple allele polymorphism typing, AS-PCR amplification reaction can be carried out in a single tube, and single polymorphism sites in multiple alleles are detected sequentially through the single tube reaction or a plurality of polymorphism sites in the multiple alleles are detected simultaneously through the single tube reaction, so that the identification of the multiple allele polymorphism typing is completed.

Furthermore, the multiple alleles are rice starch granule-bound starch synthase genes, and the differential SNP sites of the rice starch granule-bound starch synthase genes are Int1-1, Ex4-53, Ex4-77, Ex6-62 and Ex10-105 respectively.

Furthermore, the primer sequence for detecting Int1-1 is shown as SEQ ID NO. 41-45; the sequence of the primer for detecting Ex4-53 is shown as SEQ ID NO. 46-50; the sequence of the primer for detecting Ex4-77 is shown as SEQ ID NO 51-55; the sequence of the primer for detecting Ex6-62 is shown as SEQ ID NO 56-60; the primer sequence for detecting Ex10-105 is shown in SEQ ID NO 61-65.

Still further, primers having at least 60% or more sequence identity to said Int1-1 primer sequence, said Ex4-53 primer sequence, said Ex4-77 primer sequence, said Ex6-62 primer sequence, and said Ex10-105 primer sequence are included.

Another object of the present invention is to provide an identification system for genotyping of gene polymorphisms.

An identification system for genotyping a genetic polymorphism, comprising the following modules:

an information acquisition module: respectively designing two specific primers ASP1 and ASP2 corresponding to different polymorphic sites and a universal reverse primer LSP according to gene sequences of the different polymorphic sites in a sample to be detected;

a primer design module: embedding an additional sequence into the specific primers ASP1 and ASP2 respectively, and matching the 3' terminal base of the specific primers ASP1 and ASP2 with different polymorphic sites in a sample to be detected respectively to obtain primers for genotyping of gene polymorphism;

a PCR amplification reaction module: preparing a PCR reaction system, adding corresponding reagents, and carrying out AS-PCR amplification reaction;

an analysis module: after the amplification reaction is finished, the genotyping identification of the sample to be detected can be finished through the analysis of the melting curve.

Further, the primer design module further comprises a primer related parameter optimization module, wherein the primer related parameter optimization module is used for optimizing the position of the primer on the template, the length of the primer, the annealing temperature, the GC content, GC-add and AT-add selection, and the insertion sites of GC-add and AT-add on the primer.

The principle of the identification method for genotyping of gene polymorphisms of the present invention is as follows: during ASP design, a GC-add is embedded in the interior or 5 'end of one ASP (ASP1) and an AT-add is embedded in the interior or 5' end of the other ASP (ASP2), i.e., the Tm of the two amplicons is respectively increased and decreased by increasing the GC or AT content, the Δ Tm of the two amplicons is increased, and the amplification efficiency of the two ASPs is balanced by adjusting the length of the GC-add or AT-add sequence and the embedding position in the primer. When the GC-add and the AT-add are positioned AT the 5' end of the primer, the tail end sequences of the primers are used to participate in PCR reaction and are introduced into corresponding amplicons; when the GC-add and the AT-add are positioned in the primers, the primers and the template are annealed to form a DNA bubble structure (DNA-bubble) to participate in PCR reaction, so that the GC-add and the AT-add are introduced into corresponding amplicons. The introduction of GC-add and AT-add results in a respective increase and decrease in the overall GC content of the corresponding amplicon, with the difference in GC content being significantly greater than the corresponding target sequence. During melting curve determination, there was little difference between the melting patterns and Δ Tm for the amplification products corresponding to ASP1 and ASP2 when no GC-add and AT-add were added to ASP (FIGS. 3a and 3 d). When either GC-add or AT-add is located AT the 5' end of the primer, melting of the GC-add product starts from the opposite end (FIG. 3b), whereas melting of the AT-add product starts from both ends of the product simultaneously (FIG. 3e), with a faster melting rate than the GC-add product, resulting in a larger Δ Tm than the PCR product without the addition of GC-add or AT-add (FIGS. 3a and 3 d). When GC-add (FIG. 3c) or AT-add (FIG. 3f) is located inside the primer, although both GC-add and AT-add melt from both ends, the melting of the GC-add segment is still later than that of the AT-add region, and the Tm value of the GC-add is significantly higher than that of the GC-add AT the 5 ' end (FIG. 3b), and the Tm value of the AT-add is lower than that of the AT-add AT the 5 ' end (FIG. 3e), so that the Δ Tm of the two PCR products is larger and easier to distinguish than that of the GC-add or AT-add AT the 5 ' end of the primer, and the identification of the PCR products of the two genotypes can be completed through melting curve analysis, thereby achieving the purpose of efficiently realizing the genotyping identification.

The invention also provides a primer for typing gene polymorphism.

A primer for genotyping gene polymorphism is designed by the primer design module.

The invention also provides a detection kit for genotyping of gene polymorphism.

A detection kit for genotyping of gene polymorphism, comprising the PCR reaction system in the identification method for genotyping of gene polymorphism.

The invention finally provides the application of the identification method for genotyping of gene polymorphism in allelic polymorphism typing detection.

Further, the allele polymorphism typing detection is rice allele polymorphism typing detection or rice multiple allele polymorphism typing detection.

Compared with the prior art, the invention has the following advantages:

1) the invention increases the delta Tm of two amplification products by adding a GC-rich sequence (GC-add) and an AT-base-rich sequence (AT-add) to two ASPs respectively, and can form two melting peaks which are well separated even for a heterozygous genotype sample of an A/T polymorphic site;

2) the addition positions of the sequence (GC-add) rich in GC bases and the sequence (AT-add) rich in AT bases are not limited to the 5' end of the ASP, but can be embedded into the ASP, so that the Delta Tm can be further increased, and the detection precision can be improved;

3) the invention balances the amplification efficiency of two ASPs by adjusting the length of GC-add or AT-add sequences and the embedding position in the primer, and successfully eliminates the heterogeneous amplification phenomenon in the detection of heterozygous genotype samples.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the description below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a schematic flow chart of the allele polymorphism typing detection principle of the present invention (GC-add and AT-add are located AT the 5' end of ASP), which is illustrated by taking the polymorphic site as C/T, the allele specific primer ASP located AT the upstream of the polymorphic site, the fluorescent dye Super EvaGreen and adding in the initial stage of the reaction as an example; wherein, the diagram (A) is a reaction system composition diagram, and comprises target DNA (polymorphic sites take C/T as an example) of SNP Allle 1 and SNP Allle 2, two homodromous primers ASP1 and ASP2 (the 5' end is respectively provided with GC-add and AT-add), a universal reverse primer LSP and a fluorescent dye Super EvaGreen specifically combined with double-stranded DNA (the fluorescent dye is not combined with the double-stranded DNA before reaction and is in a quenching state); FIG. B is a schematic diagram showing the initial PCR reactions in which the ASP1 and ASP2 respectively pair with the LSP to amplify the target DNA containing the corresponding polymorphic sites (a, B, e), and if the ASP and SNP sites do not match, the extension reaction cannot proceed (c, d), and the GC-add and AT-add sequences AT the ends of ASP1 and ASP 25' are introduced into the corresponding amplicons (f, g); FIG. C is a schematic diagram of a multi-round PCR reaction in which ASP1 and ASP2 are paired with LSP, and the products in FIGS. (B) f and g are used as templates to amplify a large number of PCR products containing GC-add and AT-add sequences, and a fluorescent dye is combined with the PCR products to generate a fluorescent signal; FIG. D is a schematic diagram showing the measurement of melting curves of PCR products, in which as the temperature of the reaction system gradually increases, the double-stranded DNA dissociates, and products containing GC-add and AT-add sequences undergo different dissociation modes, the melting of the GC-add product starts from the other end, the melting of the AT-add product starts from both ends of the products, and as the double-stranded DNA dissociates, the fluorescent dye is released into a free state, resulting in fluorescence quenching.

FIG. 2 is a schematic flow chart of the allele polymorphism typing detection principle of the present invention (GC-add and AT-add are located inside ASP), which is illustrated by taking the polymorphic site as C/T, the allele specific primer ASP located upstream of the polymorphic site, the fluorescent dye Super EvaGreen and adding in the initial stage of the reaction as an example; wherein, the diagram (A) is a reaction system composition diagram, target DNA (polymorphic sites take C/T as an example) of SNP Allle 1 and SNP Allle 2, two homodromous primers ASP1 and ASP 2(GC-add and AT-add are respectively embedded inside), a universal reverse primer LSP and a fluorescent dye Super EvaGreen specifically combined with double-stranded DNA (the double-stranded DNA is not combined before reaction and is in a quenching state); FIG. B is a schematic diagram showing the initial PCR reaction rounds in which the target DNAs (a, B, e) containing the corresponding polymorphic sites are amplified by ASP1 and ASP2 in a matched manner with LSP, and if the primers and SNP sites do not match, the extension reaction cannot be performed (c, d), and GC-add and AT-add sequences in ASP1 and ASP2 are introduced into the corresponding amplicons (f, g); FIG. C is a schematic diagram of a multi-round PCR reaction in which ASP1 and ASP2 are paired with LSP and the products of FIGS. 2(B) f and g are used as templates to amplify a large number of PCR products containing GC-add and AT-add sequences, and a fluorescent dye is combined with the PCR products to generate a fluorescent signal; FIG. D is a schematic diagram showing the measurement of melting curves of PCR products, in which double-stranded DNA is dissociated with a gradual increase in the temperature of the reaction system, and products containing GC-add and AT-add sequences are different in melting modes, both of which are melted from both ends, but the GC-add segment is still melted later than the AT-add segment, and as the double-stranded DNA is dissociated, the fluorescent dye is released in a free state to quench fluorescence.

FIG. 3 is a melting chart of the target sequence and amplification sequence of the single nucleotide polymorphism site 1(SNP Allole 1) and the single nucleotide polymorphism site 2(SNP Allole 2) of the rice target gene 1(Ostarget1) according to the present invention; wherein, the picture a is the melting picture of the target sequence (SEQ ID NO:66) of SNP Allele 1; FIG. b is a melting diagram of the amplification product (SEQ ID NO:82) of SNP Allle 1 with GC-add1 at the 5' end; FIG. c is a melting diagram of the amplification product (SEQ ID NO:84) of SNP Allele1 with GC-add1 located inside the primer; FIG. d is the melting diagram of the target sequence (SEQ ID NO:67) of SNP Allele 2; FIG. e is a melting diagram of an amplification product (SEQ ID NO:83) of SNP Allle 2 with AT-add1 AT the 5' end; FIG. f is a melting diagram of the amplification product (SEQ ID NO:85) of SNP Allele2 with AT-add1 located inside the primer; the fused Map was rendered by uMelt Map software analysis (https:// www.dna-utah. org/uMelt/quartz/Map. php).

FIG. 4 is a graph showing AS-PCR product melting curves of the rice target gene (OsTarget1) in example 1 of the present invention; in the figure a, the ASP is not added with GC-add and AT-add; in FIG. b, GC-add and AT-add are located AT the 5' end of the primer; in the diagram c, GC-add and AT-add are located inside the primers, both 9 bases away from the 3' end of the ASP; in the diagram d, GC-add and AT-add are located inside the primers, and are both 10 bases away from the 3' end of the ASP; in the diagram e, GC-add and AT-add are located inside the primers, and are both 14 bases away from the 3' end of the ASP; in the diagram f, GC-add and AT-add are located inside the primers, both 17 bases away from the 3' end of the ASP; in FIG. g, the GC-add and AT-add sequences are of equal length, located within the primers, and are each 14 bases from the 3' end of the ASP.

FIG. 5 is a graph showing AS-PCR product melting curves of the rice target gene (OsTarget2) in example 2 of the present invention; in the figure a, the ASP is not added with GC-add and AT-add; in FIG. b, GC-add and AT-add are located AT the 5' end of the primer; in FIG. c, the GC-add is 17 bases from the end of ASP 13 ', and the AT-add is 19 bases from the end of ASP 23'; in FIG. d, the GC-add is 17 bases from the end of ASP 13 ', and the AT-add is 20 bases from the end of ASP 23'; in FIG. e, the GC-add and AT-add sequences are of equal length and are located 17 bases away from the end of ASP 13 'and 19 bases away from the end of ASP 23', respectively; in the diagram f, the GC-add and AT-add sequences are of equal length and are 19 bases away from the end of ASP 13 'and 20 bases away from the end of ASP 23'.

FIG. 6 shows the results of melt curve typing tests on a large number of rice target genes (OsTarget1) AS-PCR population samples in example 3 of the present invention, wherein GC-add and AT-add are both 17 bases away from the 3' end of ASP; panel a shows the results for a single sample for each genotype and panel b shows the results for a large number of samples tested.

FIG. 7 shows the results of melt curve typing tests on a large number of rice target genes (OsTarget2) AS-PCR population samples in example 4 of the present invention, in which GC-add is 19 bases away from the end of ASP 13 ', and AT-add is 20 bases away from the end of ASP 23'; panel a shows the results for a single sample for each genotype and panel b shows the results for a large number of samples tested.

FIG. 8 shows the results of melting curve typing detection of two target genes (rice target gene 1(Ostarget1) and rice target gene 2(Ostarget2)) simultaneously by single-tube reaction in example 5 of the present invention; FIG. a shows parent 1, FIG. b shows parent 2, FIG. c shows the first filial generation material, and FIG. d shows the negative Control (No-Template Control, NTC).

FIG. 9 shows the results of single-tube reaction for simultaneously performing melting curve typing on three target genes (rice target gene 1(Ostarget1), rice target gene 2(Ostarget2) and rice target gene 3(Ostarget3)) in example 6 of the present invention; FIG. a is parent 1, FIG. b is parent 2, FIG. c is first filial generation material, and FIG. d is NTC.

FIG. 10 shows the results of typing and identification of Wx-a homozygote, Wx-in homozygote and Wx-a/Wx-in heterozygote by "single detection" in example 7 of the present invention; wherein, the graph a shows a single detection melting curve diagram of each bit of Wx-a homozygote, the graph b shows a single detection melting curve diagram of each bit of Wx-in homozygote, the graph c shows a single detection melting curve diagram of each bit of Wx-a/Wx-in heterozygote, and the graph d shows a single detection melting curve diagram of each bit of NTC.

FIG. 11 shows the results of typing and identification of Wx-a homozygote, Wx-in homozygote and Wx-a/Wx-in heterozygote by "double + single detection" in example 7 of the present invention; wherein, line 1 is Wx-a homozygote, line 2 is Wx-in homozygote, line 3 is Wx-a/Wx-in heterozygote, line 4 is NTC; the 1 st column comprises double detection of Int1-1& Ex4-53 sites, the 2 nd column comprises double detection of Ex6-62& Ex10-115 sites, and the 3 rd column comprises single detection of Ex4-77 sites.

FIG. 12 shows the results of typing and identification of Wx-a homozygote, Wx-in homozygote and Wx-a/Wx-in heterozygote by "double + triple detection" in example 7 of the present invention; wherein, line 1 is Wx-a homozygote, line 2 is Wx-in homozygote, line 3 is Wx-a/Wx-in heterozygote, line 4 is NTC; column 1, double detection at Ex4-53& Ex6-62 sites, and triple detection at Int1-1& Ex4-77& Ex10-115 sites.

FIG. 13 shows the results of typing and identification of Wx-op homozygotes, Wx-mq homozygotes and Wx-op/Wx-mq heterozygotes by the "single-plex test" in example 7 of the present invention; wherein, the diagram a is a single detection melting curve diagram of each bit of the Wx-op homozygote, the diagram b is a single detection melting curve diagram of each bit of the Wx-mq homozygote, the diagram c is a single detection melting curve diagram of each bit of the Wx-op/Wx-mq heterozygote, and the diagram d is a single detection melting curve diagram of each bit of the NTC.

FIG. 14 shows the results of typing and identification of Wx-op homozygote, Wx-mq homozygote and Wx-op/Wx-mq heterozygote by "double + single detection" in example 7 of the present invention; wherein, the line 1 is Wx-op homozygote, the line 2 is Wx-mq homozygote, the line 3 is Wx-op/Wx-mq heterozygote, and the line 4 is NTC; the position double detection is carried out at Int1-1& Ex4-77 in the 1 st column, the position double detection is carried out at Ex6-62& Ex10-115 in the 2 nd column, and the position single detection is carried out at Ex4-53 in the 3 rd column.

FIG. 15 shows the results of typing and identification of Wx-op homozygotes, Wx-mq homozygotes and Wx-op/Wx-mq heterozygotes by "double + triple detection" in example 7 of the present invention; wherein, the line 1 is Wx-op homozygote, the line 2 is Wx-mq homozygote, the line 3 is Wx-op/Wx-mq heterozygote, and the line 4 is NTC; column 1, double detection at Ex4-53& Ex6-62 sites, and triple detection at Int1-1& Ex4-77& Ex10-115 sites.

Detailed Description

The technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention. It is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments, and all other embodiments obtained by those skilled in the art without any inventive work are within the scope of the present invention.

The principle of SNP typing detection by using AS-PCR (explained by taking the SNP site AS C/T, ASP upstream of the polymorphic site and fluorescent dye AS Super EvaGreen and adding in the initial stage of the reaction AS an example) in the invention is AS follows:

as shown in FIG. 1(GC-add and AT-add located AT the 5' end of ASP) and FIG. 2(GC-add and AT-add located inside ASP), melting curve determination was performed on a 7900HT real-time fluorescent quantitative PCR instrument from ABI, and melting curve analysis was performed by software SDS2.4.1. The PCR reaction is carried out by three conventional primers, two homodromous primers ASP1 and ASP2 are respectively used for distinguishing C and T polymorphic sites, the 5 'ends of ASP1 and ASP2 are respectively provided with different tail end sequences GC-add and AT-add which are not matched with a target amplification segment, the 3' part is completely matched with the target amplification segment, and the extension reaction can be initiated only when the tail end basic genes are different and the tail end basic groups are completely matched with the basic groups of the SNP sites. ASP1 and ASP2 share the same reverse primer LSP to respectively complete the amplification of target sequences containing different SNP sites, and GC-add and AT-add on the PCR amplification primers are respectively introduced into corresponding PCR products. The reaction system contains a fluorescent dye Super EvaGreen, and the dye is specifically combined with double-stranded DNA and is in a quenching state when not combined with the double-stranded DNA. As the PCR reaction proceeded, a large number of amplification products with GC-add and AT-add, respectively, appeared, and SuperEvaGreen bound to the PCR products to generate fluorescence. After the PCR reaction was completed, the melting curve measurement was started, and first, the system was heated at 0.025 ℃/sec until the PCR product was completely denatured. At this time, the DNA double strand gradually dissociates into single strand form, Super EvaGreen bound to the PCR product is released into free state to cause fluorescence quenching, the fluorescence signal gradually weakens, and the fluorescence intensity during PCR product denaturation is recorded. As the two products respectively have GC-add and AT-add, the GC content and the melting mode are different, and the Tm is different. And finally, drawing a derivative melting curve graph, wherein two PCR products form melting peaks at respective Tm temperatures, and the existence condition of the melting peaks can be used for judging whether the detected sample is a heterozygote or a homozygote.

The conventional reagents and equipment used in the present invention are commercially available unless otherwise specified.

In the following examples, SNP typing detection and multiple allele typing detection of rice will be described as examples, but the primers and detection system of the present invention are not only used for SNP typing detection and multiple allele typing detection of rice, but also can be used for identification of allele polymorphism typing of other species and multiple allele typing detection.

The naming rule of the primer ASP of the invention is as follows:

nomenclature of ASP without GC-add or AT-add: target gene name + ASP and sequence number; for example, Ostarget1ASP1 indicates allele-specific primer 1 of Ostarget1as the target gene.

Nomenclature of ASP with GC-add or AT-add: target gene name + ASP and sequence number + added sequence length + type of inserted sequence + added position + distance from 3 ' end (if the added site is located inside ASP), for example, OsTarget1ASP1-10GC5 ' indicates that 10 base GC-add is added to the 5 ' end of allele-specific primer 1 of target gene OsTarget 1; OsTarget1ASP2-14AT3 { -17} represents an insertion of 14 base long AT-add AT 17 bases from the 3' end of allele-specific primer 2 of the target gene OsTarget 1.

The fluorescent dyes used: super EvaGreen, a saturated fluorescent dye capable of specifically binding double-stranded DNA to generate a fluorescent signal, can be used for high-resolution dissolution curve analysis, and has the following specific parameters: excitation wavelength (500nm, bound DNA; 471nm, unbound DNA) and emission wavelength of 530 nm.

GC-add: a GC-rich sequence;

AT-add: AT-rich sequences.

Example 1

A rice target gene 1(OsTarget1) is used as a template, the genotyping detection effect is tested when GC-add and AT-add with different lengths or the same length are respectively added AT the same positions of ASP1 and ASP2, the allelic gene polymorphic site is T (Allele1)/A (Allele2) genotype, and 7 add sequences and 14 primers are designed in total, as shown in the following table 1:

TABLE 1 primer and add sequence Listing

The reaction system was formulated as in table 2, with ASP1 and ASP2 in combination: 8& 9 SEQ ID NO, 10& 11 SEQ ID NO, 12& 13 SEQ ID NO, 14& 15 SEQ ID NO, 16& 17 SEQ ID NO, 16& 18 SEQ ID NO and 19& 20 SEQ ID NO.

TABLE 2 Single weight detection reaction System formulation

10-100ng of rice standard material parent 1, parent 2 and first-filial generation material genome DNA are taken to be placed in reaction holes of a 96-hole PCR reaction plate, the SNP type of the standard material is confirmed by PARMS detection (Wuhan city scenery peptide Biotechnology Co., Ltd.), and each primer combination is provided with two repeats and two NTCs for each template. Treating at 65 ℃ for 30 minutes until the template DNA is dried, adding 10 mul of reaction mixed solution into each hole, sealing the holes with mineral oil, placing the holes on a PCR instrument, and finishing the amplification reaction according to the program set in the table 3.

TABLE 3 AS-PCR reaction procedure

After the amplification reaction was complete the plate was transferred to ABI 7900HT and the melting curve was determined according to the set-up procedure of Table 4.

TABLE 4 melting Curve measurement procedure

Software SDS2.4.1 analyzes the melt curve data and plots derivative melt curves, the results of which are shown in FIG. 4.

As shown in FIG. 4a, when ASP1 and ASP2 do not contain GC-add and AT-add (SEQ ID NO:8& SEQ ID NO:9), OsTarget1 parent 1 and parent 2 have very little difference in melting peak position, Δ Tm is 0.5 ℃, the hybrid genotype has only one melting peak formed, and thus conventional ASP1 and ASP2 cannot complete genotyping by melting curve analysis for this SNP site.

As shown in FIG. 4b, when GC-add (10 bases) and AT-add (14 bases) with different lengths are respectively located AT the 5' ends of ASP1 and ASP2 (SEQ ID NO:10& SEQ ID NO:11), OsTarget1 parent 1 and parent 2 form specific melting peaks AT different Tm positions, a generation of hybridized material forms two specific melting peaks which are respectively located AT the Tm positions corresponding to the melting peaks of parent 1 and parent 2, and the difference between the peak heights of the two melting peaks is large, which indicates that a certain degree of heterogeneous amplification exists, and the Δ Tm of the two products of the hybrid genotype is 4.0 ℃.

As shown in FIG. 4c, OsTarget1, parent 1 and parent 2, when GC-add (22 bases) and AT-add (26 bases) of different lengths were located AT 9 bases from the 3' end of ASP1 and ASP2, respectively (SEQ ID NO:12& SEQ ID NO:13), formed specific melting peaks AT different Tm sites, both Δ Tm of 6.4 ℃. The first filial generation material only forms a specific melting peak and is positioned at the Tm position corresponding to the melting peak of the parent 2, so the primer group and the design can obviously increase the Delta Tm of two amplification products, but cannot complete the heterozygous genotyping detection, which is caused by the serious inhomogeneous amplification of ASP1 and ASP 2.

As shown in FIG. 4d, when GC-add (22 bases) and AT-add (26 bases) with different lengths are located AT 10 bases from the 3' end of ASP1 and ASP2, respectively (SEQ ID NO:14& SEQ ID NO:15), OsTarget1, parent 1 and parent 2 form specific melting peaks AT different Tm sites, a first generation of hybrid material forms two specific melting peaks, which are located AT the Tm sites corresponding to the melting peaks of parent 1 and parent 2, respectively, and a large difference exists between the peak heights of the two melting peaks, indicating that there is a certain degree of heterogeneous amplification, and the Δ Tm of the two products of the hybrid genotype is 6.0 ℃.

As shown in FIG. 4e, when GC-add (16 bases) and AT-add (20 bases) with different lengths are located AT 14 bases (SEQ ID NO:16& SEQ ID NO:17) from the 3' end of ASP1 and ASP2, respectively, OsTarget1 parent 1 and parent 2 form specific melting peaks AT different Tm sites, a first generation of hybrid material forms two specific melting peaks, which are located AT the corresponding Tm sites of the melting peaks of parent 1 and parent 2, respectively, the difference of the peak heights of the two melting peaks is small, and the Δ Tm of the two products of the hybrid gene type is 6.2 ℃.

As shown in FIG. 4f, when GC-add (10 bases) and AT-add (14 bases) with different lengths are located AT 17 bases from the 3' end of ASP1 and ASP2, respectively (SEQ ID NO:19& SEQ ID NO:20), OsTarget1, parent 1 and parent 2 form specific melting peaks AT different Tm sites, a first generation of hybrid material forms two specific melting peaks, which are located AT the corresponding Tm sites of the melting peaks of parent 1 and parent 2, respectively, the peak heights of the two melting peaks are almost the same, and the Δ Tm of the two products of the hybrid gene is 6.0 ℃.

As shown in FIG. 4g, when GC-add (16 bases) and AT-add (16 bases) with the same length are located AT 14 bases from the 3' end of ASP1 and ASP2, respectively (SEQ ID NO:16& SEQ ID NO:18), OsTarget1, parent 1 and parent 2 form specific melting peaks AT different Tm sites, a first generation of hybrid material forms two specific melting peaks, which are located AT the corresponding Tm sites of the melting peaks of parent 1 and parent 2, respectively, the peak heights of the two melting peaks are almost the same, and the Δ Tm of the two products of the hybrid gene type is 5.6 ℃.

In summary, the addition of GC-add and AT-add of the same length or different lengths to the same position AT the 5 'end and inside of the ASP1 and ASP2 primers, respectively, can significantly increase the Δ Tm between the two amplification products and complete genotyping assay by melting curve, and the effect of GC-add and AT-add located in ASP (Δ Tm ═ 5.6 ℃ -6.2 ℃) is better than that located AT the 5' end of ASP (Δ Tm ═ 4.0 ℃); the heterogeneous amplification phenomenon in the detection of heterozygous genotype samples can be eliminated by adjusting the insertion sites of GC-add and AT-add in ASP.

Example 2

The rice target gene 2(OsTarget2) is used as a template to test the genotyping detection effect when GC-add and AT-add are respectively added AT different positions of ASP1 and ASP2, the allelic gene polymorphic site is G (allee 1)/T (allee 2) genotype, and the GC-add and AT-add respectively use SEQ ID NO:1 and SEQ ID NO:2, and 1 add sequence and 11 primers are designed in total, as shown in the following Table 5:

TABLE 5 primer and add sequence Listing

The combinations of ASP1 and ASP2 are: SEQ ID NO 23& SEQ ID NO 24, SEQ ID NO 25& SEQ ID NO 26, SEQ ID NO 27& SEQ ID NO 28, SEQ ID NO 27& SEQ ID NO 29, SEQ ID NO 30& SEQ ID NO 31 and SEQ ID NO 30& SEQ ID NO 32.

The specific embodiment, including the test sample, reagents and experimental procedures, except for the primer and probe combination, are the same as in example 1, and the specific test results are shown in fig. 5.

As shown in FIG. 5a, when ASP1 and ASP2 do not contain GC-add and AT-add (SEQ ID NO:23& SEQ ID NO:24), the difference in melting peak positions between OsTarget2 parent 1 and parent 2 is very small, Δ Tm is 0.3 ℃, hybrid genotypes have only one melting peak formed, and thus conventional ASP1 and ASP2 cannot complete genotyping by melting curve analysis for this SNP site.

As shown in FIG. 5b, when GC-add and AT-add are located AT 5' ends of ASP1 and ASP2 (SEQ ID NO:25& SEQ ID NO:26), respectively, OsTarget2 parent 1 and parent 2 form specific melting peaks AT different Tm sites, a hybrid generation material forms two specific melting peaks, which are located AT the corresponding Tm sites of the melting peaks of parent 1 and parent 2, respectively, and the Δ Tm of the two products of the hybrid genotype is 5.0 ℃.

As shown in FIG. 5c, when GC-add and AT-add were located AT 17 bases from the 3 'end of ASP1 and 19 bases from the 3' end of ASP2, respectively (SEQ ID NO:27& SEQ ID NO:28), OsTarget2, parent 1 and parent 2, formed specific melting peaks AT different Tm sites, and the first hybrid generation material formed two specific melting peaks located AT the corresponding Tm sites of parent 1 and parent 2, respectively, and the Δ Tm of both products of the hybrid genotype was 6.5 ℃.

As shown in FIG. 5d, when GC-add and AT-add were located AT 19 bases from the 3 'end of ASP1 and 20 bases from the 3' end of ASP2, respectively (SEQ ID NO:30& SEQ ID NO:31), OsTarget2, parent 1 and parent 2, formed specific melting peaks AT different Tm sites, and the first hybrid generation material formed two specific melting peaks, located AT the Tm sites corresponding to the melting peaks of parent 1 and parent 2, respectively, and the Δ Tm of both products of the hybrid genotype was 6.5 ℃.

As shown in FIG. 5e, when GC-add and AT-add of equal length are located AT 17 bases from 3 'end of ASP1 and 19 bases from 3' end of ASP2, respectively (SEQ ID NO:27& SEQ ID NO:29), OsTarget2 parent 1 and parent 2 form specific melting peaks AT different Tm sites, a hybrid generation of material forms two specific melting peaks located AT the corresponding Tm sites of parent 1 and parent 2, respectively, and the Δ Tm of both products of the hybrid genotype is 6.5 ℃.

As shown in FIG. 5f, when GC-add and AT-add of equal length are located AT 19 bases from 3 'end of ASP1 and 20 bases from 3' end of ASP2, respectively (SEQ ID NO:30& SEQ ID NO:32), OsTarget2 parent 1 and parent 2 form specific melting peaks AT different Tm sites, a first generation of hybrid material forms two specific melting peaks located AT the Tm sites corresponding to the melting peaks of parent 1 and parent 2, respectively, and Δ Tm of the two products of the hybrid genotype is 6.5 ℃.

In summary, the addition of GC-add and AT-add of different or same length AT different positions AT the 5 'end and inside of ASP1 and ASP2, respectively, can significantly increase the Δ Tm between the two amplification products for genotyping determination by melting curves, and the effect is better AT the ASP inside (Δ Tm ═ 6.5 ℃) than AT the 5' end (Δ Tm ═ 5.0 ℃).

Example 3

A large number of population sample typing assays were performed using rice target gene 1(OsTarget 1).

ASP1, ASP2 and LSP were tested using SEQ ID NO 19, SEQ ID NO 20 and SEQ ID NO 21, respectively, for a total of 92 samples and 4 NTC.

The specific implementation mode, including the test samples, reagents and experimental procedures used are the same as in example 1, and the specific test results are shown in fig. 6.

As can be seen from fig. 6, the homozygous materials of the two genotypes form specific melting peaks at different Tm sites, the heterozygous material forms two specific melting peaks, the two specific melting peaks are respectively located at the Tm sites corresponding to the homozygous materials of the two genotypes (fig. 6a), the 92 samples and the 4 NTC samples are successfully tested and typed (fig. 6b), and the test result is consistent with the PARMS test result (wuhan cijing peptide biotechnology limited).

Example 4

A large number of population sample typing assays were performed using rice target gene 2(OsTarget 2).

ASP1, ASP2 and LSP were tested using SEQ ID NO 30, SEQ ID NO 31 and SEQ ID NO 33, respectively, for a total of 92 samples and 4 NTCs.

The specific implementation mode, including the test samples, reagents and experimental procedures used are the same as in example 1, and the specific test results are shown in fig. 7.

As can be seen from fig. 7, the homozygous materials of the two genotypes form specific melting peaks at different Tm sites, the heterozygous materials form two specific melting peaks, which are respectively located at the corresponding Tm sites of the homozygous materials of the two genotypes (fig. 7a), 92 samples and 4 NTC samples are successfully tested and typed (fig. 7b), and the test results are consistent with those of PARMS (wuhan city peptide biotechnology limited).

Example 5

The single-tube reaction is used for simultaneously carrying out melting curve typing detection on two target genes (rice target gene 1(Ostarget1) and rice target gene 2(Ostarget 2)).

ASP1, ASP2 and LSP of the rice target gene 1(Ostarget1) use SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:21, respectively; ASP1, ASP2 and LSP of the rice target gene 2(Ostarget2) use SEQ ID NO 30, SEQ ID NO 31 and SEQ ID NO 33, respectively.

Primers of each target gene were prepared into a mixed solution (primer mix) according to table 6, and a reaction system was prepared according to table 7; the details are as follows:

TABLE 6 preparation of mixture of target Gene typing primers (primer mix)

TABLE 7 Dual assay reaction System formulation

The specific implementation mode, including the test samples, reagents and experimental procedures are the same as those in example 1, and the specific test results are shown in FIG. 8.

As can be seen from FIG. 8, in the homozygous material assay, each target gene forms a specific melting peak at a corresponding single Tm site, and 1 homozygous material forms 2 melting peaks in total without interfering with each other (FIGS. 8a and 8 b); in the hybrid material detection, each target gene forms specific melting peaks at two corresponding Tm sites, 4 melting peaks are formed in 1 hybrid material and are not interfered with each other (fig. 8c), the detection result is consistent with the PARMS detection result (Wuhan city scenery peptide Biotechnology Co., Ltd.), and NTC is not amplified (fig. 8 d).

Example 6

The single-tube reaction simultaneously carries out melting curve typing detection on three target genes (a rice target gene 1(Ostarget1), a rice target gene 2(Ostarget2) and a rice target gene 3(Ostarget 3)).

ASP1, ASP2 and LSP of the rice target gene 1(Ostarget1) use SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:21, respectively; ASP1, ASP2 and LSP of the rice target gene 2(Ostarget2) use SEQ ID NO 30, SEQ ID NO 31 and SEQ ID NO 33, respectively.

The rice target gene 3(OsTarget3) allelic polymorphism site is C (Allle 1)/A (Allle 2) genotype, and the GC-add and AT-add respectively use SEQ ID NO:1 and SEQ ID NO:2, and 5 primers are designed in total, as shown in the following table 8:

TABLE 8 primer and add sequence Listing

ASP1, ASP2 and LSP of the rice target gene 3(OsTarget3) use SEQ ID NO:36, SEQ ID NO:37 and SEQ ID NO:38, respectively.

The specific implementation mode, including the test samples, reagents and experimental procedures used are the same as in example 1, and the specific test results are shown in fig. 9.

As can be seen from FIG. 9, in the homozygous material assay, each target gene forms a specific melting peak at a corresponding single Tm site, and 1 homozygous material forms 3 melting peaks in total without interfering with each other (FIGS. 9a and 9 b); in the hybrid material detection, each target gene forms specific melting peaks at two corresponding Tm sites, 1 hybrid material forms 6 melting peaks in total, the melting peaks are not interfered with each other (FIG. 9c), the detection result is consistent with the PARMS detection result (Wuhan city peptide Biotechnology Co., Ltd.), and NTC is not amplified (FIG. 9 d).

Example 7

And (4) carrying out detection and identification of multiple alleles by using a melting curve.

Specifically, four kinds of homozygote samples Wx-a, Wx-in, Wx-op and Wx-mq of rice starch grain combined starch synthase gene (grain-bound starch synthase I, GBSS I, waxy, Wx) and a Wx-a/Wx-in and Wx-op/Wx-mq heterozygote are used as detection objects. These four alleles differ at 5 SNP sites: the Int1-1 site is G (Allole 1)/T (Allole 2) genotype; the Ex4-53 site is G (Allole 1)/A (Allole 2) genotype; the Ex4-77 site is G (Allele1)/A (Allele2) genotype; the Ex6-62 site is C (allee 1)/A (allee 2) genotype; the Ex10-115 locus is C (Allole 1)/T (Allole 2) genotype, and the specific information is shown in Table 9 and Table 10:

TABLE 9 SNP profiles of individual multiple genotypes of rice Wx

TABLE 10 SNP profiles of Wx Gene of Rice related to the present invention

Wherein, the sequence of SEQ ID NO:72 (OsWx Int1-1 Allole 1) is as follows: TCATCAGGAAGAACATCTGCAAGGTATACATATATGTTTATAATTCTTTGTTTCCCCTCTTATTCAGATCGA, respectively;

the sequence of SEQ ID NO:73 (OsWx Int1-1 Allole 2) is as follows: TCATCAGGAAGAACATCTGCAAGTTATACATATATGTTTATAATTCTTTGTTTCCCCTCTTATTCAGATCGA, respectively;

the sequence of SEQ ID NO:74 (OsWx Ex4-53 Allole 1) is as follows: AATTCATTGCAGATCAAGGTTGCAGACAGGTACGAGAGGGTGAGGTTTTTCCATTGCTACAAGCGTGGAGTCGACCGTGTGTTCAT, respectively;

the sequence of SEQ ID NO:75 (OsWx Ex4-53 Allole 2) is as follows: AATTCATTGCAGATCAAGGTTGCAGACAGGTACGAGAGGGTGAGGTTTTTCCATTGCTACAAGCATGGAGTCGACCGTGTGTTCAT, respectively;

the sequence of SEQ ID NO:76 (OsWx Ex4-77 Allole 1) is as follows: TCGACCGTGTGTTCATCGGCCATCCGTCATTCCTGGAGAAGGTGGAGTCATCATTA, respectively;

the sequence of SEQ ID NO:77 (OsWx Ex4-77 Allole 2) is as follows: TCGACCGTGTGTTCATCGACCATCCGTCATTCCTGGAGAAGGTGGAGTCATCATTA, respectively;

the sequence of SEQ ID NO:78 (OsWx Ex6-62 Allole 1) is as follows: GCTCCTAGGATCCTAAACCTCAACAACAACCCATACTTCAAAGGAACTTCTGGTGAGTTATAATTGATCTCAAGAT;

the sequence of SEQ ID NO:79 (OsWx Ex6-62 Allole 2) is as follows: GCTCCTAGGATCCTAAACCTCAACAACAACCCATACTTCAAAGGAACTTATGGTGAGTTATAATTGATCTCAAGAT, respectively;

the sequence of SEQ ID NO:80 (OsWx Ex10-115 Allole 1) is as follows: CTGGAGGAACAGAAGGGCCCTGACGTCATGGCCGCCGCCATCCCGGAGCTCATGCAGGAGGACGTCCAGATCGTTCTTCTGGTATAA, respectively;

the sequence of SEQ ID NO:81 (OsWx Ex10-115 Allole 2) is as follows: CTGGAGGAACAGAAGGGCTCTGACGTCATGGCCGCCGCCATCCCGGAGCTCATGCAGGAGGACGTCCAGATCGTTCTTCTGGTATAA are provided.

For the five SNP sites, a total of 2 add sequences and 25 primers were designed as shown in Table 11 below:

TABLE 11 primer and add sequence Listing

The 6 genotype materials were tested in two sets of tests: one group is Wx-a homozygote, Wx-in homozygote and Wx-a/Wx-in heterozygote, and the other group is Wx-op homozygote, Wx-mq homozygote and Wx-op/Wx-mq heterozygote; three modes are designed for each genotype to complete the detection of 5 SNP sites, and the detection method specifically comprises the following steps:

first (singleplex detection): each genotype requires 5 reactions to complete the detection of 5 SNP sites, and each reaction detects 1 site;

second (double + single detection): each genotype needs 3 reactions to complete 5 SNP site detections, 2 reactions all detect 2 SNP sites, and the other 1 reaction detects 1 SNP site;

third (double + triple test): each genotype requires 2 reactions to complete 5 SNP site detections, with 1 reaction detecting 2 SNP sites and the other 1 reaction detecting 3 SNP sites.

FIG. 10 is a graph showing the results of "single-fold detection" of Wx-a homozygote (FIG. 10a), Wx-in homozygote (FIG. 10b) and Wx-a/Wx-in heterozygote (FIG. 10c), wherein it can be seen that in the single-fold reactions of Int1-1, Ex4-53 and Ex4-77, both homozygote and heterozygote materials generate single melting peaks corresponding to the sites of Int1-1 Allle 1, Ex4-53 Allle 1 and Ex4-77 Allle 2, respectively; in the single reaction of Ex6-62, both the Wx-a homozygote and the Wx-in homozygote generate single melting peaks respectively corresponding to Ex6-62 Allole 2 sites and Ex6-62 Allole 1 sites, and the hybrid material generates two melting peaks respectively corresponding to Ex6-62 Allole 1 sites and Ex6-62 Allole 2 sites; in the single reaction of Ex10-115, both Wx-a and Wx-in homozygote generate single melting peak respectively corresponding to Ex10-115 Allle 2 and Ex10-115 Allle 1 sites, and the hybrid material generates two melting peaks respectively corresponding to Ex10-115 Allle 1 and Ex10-115 Allle 2 sites; none of the NTCs amplified (fig. 10 d); all the results were correct and consistent with the PARMS test (Wuhan City peptide Biotech Co., Ltd.).

FIG. 11 is a graph showing the results of "double + single detection" of Wx-a homozygote, Wx-in homozygote and Wx-a/Wx-in heterozygote, wherein it can be seen that in the double reaction of Int1-1& Ex4-53, both homozygous and heterozygous materials generate two melting peaks corresponding to the sites of Int1-1 Allle 1 and Ex4-53 Allle 1; in the double reaction of Ex6-62& Ex10-115, two melting peaks are generated by the Wx-a homozygote and correspond to Ex6-62 Allole 2 and Ex10-115 Allle 2 sites respectively, and two melting peaks are generated by the Wx-in homozygote and correspond to Ex6-62 Allle 1 and Ex10-115 Allle 1 sites respectively; the hybrid material generates four melting peaks which respectively correspond to Ex6-62 Allole 1, Ex6-62 Allole 2, Ex10-115 Allole 1 and Ex10-115 Allole 2; in Ex4-77 single-fold reaction, single melting peaks are generated on the homozygous material and the heterozygous material, and the single melting peaks correspond to Ex4-77 Allole 2 sites; NTC has no amplification; all the results were correct and consistent with the "singleplex assay" and the PARMS assay (Wuhan City peptide Biotech Co., Ltd.).

FIG. 12 is a diagram showing the results of "double + triple detection" of Wx-a homozygote, Wx-in homozygote and Wx-a/Wx-in heterozygote, wherein two melting peaks are generated in Wx-a homozygote in the double reaction of Ex4-53& Ex6-62, corresponding to Ex4-53 Allle 1 and Ex6-62 Allle 2 sites, two melting peaks are generated in Wx-in homozygote, corresponding to Ex4-53 Allle 1 and Ex6-62 Allle 1 sites, and three melting peaks are generated in hybrid material, corresponding to Ex4-53 Allle 1, Ex6-62 Allle 1 and Ex6-62 Allle 2 sites; in triple reactions of Int1-1& Ex4-77& Ex10-115, a Wx-a homozygote generates three melting peaks corresponding to Int1-1 Allle 1, Ex4-77 Allle 2 and Ex10-115 Allle 2 sites, a Wx-in homozygote generates three melting peaks corresponding to Int1-1 Allle 1, Ex4-77 Allle 2 and Ex10-115 Allle 1 sites, and a hybrid material generates four melting peaks corresponding to Int1-1 Allle 1, Ex4-77 Allle 2, Ex10-115 Allle 1 and Ex10-115 Allle 2 sites; NTC has no amplification; all the results were correct and consistent with the "single test" result, the "double + single test" result and the PARMS test result (Wuhan city peptide Biotechnology Co., Ltd.).

FIG. 13 shows the results of "single-fold detection" of Wx-op homozygote (FIG. 13a), Wx-mq (FIG. 13b) homozygote and Wx-op/Wx-mq heterozygote (FIG. 13c), wherein in the single-fold reactions of Ex6-62 and Ex10-115, the homozygote and heterozygote materials generate single melting peaks corresponding to Ex6-62 Allle 2 and Ex10-115 Allle 1 sites, respectively; in the Int1-1 single reaction, both Wx-op homozygote and Wx-mq homozygote generate single melting peaks respectively corresponding to Int1-1 Allle 1 and Int1-1 Allle 2 sites, and the hybrid material generates two melting peaks respectively corresponding to Int1-1 Allle 1 and Int1-1 Allle 2 sites; in the Ex4-53 single reaction, both the Wx-op homozygote and the Wx-mq homozygote generate single melting peaks respectively corresponding to Ex4-53 Allole 1 sites and Ex4-53 Allole 2 sites, and the hybrid material generates two melting peaks respectively corresponding to Ex4-53 Allole 1 sites and Ex4-53 Allole 2 sites; in Ex4-77 single reaction, both Wx-op homozygote and Wx-mq homozygote generate single melting peaks respectively corresponding to Ex4-77 Allole 1 sites and Ex4-77 Allole 2 sites, and the hybrid material generates two melting peaks respectively corresponding to Ex4-77 Allole 1 sites and Ex4-77 Allole 2 sites; none of the NTCs amplified (fig. 13 d); all the results were correct and consistent with the PARMS test (Wuhan city Scopolia).

FIG. 14 shows the results of "double + single detection" of Wx-op homozygote, Wx-mq homozygote and Wx-op/Wx-mq heterozygote, wherein in the double reaction of Int1-1& Ex4-77, Wx-op homozygote generates two melting peaks corresponding to the positions of Int1-1 Allle 1 and Ex4-77 Allle 1, Wx-mq homozygote generates two melting peaks corresponding to the positions of Int1-1 Allle 2 and Ex4-77 Allle 2, and hybrid material generates four melting peaks corresponding to the positions of Int1-1 Allle 1, Int1-1 Allle 2, Ex4-77 Allle 1 and Ex 4-Allle 2; in the double reaction of Ex6-62& Ex10-115, the homozygous and heterozygous materials generate two melting peaks which respectively correspond to Ex6-62 Allole 2 sites and Ex10-115 Allole 1 sites; in the Ex4-53 single reaction, both the Wx-op homozygote and the Wx-mq homozygote generate single melting peaks respectively corresponding to Ex4-53 Allole 1 sites and Ex4-53 Allole 2 sites, and the hybrid material generates two melting peaks respectively corresponding to Ex4-53 Allole 1 sites and Ex4-53 Allole 2 sites; NTC has no amplification; all the results were correct and consistent with the "singleplex assay" and the PARMS assay (Wuhan City peptide Biotech Co., Ltd.).

FIG. 15 shows the results of "double + triple detection" of Wx-op homozygote, Wx-mq homozygote and Wx-op/Wx-mq heterozygote, wherein in the double reaction of Ex4-53& Ex6-62, the Wx-op homozygote generates two melting peaks corresponding to Ex4-53 Allle 1 and Ex6-62 Allle 2 sites, the Wx-mq homozygote generates two melting peaks corresponding to Ex4-53 Allle 2 and Ex6-62 Allle 2 sites, and the hybrid material generates three melting peaks corresponding to Ex4-53 Allle 1, Ex4-53 Allle 2 and Ex6-62 Allle 2 sites; in the triple reaction of Int1-1& Ex4-77& Ex10-115, the Wx-op homozygote generates three melting peaks corresponding to the sites of Int1-1 Allole 1, Ex4-77 Allole 1 and Ex10-115 Allole 1; the Wx-mq homozygote generates three melting peaks which respectively correspond to Int1-1 Allle 2, Ex4-77 Allle 2 and Ex10-115 Allle 1 sites, and the hybrid material generates five melting peaks which respectively correspond to Int1-1 Allle 1, Int1-1 Allle 2, Ex4-77 Allle 1, Ex4-77 Allle 2 and Ex10-115 Allle 1 sites; none of the NTCs was amplified. All the results were correct and consistent with the "single test" result, the "double + single test" result and the PARMS test result (Wuhan City peptide Biotech Co., Ltd.).

In conclusion, the high-resolution melting curve can complete the typing identification of the multiple alleles, and the workload can be greatly reduced by adopting a multiple amplification mode on the premise of ensuring the detection result.

Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art will understand that: any person skilled in the art can modify or easily conceive the technical solutions described in the foregoing embodiments or equivalent substitutes for some technical features within the technical scope of the present disclosure; such modifications, changes or substitutions do not depart from the spirit and scope of the embodiments of the present invention, and they should be construed as being included therein.

Sequence listing

<110> Wuhan City scene peptide Biotech Co., Ltd

<120> an identification method for genotyping of genetic polymorphisms and use thereof

<160> 85

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgggcagggc 10

<210> 2

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aattatataa atta 14

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgtccacggg cagggctgga ca 22

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtccaaatt atataaatta tggaca 26

<210> 5

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccacgggcag ggctgg 16

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccaaattata taaattatgg 20

<210> 7

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccaaattaaa ttatgg 16

<210> 8

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttttaatact aaatgtacaa atcctggagt 30

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttttaatact aaatgtacaa atcctggaga 30

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgggcagggc ttttaatact aaatgtacaa atcctggagt 40

<210> 11

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aattatataa attattttaa tactaaatgt acaaatcctg gaga 44

<210> 12

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ttttaatact aaatgtacaa atgtccacgg gcagggctgg acattttcct ggagt 55

<210> 13

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ttttaatact aaatgtacaa atgtccaaat tatataaatt atggacattt tcctggaga 59

<210> 14

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ttttaatact aaatgtacaa tgtccacggg cagggctgga caatcctgga gt 52

<210> 15

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ttttaatact aaatgtacaa tgtccaaatt atataaatta tggacaatcc tggaga 56

<210> 16

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ttttaatact aaatgtccac gggcagggct ggacaaatcc tggagt 46

<210> 17

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ttttaatact aaatgtccaa attatataaa ttatggacaa atcctggaga 50

<210> 18

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ttttaatact aaatgtccaa attaaattat ggacaaatcc tggaga 46

<210> 19

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ttttaatact aaacgggcag ggctgtacaa atcctggagt 40

<210> 20

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ttttaatact aaaaattata taaattatgt acaaatcctg gaga 44

<210> 21

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

caaagttagt gaattttcac caatgat 27

<210> 22

<211> 10

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

aattaaatta 10

<210> 23

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cgattttgca ttgtaaagaa cctaatc 27

<210> 24

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

cgattttgca ttgtaaagaa cctaata 27

<210> 25

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cgggcagggc cgattttgca ttgtaaagaa cctaatc 37

<210> 26

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

aattatataa attacgattt tgcattgtaa agaacctaat a 41

<210> 27

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

cgattttgca cgggcagggc ttgtaaagaa cctaatc 37

<210> 28

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cgattttgaa ttatataaat tacattgtaa agaacctaat a 41

<210> 29

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

cgattttgaa ttaaattaca ttgtaaagaa cctaata 37

<210> 30

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

cgattttgcg ggcagggcca ttgtaaagaa cctaatc 37

<210> 31

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

cgattttaat tatataaatt agcattgtaa agaacctaat a 41

<210> 32

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

cgattttaat taaattagca ttgtaaagaa cctaata 37

<210> 33

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ttcataagca agcttataat gttcagata 29

<210> 34

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

cgattccaac aacaagcaaa cac 23

<210> 35

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

cgattccaac aacaagcaaa caa 23

<210> 36

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

cgattccaac gggcagggcc aacaagcaaa cac 33

<210> 37

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

cgataattat ataaattatc caacaacaag caaacaa 37

<210> 38

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

actgcgatct tgaagggtgg tc 22

<210> 39

<211> 6

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

ggcagg 6

<210> 40

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gccgggcagg gccg 14

<210> 41

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

tcatcaggaa gaacatctgc aagg 24

<210> 42

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

tcatcaggaa gaacatctgc aagt 24

<210> 43

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

tcatggcagg caggaagaac atctgcaagg 30

<210> 44

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

tcataattat ataaattaca ggaagaacat ctgcaagt 38

<210> 45

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

tcgatctgaa taagagggga aaca 24

<210> 46

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

atgaacacac ggtcgactcc ac 22

<210> 47

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

atgaacacac ggtcgactcc at 22

<210> 48

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

atgaacaccg ggcagggcac ggtcgactcc ac 32

<210> 49

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

ataattatat aaattagaac acacggtcga ctccat 36

<210> 50

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

aattcattgc agatcaaggt tgca 24

<210> 51

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

tcgaccgtgt gttcatcgg 19

<210> 52

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

tcgaccgtgt gttcatcga 19

<210> 53

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

tcgacgggca gggcccgtgt gttcatcgg 29

<210> 54

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

tcgaaattat ataaattacc gtgtgttcat cga 33

<210> 55

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 55

taatgatgac tccaccttct ccag 24

<210> 56

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 56

atcttgagat caattataac tcaccag 27

<210> 57

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 57

atcttgagat caattataac tcaccat 27

<210> 58

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 58

cgggcagggc atcttgagat caattataac tcaccag 37

<210> 59

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 59

atctaattat ataaattatg agatcaatta taactcacca t 41

<210> 60

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 60

gctcctagga tcctaaacct caac 24

<210> 61

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 61

ctggaggaac agaagggcc 19

<210> 62

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 62

ctggaggaac agaagggct 19

<210> 63

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 63

ctggaggccg ggcagggccg gaacagaagg gcc 33

<210> 64

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 64

aattatataa attactggag gaacagaagg gct 33

<210> 65

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 65

ttataccaga agaacgatct ggacg 25

<210> 66

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 66

ttttaatact aaatgtacaa atcctggagt aatcattggt gaaaattcac taactttg 58

<210> 67

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 67

ttttaatact aaatgtacaa atcctggaga aatcattggt gaaaattcac taactttg 58

<210> 68

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 68

ttcataagca agcttataat gttcagataa aaagattagg ttctttacaa tgcaaaatcg 60

<210> 69

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 69

ttcataagca agcttataat gttcagataa aaatattagg ttctttacaa tgcaaaatcg 60

<210> 70

<211> 84

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 70

cgattccaac aacaagcaaa cacggagcga ctttgtcatc caccgctctc gacaaaacac 60

aagaccaccc ttcaagatcg cagt 84

<210> 71

<211> 84

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 71

cgattccaac aacaagcaaa caaggagcga ctttgtcatc caccgctctc gacaaaacac 60

aagaccaccc ttcaagatcg cagt 84

<210> 72

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 72

tcatcaggaa gaacatctgc aaggtataca tatatgttta taattctttg tttcccctct 60

tattcagatc ga 72

<210> 73

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 73

tcatcaggaa gaacatctgc aagttataca tatatgttta taattctttg tttcccctct 60

tattcagatc ga 72

<210> 74

<211> 86

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 74

aattcattgc agatcaaggt tgcagacagg tacgagaggg tgaggttttt ccattgctac 60

aagcgtggag tcgaccgtgt gttcat 86

<210> 75

<211> 86

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 75

aattcattgc agatcaaggt tgcagacagg tacgagaggg tgaggttttt ccattgctac 60

aagcatggag tcgaccgtgt gttcat 86

<210> 76

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 76

tcgaccgtgt gttcatcggc catccgtcat tcctggagaa ggtggagtca tcatta 56

<210> 77

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 77

tcgaccgtgt gttcatcgac catccgtcat tcctggagaa ggtggagtca tcatta 56

<210> 78

<211> 76

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 78

gctcctagga tcctaaacct caacaacaac ccatacttca aaggaacttc tggtgagtta 60

taattgatct caagat 76

<210> 79

<211> 76

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 79

gctcctagga tcctaaacct caacaacaac ccatacttca aaggaactta tggtgagtta 60

taattgatct caagat 76

<210> 80

<211> 87

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 80

ctggaggaac agaagggccc tgacgtcatg gccgccgcca tcccggagct catgcaggag 60

gacgtccaga tcgttcttct ggtataa 87

<210> 81

<211> 87

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 81

ctggaggaac agaagggctc tgacgtcatg gccgccgcca tcccggagct catgcaggag 60

gacgtccaga tcgttcttct ggtataa 87

<210> 82

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 82

cgggcagggc ttttaatact aaatgtacaa atcctggagt aaatcattgg tgaaaattca 60

ctaactttg 69

<210> 83

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 83

aattatataa attattttaa tactaaatgt acaaatcctg gagaaaatca ttggtgaaaa 60

ttcactaact ttg 73

<210> 84

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 84

ttttaatact aaacgggcag ggctgtacaa atcctggagt aaatcattgg tgaaaattca 60

ctaactttg 69

<210> 85

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 85

ttttaatact aaaaattata taaattatgt acaaatcctg gagaaaatca ttggtgaaaa 60

ttcactaact ttg 73

Claims (26)

1. An identification method for genotyping a genetic polymorphism, comprising the steps of:

s1, respectively designing two specific primers ASP1 and ASP2 corresponding to different polymorphic sites and a universal reverse primer LSP according to gene sequences of the different polymorphic sites in a sample to be detected;

s2, embedding an additional sequence in the specific primers ASP1 and ASP2 respectively, and matching the 3' terminal base of the specific primers ASP1 and ASP2 with different polymorphic sites in the sample to be detected respectively;

s3, preparing a PCR reaction system, adding corresponding reagents, and carrying out AS-PCR amplification reaction;

and S4, after the amplification reaction is finished, analyzing through a melting curve, and completing the genotyping identification of the sample to be detected.

2. The method for identifying a polymorphic locus according to claim 1, wherein in step S1, the specific primers ASP1 and ASP2 are located upstream of the polymorphic locus or downstream of the polymorphic locus.

3. The method of claim 1, wherein the additional sequence is inserted at a position which is 10 bases away from the 3 'end of the specific primer in the shortest distance and may be located at the 5' end of the specific primer in the farthest distance in step S2.

4. The method of claim 1, wherein the additional sequence is selected from one of GC-add and AT-add in step S2.

5. The method of claim 4, wherein said GC-add is added to said specific primer ASP1 and said AT-add is added to said specific primer ASP 2.

6. The method of claim 5, wherein the GC-add and the AT-add are located AT the same or different distances from the 3' terminal base and the insertion site on the specific primers ASP1 and ASP2, respectively.

7. The method of claim 4, wherein the GC-add and the AT-add are the same or different in length.

8. The method of claim 4, wherein the GC-add and the AT-add consist of AT least one of the following:

1) a nucleotide base;

2) a nucleotide base analog;

3) a chemically modified nucleotide base.

9. The method according to claim 4, wherein the GC-add has a length of 3 to 40bp, and the ratio of guanine bases (G) to cytosine bases (C) in the GC-add is not less than 60%.

10. The method according to claim 4, wherein the AT-add has a length of 3 to 40bp, and the ratio of the adenine bases (A) to the thymine bases (T) in the AT-add is not less than 60%.

11. The method of claim 1, wherein in step S3, the PCR reaction system comprises two specific primers ASP1 and ASP2 corresponding to different polymorphic sites, a universal reverse primer LSP, a buffer system, DNA polymerase, dNTPs, sample DNA to be detected, and a fluorescent dye.

12. The method for identifying a polymorphism of a gene according to claim 11, wherein the fluorescent dye includes a fluorescent dye that can specifically bind to or intercalate into double-stranded DNA and generate a fluorescent signal.

13. The method of claim 11, wherein the sample DNA to be tested comprises double-stranded DNA, single-stranded DNA, linear DNA, circular DNA, and cDNA transcribed from RNA.

14. The method of claim 1, wherein in the step S4, the temperature increase rate in the temperature increase process for melting the double-stranded DNA is not less than 1.5 ℃/min during the melting curve analysis.

15. The method of claim 1, wherein the AS-PCR amplification reaction is performed in a single tube, and the typing of two or more target genes can be simultaneously detected in the single tube.

16. The method of claim 1, wherein the identification of the genotyping of the genetic polymorphisms is the identification of a multiple allele polymorphism genotyping.

17. The method of claim 16, wherein in the step of identifying the multiple allele polymorphism, the AS-PCR amplification reaction is performed in a single tube, and the single polymorphic site in the multiple allele is detected sequentially by the single tube reaction or a plurality of polymorphic sites in the multiple allele is detected simultaneously by the single tube reaction, thereby completing the identification of the multiple allele polymorphism.

18. The method of claim 17, wherein the multiple genes are rice starch granule-bound starch synthase genes, and the differential SNP sites of the rice starch granule-bound starch synthase genes are Int1-1, Ex4-53, Ex4-77, Ex6-62, and Ex10-105, respectively.

19. The method of claim 18, wherein the primer sequence for detecting Int1-1 is represented by SEQ ID NO 41-45; the sequence of the primer for detecting Ex4-53 is shown in SEQ ID NO. 46-50; the sequence of the primer for detecting Ex4-77 is shown as SEQ ID NO 51-55; the sequence of the primer for detecting Ex6-62 is shown as SEQ ID NO 56-60; the primer sequence for detecting Ex10-105 is shown in SEQ ID NO 61-65.

20. The method of claim 19, further comprising primers having at least 60% or more sequence identity to the Int1-1 primer sequence, the Ex4-53 primer sequence, the Ex4-77 primer sequence, the Ex6-62 primer sequence, and the Ex10-105 primer sequence.

21. An identification system for genotyping a genetic polymorphism, comprising the following modules:

an information acquisition module: respectively designing two specific primers ASP1 and ASP2 corresponding to different polymorphic sites and a universal reverse primer LSP according to gene sequences of the different polymorphic sites in a sample to be detected;

a primer design module: embedding an additional sequence into the specific primers ASP1 and ASP2 respectively, and matching the 3' terminal base of the specific primers ASP1 and ASP2 with different polymorphic sites in a sample to be detected respectively to obtain primers for genotyping of gene polymorphism;

a PCR amplification reaction module: preparing a PCR reaction system, adding corresponding reagents, and carrying out AS-PCR amplification reaction;

an analysis module: after the amplification reaction is finished, the genotyping identification of the sample to be detected can be finished through the analysis of the melting curve.

22. The identification system for genotyping of gene polymorphisms of claim 21, wherein said primer design module further comprises a primer-related parameter optimization module for optimizing the position of the primer on the template, the primer length, the annealing temperature, the GC content, the GC-add and AT-add selections, the GC-add and AT-add insertion sites on the primer.

23. A primer for typing a gene polymorphism, which is designed by the primer design module according to claim 21.

24. A detection kit for genotyping of gene polymorphisms, comprising the PCR reaction system according to claim 1 or claim 11 in the method for identifying gene polymorphisms.

25. Use of the method for identifying a genetic polymorphism according to any one of claims 1 to 20 for detecting an allelic polymorphism.

26. The use of claim 25, wherein the allelic polymorphism typing assay is a rice allelic polymorphism typing assay or a rice multiple allelic polymorphism typing assay.

Images