CN114957416A

CN114957416A - Rice antibacterial protein AntiB-1 and application thereof

Info

Publication number: CN114957416A
Application number: CN202011336667.0A
Authority: CN
Inventors: 李文奇; 杨杰; 王军; 范方军; 王芳权; 许扬; 陶亚军; 蒋彦婕; 陈智慧
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2020-11-25
Filing date: 2020-11-25
Publication date: 2022-08-30

Abstract

The invention discloses a rice antimicrobial protein AntiB-1 and application thereof. Application of rice AntiB-1 protein in preparing medicines for preventing and treating rice blast is disclosed. The gene sequence of the protein is numbered XM _015779840.2 in Genbank. The invention utilizes the antibacterial protein derived from the rice, and has the advantages of safety, greenness, high efficiency and the like for preventing and treating rice blast germs.

Description

Rice antibacterial protein AntiB-1 and application thereof

Technical Field

The invention belongs to the field of agricultural bioengineering, and relates to a rice antimicrobial protein AntiB-1 and application thereof.

Background

The rice blast is the most destructive fungal disease that jeopardizes the safe production of rice. Chemical pesticides have the advantages of obvious bactericidal effect and the like, are often used as the first choice for preventing and treating rice blast in agricultural production, but have potential adverse effects on the safety of ecological environment. The cultivation and popularization of disease-resistant rice varieties by using resistance genes are important ways for preventing and controlling rice blast in agricultural production at present. However, with the extensive spread of resistant varieties, resistance is easily lost after 3-5 years. The safe, efficient and durable rice blast prevention and control technology is urgently needed.

As a non-chemical synthetic pesticide using natural products or protein as active ingredients, compared with chemical pesticides, biological pesticides have the characteristics of strong selectivity, no harm to human and livestock, easy degradation, low toxicity or no toxicity, difficult generation of immunity and the like, and become an important way for solving the negative problems of chemical pesticides and a new direction for the development of pesticide industries. Under the new trend of green agriculture development, the function of plant antibacterial protein in green disease prevention and control is gradually highlighted. The antibacterial effect of the exogenous antibacterial protein coding gene of cotton, cucumber, ginkgo and the like transferred into rice is reported, and the gene shows broad-spectrum resistance to various pathogenic bacteria in vitro. However, endogenous antimicrobial proteins derived from rice are reported to be rare and have great potential development and utilization values. The plant antibacterial protein is expected to become a novel 'antibiotic' for protecting plants from being harmed by pathogenic bacteria due to the unique sterilization mechanism of the plant antibacterial protein. In order to research the bactericidal effect of the rice antibacterial protein AntiB-1 on rice blast germs, the invention clones the coding sequence of the antibacterial protein AntiB-1 gene to a prokaryotic expression vector, purifies the AntiB-1 protein and verifies the bacteriostatic effect on the rice blast germs in vitro.

Disclosure of Invention

The invention aims to provide the application of the rice antimicrobial protein AntiB-1 aiming at the defects in the prior art.

The purpose of the invention can be realized by the following technical scheme:

application of rice AntiB-1 protein in preparing a medicament for preventing and treating rice blast. The coding sequence of the protein is numbered XM _015779840.2 in Genbank.

The application of the coding gene of the rice AntiB-1 protein in preparing a medicament for preventing and treating rice blast.

Has the advantages that:

the invention provides application of rice AntiB-1 protein in preparation of a medicament for preventing and treating rice blast. The invention utilizes the antibacterial protein derived from the rice, and has the advantages of safety, greenness, high efficiency and the like for preventing and treating rice blast germs.

Drawings

FIG. 1 results of enzyme digestion identification of AntiB-1 gene

Marke:100,250,500,750,1000,1500,2000,3000,5000

The gene name: (OD260/OD280:1.81)

Enzyme digestion identification: nde I/Xba I

M is Marker; line1, plasmid before enzyme digestion; line2 plasmid after enzyme digestion

FIG. 2 pCzn1 plasmid spectrogram

FIG. 3 SDS-PAGE results of protein-induced expression

M is Protein Marker, lane 1: uninduced, lane 2: induced, lane 3:0.5mM IPTG 37 degree induced supernatant; lane 4 precipitation induced by 0.5mM IPTG 37 degrees

FIG. 4 SDS-PAGE results of purification of AntiB-1-His fusion protein

M Protein Marker, lane 1 unpurified, lane 2 flow through, lane 3 elute

FIG. 5 inhibition of Magnaporthe grisea growth in vitro

Detailed Description

The methods used in the following examples are conventional methods unless otherwise specified.

Example 1

Gene cloning and vector construction

Obtaining a gene coding region sequence according to the NCBI accession number XM-015779840.2 of the rice AntiB-1 protein coding gene, and designing a full-length amplification primer Ant of the gene coding region by utilizing primer design software Oligo 6iB-1-F：CATATGATGGCGCGGTGCACTTTGCTCGTT (SEQ ID NO:1) and AntiB-1-R:TCTAGACTACTCACGCAGCACCACC (SEQ ID NO:2), and the upstream and downstream primers have restriction sites Nde I and Xba I, respectively (underlined). The sequence of the coding region of the gene was amplified from the japonica rice variety threo nay 118 using PrimeSTAR HS DNA Polymerase (TaKaRa, Dalian), gel-electrophoresed and excised to recover the target fragment (Omega, USA). Performing double enzyme digestion on the PCR recovery product, wherein the operation method comprises the following steps: 10 μ l of PCR product, 1.0 μ l Nde I, 1.0 μ l Xba I, 1.0 μ l buffer, ddH ₂ O make up 30. mu.l. After 3 hours at 37 ℃, the band of interest was recovered using a gel recovery kit (Omega, USA). The recovered DNA was ligated with the expression vector pCzn1 using T4 ligase. The obtained recombinant plasmid pCzn1-AntiB-1 was transformed into an Arctic express expression strain. The operation method comprises the following steps: add plasmid 1. mu.l into competent bacterium of 100. mu.l, put on ice for 20 min; thermally shocking at 42 deg.C for 90sec, and rapidly placing in ice for 5 min; adding 600 mul LB culture liquid; after centrifugation, the whole was spread on LB plates containing 50. mu.g/ml Amp after shaking at 220rpm for 1 hour at 37 ℃ and cultured overnight in an inverted state at 37 ℃.

Example 2

2.1 IPTG Induction of expression of pCZN1-AntiB-1 vector fusion protein

2.1.1 picking up a single clone on the transformation plate and inoculating it into a tube of 3ml LB medium containing 50. mu.g/ml AMP, shaking it overnight at 37 ℃ and 220 rpm;

2.1.2 days as follows: 100 was inoculated into 30ml LB medium containing 50. mu.g/ml AMP, and shaken at 37 ℃ and 220rpm until the OD600 of the cells became 0.6-0.8 (about 2 hours);

2.1.3 taking out 1ml of culture, centrifuging at 10000g for 2min at room temperature, discarding the supernatant, and resuspending the bacterial pellet with 100. mu.l of 1 Xloading buffer;

21.4 adding IPTG to the remaining culture to a final concentration of 0.5mM, shaking at 37 ℃ and 220rpm for 4h, inducing expression of LWQ-His fusion protein;

2.1.5 remove 1ml of culture, 12000g room temperature centrifugation for 2min, abandon the supernatant, 100 u l 1 x loading buffer heavy suspension of bacterial precipitation.

2.1.6 analysis was performed by 12% SDS-PAGE.

2.2 renaturation of Inclusion body proteins

2.2.1 centrifuging culture solution after induction expression at low temperature for 6000g for 10min, resuspending thallus precipitate and 20ml lysine buffer (20mM Tris-HCl containment 1mM PMSF and bacterial protease inhibitor cocktail, pH8.0), and ultrasonically crushing (power 400W, working for 4sec, intermittent 8sec, total 20 min);

2.2.2 centrifuging the ultrasonically-broken cell lysate at 4 ℃ and 10000g for 20min, and collecting the precipitate;

2.2.3 washing of the inclusion bodies 3 times with an inclusion body wash (20mM Tris, 1mM EDTA, 2M urea, 1M NaCl, 1% Triton X-100, pH 8.0);

2.2.4 dissolving the inclusion body by using a dissolving buffer solution (20mM Tris, 5mM DTT, 8M urea pH8.0) according to a certain proportion, and standing at 4 ℃ for overnight; centrifuging at room temperature at 15000rpm for 15 min;

2.2.5 the solution was added dropwise to 20mM Tris-HCl 5mM EDTA Buffer pH7.8 Buffer, gradually diluted in stepwise gradients with slow stirring, and the protein solution was dialyzed overnight in PBS pH7.4 solution in dialysis bags.

2.3 Ni column affinity purification of fusion proteins

2.3.1 Using a low pressure chromatography system, the inclusion body solution was loaded onto a Ni-IDA Binding-Buffer pre-equilibrated Ni-IDA-Sepharose CL-6B affinity chromatography column at a flow rate of 0.5 ml/min;

2.3.2 flushing with Ni-IDA Binding-Buffer at a flow rate of 0.5ml/min until the effluent OD280 value reaches the baseline;

2.3.3 Washing with Ni-IDA Washing-Buffer (20mM Tris-HCl, 20mM imidazole, 0.15M NaCl, pH8.0) at a flow rate of 1ml/min until the effluent OD280 reached baseline;

2.3.4 eluting the target protein with Ni-IDA Elution-Buffer (20mM Tris-HCl, 250mM imidazole, 0.15M NaCl, pH8.0) at a flow rate of 1ml/min, and collecting the effluent;

2.3.5 adding the collected protein solution into a dialysis bag, and dialyzing overnight with PBS (pH 7.4);

2.3.6 were analyzed by 12% SDS-PAGE.

2.4 protein expression purification analysis

Protein expression was induced by IPTG, and the target protein was mainly present in the precipitate as analyzed by 12% SDS-PAGE. The inclusion body re-dissolves target protein in a renaturation mode, obtains the target protein through Ni column affinity purification, and performs 12% SDS-PAGE analysis.

Example 3 bacteriostatic test method

5mL of PDA medium (bacteriostatic protein concentration 20mmol/L PBS (pH7.2), control (20mmol/L PBS; containing 1mol/L NaCl 20mmol/L PBS) added into the small hole) was poured into the bottom layer of a 150mm culture tube. After complete solidification, the central position of the culture medium is inoculated with rice blast germs, dark culture is carried out at 26 ℃, and the growth condition of the rice blast germs is observed after 24 hours, 48 hours, 72 hours and 120 hours after inoculation. The results showed that the AntiB-1 protein was able to significantly inhibit the growth of Pyricularia oryzae (FIG. 5).

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> rice antimicrobial protein AntiB-1 and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

catatgatgg cgcggtgcac tttgctcgtt 30

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tctagactac tcacgcagca ccacc 25

Claims

1. Application of rice AntiB-1 protein in preparing a medicament for preventing and treating rice blast. The coding sequence of the protein has accession number XM _015779840.2 in Genbank.

2. The application of the coding gene of the rice AntiB-1 protein in preparing a medicament for preventing and treating rice blast.