CN114946764A

CN114946764A - Construction method of transgenic animal permanently labeled with neural crest source cells

Info

Publication number: CN114946764A
Application number: CN202210504730.XA
Authority: CN
Inventors: 楼建林; 冯玲芳; 李泳欣; 龚晓雪; 董小雯; 姚佳慧
Original assignee: Hangzhou Medical College
Current assignee: Hangzhou Medical College
Priority date: 2022-05-10
Filing date: 2022-05-10
Publication date: 2022-08-30

Abstract

The invention discloses a construction method of a transgenic animal permanently marking neural crest source cells. The invention establishes an optimal mouse propagation method for permanently marking green fluorescent protein in cells from neural crest, and can obtain a large number of F1 generation gene editing mice with a wild mother mouse broad group by only purchasing a small number (4) of transgenic mice, thereby avoiding the defects of high purchase cost and low propagation speed caused by the introduction of 1: 1 of the traditional transgenic mice male and female. On the basis, a silicosis model is established, and a standard research means is provided for researching the effect of neural crest source cells in the silicon dioxide induced pulmonary fibrosis.

Description

Construction method of transgenic animal permanently labeled with neural crest source cells

Technical Field

The invention relates to the technical field of animal models, in particular to a method for constructing a transgenic animal with neural crest source cells permanently labeled.

Background

Pulmonary fibrosis is a disease characterized by progressive scarring of the lung, which destroys normal lung tissue architecture, ultimately leading to respiratory failure and death. Idiopathic Pulmonary Fibrosis (IPF) is one of the serious, with a median survival after diagnosis of only 2.5-3.5 years. Therefore, there is a need to fully understand the cellular and molecular mechanisms of pulmonary fibrosis in order to develop new and effective treatments to reduce mortality.

The abnormal increase of fibroblasts/myofibroblasts and the excessive extracellular matrix production by these cells are one of the key pathological changes of pulmonary fibrosis. The origin of these abnormal lung/myofibroblasts is highly heterogeneous. Different mechanisms may exist to promote the growth and accumulation of these cells. Normally, neural crest-derived cells constitute the nerve fibers in the vicinity of airway smooth muscle (Freem LJ, Escot S, Tannahill D, Druckenbrod NR, Thapar N, Burns AJ. the intracinic initialization of the lung is derived from neural cells as a lower by optical projection tomograph in Wnt 1-Cre; YFP reporter microorganism. J Ant.2010 Dec; 217(6): 651-64.).

Previous studies have shown that a novel mesenchymal stem cell population originating in the neural crest may be present in fibrotic lungs. Therefore, in order to investigate whether neural crest derived cells play a role in pulmonary fibrosis, there is a need for a mouse model of pulmonary fibrosis labeled with neural crest derived cells, in which neural crest cells and their progeny cells need to be permanently labeled and can be detected by standardized methods for localization in the fibrotic lung. The method is not reported at present.

Wnt1-Cre mice have been reported in the literature to be useful for lineage tracing neural crest cells and their derived cells, and Wnt 1-Cre-labeled cells have all phenotypes of neural crest stem cell-like ([1 ]]Wiszniak S,Schwarz Q.Notch signalling defines dorsal root ganglia neuroglial fate choice during early neural crest cell migration.BMC Neurosci.2019Apr 29；20(1):21.[2]Experimental study of distribution of Liu Xiangyang, Wang Leng, Song Weiya, et al Wnt1-Cre labeled cardiac neural crest-derived cells in atrioventricular valves [ J]A chinese clinician journal: electronic plate 2012,6(22):6 [3]Acuna-Mendoza S,Martin S,Kuchler-Bopp S,Ribes S,Thalgott J,Chaussain C,Creuzet S,Lesot H,Lebrin F,Poliard A.A New Wnt1-CRE Tomato ^Rosa Embryonic Stem Cell Line A Tool for student New Cell Integration Capacity Stem Cells Dev.2017Dec 1; 26(23):1682-1694.). However, a mouse silicosis model using Wnt1-Cre mice to permanently label neural crest-derived cells has not yet been established.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a construction method of a transgenic animal for permanently marking cells derived from neural crest.

A method for constructing a transgenic animal permanently labeled with neural crest-derived cells, comprising the steps of:

(1) the heterozygous Wnt1-Cre male transgenic animal and the homozygous mTomoto-mGFP male transgenic animal are respectively hybridized with the corresponding wild transgenic animal to obtain the F1 generation heterozygous Wnt1-Cre transgenic animal and the F1 generation heterozygous mTomoto-mGFP transgenic animal,

(2) hybridizing the F1 generation hybrid Wnt1-Cre transgenic animal and the F1 generation hybrid mTomat-mGFP transgenic animal to obtain an F2 generation transgenic animal, screening to obtain the Wnt1-Cre and mTomat-mGFP double hybrid transgenic animal which is the transgenic animal permanently marked with the neural crest source cell,

wherein Wnt1-Cre indicates that the transgenic animal expresses Cre recombinase under the control of Wnt1 gene; mTomoto-mGFP indicates that the transgenic animal has two reporter genes, and one reporter gene is expressed in the cell after Cre-mediated recombination in step (2) and the other reporter gene is expressed in the non-recombinant cell.

Preferably, the transgenic animal is a transgenic mouse.

More preferably, the male heterozygote is Wnt1-Cre maleThe transgenic animal is 129S4.Cg-E2f1 ^{Tg(Wnt1-cre)2Sor} Male mice; the homozygous mTomoto-mGFP male transgenic animal is B6.129(Cg) -Gt (ROSA)26Sor ^tm4(ACTB ^{-tdTomato,-EGFP)Luo} A/J male mouse. Both transgenic mice were purchased from Jackson Laboratory (Jackson Laboratory, Bar Harbor, ME, USA).

The invention also provides a method for establishing an animal model of pulmonary fibrosis, the transgenic animal established by the method is injected into SiO through a tracheal cannula ₂ Suspending, and carrying out primary modeling to obtain the animal model of the pulmonary fibrosis.

Preferably, the transgenic animal is a transgenic mouse injected with SiO ₂ The volume of the suspension was 0.1ml, SiO ₂ The concentration of the suspension was 25 mg/ml.

More preferably, the transgenic animal is injected with SiO through a tracheal cannula ₂ After suspension, feeding was continued for at least 30 days.

More preferably, the transgenic animal is injected into SiO through the trachea cannula ₂ Before suspension, the transgenic mouse is anesthetized, then the narcotized transgenic mouse is hung on the line, the trachea of the transgenic mouse is easily exposed under the action of gravity, and the upper jaw and the tongue root of the transgenic mouse are separated by using tweezers under the illumination to expose the trachea.

The invention also provides application of the animal model constructed by the animal model establishing method in detection of tracing neural crest source cells. During detection, a tissue to be detected is taken, the tissue is firstly fixed by paraformaldehyde with the mass concentration of 4%, the tissue structure is reserved, then a sucrose solution with the mass concentration of 30% is put into the tissue, after the tissue sinks, OCT is used for embedding and liquid nitrogen is used for quick freezing, and a frozen section is manufactured.

The invention has the beneficial effects that:

1. the invention establishes an optimal mouse propagation method for permanently marking green fluorescent protein in cells from neural crest, only a small amount (4) of transgenic male mice are needed to be purchased, and a large amount of F1 generation gene editing mice can be obtained with a wild-type female mouse swarm, thereby avoiding the defects of high purchase cost and slow propagation speed caused by the introduction of 1: 1 of the traditional transgenic mouse male and female mice. On the basis, a silicosis model is established, and a standard research means is provided for researching the effect of neural crest source cells in the silicon dioxide induced pulmonary fibrosis.

2. The silicosis model is easy to manufacture and the success rate of trachea intubation is high. The current commonly used mouse silicosis model establishment method mainly comprises instillation through the nasal cavity (more SiO) ₂ Particles are retained in the nasal cavity, the actual injection concentration cannot be controlled), and the dust-staining system atomizes and inhales SiO every day ₂ Dust (high cost and long molding time), dust pollution caused by an exposed trachea method (large operative wound and susceptibility to mouse death), and the like, but because of the problems of the dust and the dust, a noninvasive trachea cannula is still the preferred method. The device required by the invention is simple and easy to manufacture, the cost is extremely low, the suspension type placement does not need to bind the mouse, the process is simple, the trachea exposure effect is good, the injury to the oral cavity and the airway of the mouse is reduced to the maximum extent by the hose cannula of the indwelling needle, and the perfusion concentration and the volume are controllable.

3. Normalization of detection of neural crest derived cells: the mouse lung tissue generates a large amount of autofluorescence in a common paraffin section-immunofluorescence mode due to large blood flow volume, and the observation of GFP is completely covered; the conventional freezing of the slices can collapse the alveolar structure, so that the positioning of neural crest source cells in different structures of lung tissues cannot be accurately judged; according to the invention, the tissue is firstly fixed by paraformaldehyde with the mass concentration of 4%, the tissue structure is reserved, then the sucrose solution with the mass concentration of 30% is put in, after the tissue sinks, OCT is used for embedding and liquid nitrogen is used for quick freezing, and the frozen section is prepared, so that the defect of detecting the index by using the traditional paraffin and the frozen section is avoided.

Drawings

FIG. 1 is a schematic diagram of the principle of green fluorescence labeling of cells.

Fig. 2 is a homemade mouse trachea cannula console.

FIG. 3 is a self-made mouse trachea cannula needle.

Fig. 4 is a schematic diagram of a mouse tracheal tube.

FIG. 5 shows the results of gene identification in F2 mouse.

Fig. 6 is a general view of lung tissue.

Figure 7 shows the pathological changes in lung tissue (HE staining 100 ×) for each group of mice.

FIG. 8 shows lung tissue sections for GFP (green), Tomato (red) fluorescence and DAPI co-localization.

Detailed Description

Example 1

129S4.Cg-E2f1 only ^{Tg(Wnt1-cre)2Sor} Male Wnt1-Cre mice and 2B 6.129(Cg) -Gt (ROSA)26Sor ^{tm4(ACTB-tdTomato,-EGFP)Luo} Male/J mice (expressed as mTomat-mGFP mice) were purchased from Jackson Laboratory (Jackson Laboratory, Bar Harbor, ME, USA), 129S4/SvJaeJ mice (expressed as WT) were purchased from the Laboratory animal center of the institute of medical sciences, Zhejiang. All mice were housed in the center of laboratory animals of the institute of medical sciences, Zhejiang province. Wnt1-Cre male mice and WT female mice are hybridized in a ratio of 1: 2, and a large number of F1 generations of WT and Wnt1-Cre mice can be rapidly obtained through identification. Meanwhile, the mTomat-mGFP male mouse and the WT female mouse are hybridized 1: 2, and a large number of F1 WT and mTomat-mGFP mice are obtained. Hybridizing F1 generations of Wnt1-Cre and mTomat-mGFP fluorescence labeling mice to obtain F2 generations of Wnt1-Cre, mTomat-mGFP and Wnt 1-Cre; mTomato-mGFP mice. Each mother mouse can produce about 9-12 young mice per fetus, and the survival rate approaches 100%. The young mouse is cut to extract a small amount of DNA from toes or rat tails at 5-14 days of age for genotyping. The young and mother rats were housed 21 days later. Wnt1-Cre according to the Cre-loxP principle; cells expressing the whole body Wnt1 molecule in the mTomato-mGFP mice were permanently labeled with GFP, i.e. expressing green fluorescent protein, while all the remaining cells still expressed the Tomato protein (red fluorescence).

The method specifically comprises the following steps:

1. wnt1-Cre mouse

Wnt1-Cre transgenic mice express Cre recombinase under the control of Wnt1 gene. Wingless-related MMTV integration site 1 was injected into the hybrid mouse egg cells, and Cre recombinase was regulated by Wnt1 gene 1.3kb 5 'promoter and 5.5kb 3' promoter enhancer. Integration of the flanking region-1 MMTV integration site fragment into chromosome 2 resulted in the deletion of a 257bp fragment at exon 5 of the E2f1(E2F transcription factor 1) gene, and the appearance of a 45Kb inverted fragment containing all sequences of exon 5, but deleting a 23Kb fragment including exon 6 and exon 7. This deletion resulted in a functional knockout of homozygous mouse E2f 1. Cre recombinase activity is detected in both the cardiac and cranial neural crest, particularly in the gill arch and cardiac outflow tract. When Wnt1-Cre2 transgenic mice were crossed with mice containing loxP site flanking sequences, Cre-mediated recombination resulted in deletion of the filial cell floxed sequence produced by the midbrain, developing neural tube. The mice were then backcrossed four times with 129S4 mice to stabilize the population.

2. mTomato-mGFP mouse

To assess the range of tissues in which the Cre reporter gene functions, not only cells after Cre-mediated recombination, but also non-recombined cells were labeled. Thus, a two reporter mouse was generated that expressed one marker in non-recombinant cells and another marker in recombinant cells.

ROSA ^mT/mG Is a cell membrane targeted dual-color fluorescent Cre reporter allele. Prior to Cre recombination, cell membrane localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cells expressing Cre recombinase (and progeny cells from these cells) have membrane-localized egfp (mg) fluorescence expression, replacing red fluorescence. The mT/mG (membrane-red/membrane-green) targeting vector was designed with the chicken β -actin core promoter (pCA) with CMV enhancer, driving expression of a loxP site encoding the membrane-localized tdTomato protein sequence. The entire mT/mG construction vector was inserted into the Gt (ROSA)26Sor locus by electroporation. Correctly positioned ES cells were injected into C57BL/6J embryos to generate mutant mice. Mice were backcrossed with wild-type mice for at least five generations to generate this homologous strain.

Mice homozygous for this mT/mG mutation are viable and fertile. These mice had loxP sites on both sides of the membrane-targeted tdtomato (mt) cassette and expressed intense red fluorescence in all detectable tissues and cell types. Tail or systemic fluorescence was sufficient to distinguish mT/mG mice from wild type mice. When crossed with mice expressing Cre recombinase, the resulting progeny mice had the mT cassette deleted in the Cre-expressing tissue, allowing expression of the downstream membrane-targeted EGFP green fluorescent protein (mG) driven by the pCA promoter. The ACTB promoter allows for stronger and longer lasting fluorescent protein expression compared to the endogenous gt (rosa) site. As shown in FIG. 1, the arrows indicate the direction of transcription. Triangles represent loxP targets for Cre-mediated recombination. PA represents a polyadenylation sequence. The dual fluorescence system can directly display recombinant and non-recombinant cells in real time under single cell resolution, and provides a marker for lineage tracking application. In addition, the fluorescent protein-localized membrane structure can characterize cell morphology and allow for detailed observation of the cell's vital activities. Thus, mT/mG mice can serve as Cre reporter strains: red fluorescence is expressed in widely distributed cell and tissue types and green fluorescence is present in Cre recombinase-expressing cells.

3. Mouse DNA extraction

(1) The mice were cut to number their toes and either the mouse toes or the tail of the mouse 0.5cm or so were placed in a 1.5ml sterile EP tube and stored at-20 ℃.

(2) 200. mu.l non-SDS buffer + 5. mu.l proteinase K were added to each organized tube and digested by overnight incubation in a 55 ℃ water bath.

(3) The next day, the centrifuge tube in the water bath was vortexed for 5 seconds at 13000rpm for 5 minutes

(4) Heating in a water bath box at 98 ℃ for 10 minutes to inactivate the proteinase K.

(5)13000rpm, centrifuge for 1 min, and take 100. mu.l of supernatant and store at-20 ℃.

4. F1 and F2 mouse gene typing primers

Wnt1-Cre mouse identifying primer design 5'→ 3':

Transgene Forward 16773：CAGCGCCGCAACTATAAGAG；

Transgene Reverse16774：CATCGACCGGTAATGCAG；

Internal Positive Control8744：CAAATGTTGCTTGTCTGGTG；

Internal Positive Control8745：GTCAGTCGAGTGCACAGTTT。

mTomato-mGFP mouse identification primer design 5'→ 3':

Common12177：CTTTAAGCCTGCCCAGAAGA；

Mutant Forward：TAGAGCTTGCGGAACCCTTC；

Wild type Forward：AGGGAGCTGCAGTGGAGTAG。

5. PCR reaction

The volume of the PCR reaction system was 25. mu.l. The PCR reaction system 1 is shown in Table 1.

TABLE 1

The PCR reaction system 2 is shown in Table 2.

TABLE 2

The PCR reaction conditions were as follows:

(1) pre-denaturation at 95 ℃ for 5 min;

(2) denaturation at 95 ℃ for 30s, annealing at 60 ℃ (suitable for Wnt1-Cre mouse identification) for 30 s/annealing at 65 ℃ (suitable for mTomato-mGFP mouse identification) for 30s, extension at 72 ℃ for 30s, and repeating for 35 cycles;

(3) final extension at 72 ℃ for 10 min.

Taking the PCR amplification product and a DNA Marker to carry out 1.5 percent agarose gel electrophoresis, and specifically comprising the following steps: 1.5g agarose powder was weighed into a conical flask, 100 ml 1 XTAE electrophoresis buffer was poured and shaken up, and the mouth of the conical flask was covered with a layer of PE gloves to prevent excessive evaporation of water vapor upon heating. Heating in a microwave oven until the powder is completely melted, taking out and shaking up. And (3) cooling the mixture in a fume hood to about 50 ℃, adding Gelred dye, shaking and uniformly mixing, and slightly pouring the solution onto a rubber plate. After complete coagulation, the comb is pulled out, fresh 1 Xelectrophoresis buffer solution is added into the electrophoresis tank, PCR amplification products and DNA Marker are quantitatively added into gel holes by 15 mu l per hole, and electrophoresis is carried out for 50min at the fixed time of 100V. After the completion of the reaction, when the bromophenol blue is moved to a position 1-2cm away from the edge of the gel, the gel is taken out, the size of the DNA band is observed under an ultraviolet lamp, and the photographic record is carried out.

And (3) judging a PCR result: when F1 generation mouse genes of Wnt1-Cre mice and WT mice are hybridized are identified, wild mice are generated with 200bp single bands of PCR products, and Wnt1-Cre mice are generated with 475bp and 200bp bands respectively. When identifying the F1 generation baby mouse of mTomat-mGFP mouse and WT cross, the PCR product is a GFP gene homozygote mouse with 128bp band, the product is mTomat-mGFP heterozygote mouse with 128bp and 212bp bands, and the product is wild mouse with 212bp band. When F2 mouse gene typing is carried out, the two methods for identifying F1 mouse are respectively used for carrying out two times of independent PCR reaction and agarose gel electrophoresis, and Wnt 1-Cre; four bands of 200bp, 475bp, 128bp and 212bp appear in mTomoto-mGFP mice, while two bands of 200bp and 212bp appear in wild-type mice. Wnt1-Cre mice showed three bands of 200bp, 475bp and 212bp in size, and mTomato-mGFP mouse PCR products were three bands of 200bp and 128bp, 212bp in size.

As shown in FIG. 5, the upper and lower panels are the results of testing multiple mice by Wnt1-Cre genotype identification (PCR reaction system 1) and mTomoto-mGFP genotype identification (PCR reaction system 2), respectively, the upper and lower lanes correspond to the same mouse, and the rightmost lane is DNA Ladder (100, 200, 300, 400, 500bp, etc. from bottom to top). As a result, the mice in the 4 th lane from the left are Wnt 1-Cre; mTomato-mGFP mice.

Example 2

Establishing a silicosis model of a mouse.

1. Preparation of silica suspensions

Taking a proper amount of SiO 1 day before molding ₂ The dust was placed in a clean petri dish, heated at 160 ℃ for 2h, cooled slightly and then ground in an agate mortar for 30 min. Then sterile normal saline is used for preparing 25mg/ml suspension for standby.

2. Mouse grouping and silicosis model building

8-12 weeks Wnt 1-Cre; mTomato-mGFP mice were randomly divided into a blank group, a normal saline group, and a silicosis group. All mice were fasted and water-deprived for 12h before the experiment, weighed on the day of the experiment treatment, and used for mass concentration4% chloral hydrate solution is intraperitoneally injected according to the dose of 0.01ml/g (body weight), 3-4min later, after the mouse positive reflex and the toe clip reflex disappear, the blank group of mice do not have any intervention, and the other two groups are subjected to trachea intubation. During operation, two persons are matched, one person shakes and uniformly mixes the silicon dioxide suspension before each mouse is inserted into a tube, and a clean syringe is used for sucking 0.1ml of suspension to remove bubbles. And each mouse was cannulated with a new syringe, indwelling needle, sterile forceps, etc. The triangular shaped station shown in figure 2 is made of cardboard. The other person puts the abdomen of the mouse downwards, the upper incisor is hung on a thin line on a self-made operating platform, a strong light source irradiates the position of the neck of the mouse, the mouse tongue is pulled out by using a pair of tweezers, one end of the left straight tweezers is propped against the upper jaw of the mouse, the other end of the left straight tweezers presses the root of the mouse tongue, the trachea of the mouse is exposed as much as possible, the position of the trachea is observed under the assistance of the light source, when the trachea is seen to be in the light-permeable state under the light source irradiation, the regular one-lighting one-dark one small round hole can be observed carefully, the size of the round hole is increased when the round hole is lightened, the round hole is reduced into a small point when the round hole is darkened, and the position is the glottic position. When the small round hole is enlarged (namely when the glottis is maximally opened), the 22G indwelling needle is quickly inserted into the trachea, the needle core is drawn out, and the 1ml syringe is inserted into the 22G indwelling needle cap and screwed tightly by rotation, thus completing the tracheal intubation (figures 3 and 4). In figure 3, the self-made mouse trachea cannula needle is shown, wherein two side wings at two sides of a butterfly-shaped indwelling needle are cut off and connected to a common syringe after a needle head is removed. The silicosis mice were infused with 0.1ml of the silica suspension via the trachea as described above and the saline group mice were infused with the same volume of sterile saline. Gently grasp the mouse hind neck, stand upright and gently shake side to side for 5 minutes to help the SiO ₂ The suspension liquid is uniformly distributed to enter the left lung and the right lung, and the mouse trachea is prevented from being blocked and suffocated due to dust. The anesthetized mice are placed on a heat preservation blanket and returned to the original cage after the mice are completely revived.

3. Sample collection

On days 7, 14 and 30 after treatment of the mice, 6 mice per group were weighed and then killed by dislocation of cervical vertebrae, the chest was opened, lung tissues were taken, and the mice lungs were roughly observed and photographed. The lung tissues of the white group and the physiological saline group in 7 days, 14 days and 30 days after the molding are pink, uniform in color, soft and elastic. However, the silicosis group showed significant inflammatory reaction, obvious edema and bleeding spots on the surface of the lung lobes, and macroscopic silicon nodules. The tissue was washed 2-3 times with PBS, the whole left lung was fixed with 4% by mass of paraformaldehyde, and the upper right lung was fixed in 10% neutral formalin solution and then HE-stained. The remaining lung lobes were individually placed in 1.5ml sterile EP tubes and stored at-80 ℃ for future use.

Example 3

Method for studying GFP permanently-labeled neural crest-derived cells in silicosis of mice.

1. Morphological examination of mouse Lung tissue (HE staining)

The upper lobe tissue of the right lung is taken and added into 10 percent neutral formalin solution with more than 10 times of volume for fixation for 24 hours, gradient dehydration is carried out (the tissue is respectively put into 70 percent alcohol for 1 hour, 80 percent alcohol for 1 hour, 95 percent alcohol for II 2 hours, 95 percent alcohol for III 2 hours, pure alcohol for I1 hour and pure alcohol for II 2 hours), then the tissue is transparentized by dimethylbenzene (the tissue is respectively put into dimethylbenzene for 10 minutes and dimethylbenzene for II 20 minutes), then the tissue is soaked in wax (soft wax for I60 ℃ for 1 hour, soft wax for II for 60 ℃ for 1 hour and hard wax for 60 ℃ for 2 hours), hard wax is used for embedding, and the tissue is sliced on a MICROM (HM325 type) rotary paraffin slicer, the slice thickness is 4 mu m, and finally the slice is baked for 4 hours at 60 ℃.

Gross observation of the lung of mice (FIG. 6) revealed that the lung tissue of silicosis mice had abnormal morphology, including silicon nodules of varying sizes, and the surface of the saline group was smooth and the morphology was normal. The lung pathology results are shown in figure 7. Under 100 times of the silicosis group, a plurality of cellular nodules with different sizes can be seen, the shapes are circular, round-like or irregular, a small amount of inflammatory cell infiltration (mainly including lymph and mononuclear cells) is arranged beside the blood vessel, and no obvious pathological change is seen in the normal saline group. Pathological sections of mouse lung tissues and gross observation indicate that the silicosis model is successfully established.

2. Immunofluorescence detection of cells derived from neural crest of lung tissue

After mice with GFP permanently labeled neural crest derived cells were obtained, it was determined how to detect the cells in silica-induced silicosis tissue. During sampling, the whole left lung which is freshly taken down is fixed for 12 hours by using paraformaldehyde with the mass concentration of 4 percent, then a sucrose solution with the mass concentration of 30 percent is put into the left lung, after tissues sink, OCT is used for embedding and liquid nitrogen is used for quick freezing, a freezing microtome is used for cutting into 6 mu m slices, and the slices are placed in a refrigerator at the temperature of minus 20 ℃ and used within one month. For immunofluorescence assay, sections were removed from-20 ℃ and placed at room temperature for 30 minutes, followed by removal of OCT in PBS for 15 minutes. The tissue was circled using a histochemical pen and permeabilized with 0.5% TritonX-100 (PBS) for 20min at room temperature and slightly dried. 50 μ l of DAPI were added dropwise and incubated for 2 min in the dark. Wash four times with PBS, 5 min/time, spin dry slightly, carefully enclose PBS outside. And (3) dripping the anti-fluorescence quenching mounting solution on the tissue slice, covering a cover glass, and enabling the slice to contact the mounting solution to avoid any bubbles. As a result, as shown in FIG. 8, it was observed that very few green fluorescent cells were expressed in lung tissue of mice in the saline group, regardless of the time of 7 days, 14 days and 30 days. Lung tissues of silicosis mice have obvious green fluorescence labeled cells after 7 days, 14 days and 30 days of molding, and are positioned on cell membranes.

Sequence listing

<110> Hangzhou college of medicine

<120> method for constructing transgenic animal permanently labeling neural crest derived cells

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cagcgccgca actataagag 20

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

catcgaccgg taatgcag 18

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caaatgttgc ttgtctggtg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtcagtcgag tgcacagttt 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctttaagcct gcccagaaga 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tagagcttgc ggaacccttc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agggagctgc agtggagtag 20

Claims

1. A method for constructing a transgenic animal permanently labeled with cells derived from neural crest, comprising the steps of:

2. The method for constructing a transgenic animal capable of permanently labeling neural crest-derived cells according to claim 1, wherein the transgenic animal is a transgenic mouse.

3. The method for constructing a transgenic animal permanently labeling neural crest-derived cells according to claim 2, wherein the male transgenic animal heterozygous Wnt1-Cre is 129S4.Cg-E2f1 ^{Tg(Wnt1-cre)2Sor} a/J male mouse; the homozygous mTomoto-mGFP male transgenic animal is B6.129(Cg) -Gt (ROSA)26Sor ^{tm4(ACTB-tdTomato,-EGFP)Luo} A/J male mouse.

4. A method for establishing an animal model of pulmonary fibrosis, which is characterized in that a transgenic animal constructed by the transgenic animal construction method of any one of claims 1 to 3 is injected into SiO through a tracheal cannula ₂ Suspending, and carrying out primary modeling to obtain the animal model of the pulmonary fibrosis.

5. The method for establishing an animal model of pulmonary fibrosis according to claim 4, wherein the transgenic animal is a transgenic mouse, and SiO is injected ₂ The volume of the suspension was 0.1ml, SiO ₂ The concentration of the suspension was 25 mg/ml.

6. The method for establishing animal model of pulmonary fibrosis according to claim 5, wherein the transgenic animal is injected with SiO through trachea cannula ₂ After suspension, continuing to raise for at least 30 days。

7. The method for establishing the animal model of pulmonary fibrosis according to claim 5, wherein the transgenic animal is injected with SiO through a tracheal cannula ₂ Before suspension, the transgenic mouse is anesthetized, then the narcotized transgenic mouse is hung on the line, the trachea of the transgenic mouse is easily exposed under the action of gravity, and the upper jaw and the tongue root of the transgenic mouse are separated by using tweezers under the illumination to expose the trachea.

8. Use of an animal model constructed by the animal model construction method according to any one of claims 4 to 7 in the detection of cells from neural crest sources.

9. The application of claim 8, wherein during detection, the tissue to be detected is taken, the tissue is fixed by paraformaldehyde with the mass concentration of 4%, the tissue structure is kept, then sucrose solution with the mass concentration of 30% is placed, after the tissue sinks, OCT is used for embedding, and liquid nitrogen is used for quick freezing to prepare the frozen section.