CN114940993B - Riboswitch based on cell-free transcription translation system and application thereof - Google Patents

Riboswitch based on cell-free transcription translation system and application thereof Download PDF

Info

Publication number
CN114940993B
CN114940993B CN202210647219.5A CN202210647219A CN114940993B CN 114940993 B CN114940993 B CN 114940993B CN 202210647219 A CN202210647219 A CN 202210647219A CN 114940993 B CN114940993 B CN 114940993B
Authority
CN
China
Prior art keywords
riboswitch
sequence
rna
vulnificus
sensor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210647219.5A
Other languages
Chinese (zh)
Other versions
CN114940993A (en
Inventor
郭绍彬
金天宇
石贤爱
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fuzhou University
Original Assignee
Fuzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fuzhou University filed Critical Fuzhou University
Priority to CN202210647219.5A priority Critical patent/CN114940993B/en
Publication of CN114940993A publication Critical patent/CN114940993A/en
Application granted granted Critical
Publication of CN114940993B publication Critical patent/CN114940993B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/63—Vibrio
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention specifically discloses a riboswitch based on a cell-free transcription translation system and application thereof in V.vulnificus detection, which realizes V.vulnificus field detection without expensive instruments and equipment, and the detection result is visible to naked eyes; in the invention, the isothermal amplification technology RPA is coupled with a riboswitch, and the sensitivity for detecting the conserved sequence of V.vulnificus is 4.30X10 3 cobies/. Mu.L; the activity of the TX-TL riboswitch detection system after freeze drying is reduced, but the detection of the V.vulnificus conserved sequence can be still realized. The invention also proves that the detection method has good stability and strong specificity and is suitable for detecting the V.vulnificus pathogenic microorganisms through a repeatability test and a specificity test of a TX-TL riboswitch detection system.

Description

Riboswitch based on cell-free transcription translation system and application thereof
Technical Field
The invention belongs to the technical field of pathogenic microorganism detection and molecular diagnosis, and particularly relates to a riboswitch based on a cell-free transcription translation system and application thereof.
Background
Vulnificus is one of the most common vibrio bacteria in the ocean, widely distributed in the sea water in offshore areas, the body surface of marine organisms and the intestinal tract, and there are generally two ways for humans to infect this bacteria: seafood is used in combination with sea water or seafood. Vulnificus is a dangerous human pathogen, with the highest mortality rate among all food-borne pathogens. The v.vulnificus infection is characterized by a short incubation period, symptoms usually occur within 24 hours of infection, and infective shock, skin muscle necrosis, sepsis occur within 48 hours, thereby causing multiple organ failure, with an overall mortality rate of wound infection of about 25%, but rising to 54% in patients with underlying liver disease. Since such bacteria can cause serious infection, timely antibacterial treatment is indispensable. Thus, accurate and rapid identification of such bacteria is critical in a clinical setting.
Most clinical microbiology laboratories still rely on culture to detect v.vulnificus in clinical samples. For example, after separating specific target pathogens by using a selective medium and separating bacteria, v.vulnificus is identified by MALDI-TOF MS, and the detection has the characteristics of high sensitivity, high accuracy, high resolution and the like. However, the method for detecting v.vulnificus in clinical samples by culture still has some limitations, the detection time is usually 16-48 hours, and some pathogenic microorganisms which are difficult to separate and culture cannot be detected, so that the method is mainly used for identification on a culture basis at present. In recent years, the use of PCR detection means has been rapidly developed to enable identification at the species level, and various PCR-based DNA amplification techniques such as fluorescent quantitative RCR, reverse transcription PCR, digital PCR and the like have become powerful analytical tools in the medical clinical and inspection departments,
in the practical application scene, the pathogenic microorganism content in the sample to be detected is low, and a large number of target gene fragments are required to be obtained through nucleic acid amplification, so that the rapid identification of V.vulnificus by a PCR detection means becomes a method with great development potential. However, the existing various PCR technologies need a thermal cycling process and cannot get rid of the dependence on instruments and equipment, so that the application of the PCR technology in clinical field detection of V.vulnificus is limited.
Disclosure of Invention
In order to solve the technical problems, the invention provides a riboswitch based on a cell-free transcription and translation system and a preparation method thereof, and the prepared riboswitch based on the cell-free transcription and translation system is used for detecting V.vulnificus in situ.
The technical scheme of the invention is as follows:
the invention aims to provide a riboswitch based on a cell-free transcription translation system, wherein the riboswitch is an RNA sequence with a footed structure designed according to a bacterial conserved sequence RNA, and can perform base complementary pairing with a V.vulnificus conserved sequence RNA to activate the expression of a reporter protein; the riboswitch consists of two RNA chains, namely Sensor RNA and Trigger RNA, wherein the Sensor RNA is the riboswitch, and the Trigger RNA is used for activating the riboswitch; the Sensor RNA sequence is transcribed from the Sensor DNA sequence in vitro, and the Trigger RNA sequence is transcribed from the Trigger DNA sequence in vitro.
Further, the Trigger DNA sequence is increased from V.vulnificus intermediate Wen Kuo by an upstream primer and a downstream primer with pT7 promoter, the sequence of the upstream primer is shown as SEQ ID NO. 1, the sequence of the upstream primer is shown as SEQ ID NO. 2, and the sequence of the Trigger DNA is shown as SEQ ID NO. 3.
Furthermore, the sequence of the Sensor DNA is programmable, and is designed according to the selected V.vulnificus conserved sequence Trigger DNA, and the sequence of the Sensor DNA is shown as SEQ ID NO. 4.
It is a second object of the present invention to provide the use of riboswitches based on a cell-free transcriptional translation system as described above for clinical detection of v.
Further, the use of riboswitches based on a cell-free transcriptional translation system in clinical assays for v.vulnificus, comprising the steps of:
amplifying a V.vulnificus conserved sequence by using an RPA isothermal amplification method, and under the action of T7 RNA polymerase, the amplification product starts a transcription process by using a T7 promoter in a cell-free transcription translation system so as to obtain a large amount of Trigger RNA;
in a cell-free transcription and translation system, a riboswitch SensorRNA is transcribed from the Sensor DNA to identify Trigger RNA and activate the expression of a reporter protein;
and determining the target bacteria as the detected V.vulnificus according to the color reaction of the expressed reporter protein and the substrate.
Compared with the prior art, the invention has the beneficial effects that:
1. the recognition of the RNA of the conserved sequence of the Sensor RNA and the V.vulnificus in the riboswitch provided by the invention depends on the strand displacement interaction of RNA-RNA, and the repression of the RNA aptamer foothold structure on the translation process is relieved by the principle of base complementation pairing, so that the expression of the reporter protein is promoted; according to experimental data, the riboswitch designed by the invention has the characteristics of high dynamic range, high specificity and the like, and meanwhile, the riboswitch has high universality to respond to any RNA sequence through programmable design.
2. The cell-free transcription and translation system (TX-TL) in the invention utilizes a cell crude extract to replace an intact cell to start a transcription and translation process, can bypass the limit of the transportation of molecules across cell walls, starts the synthesis of mRNA and protein in vitro in a short time by adding genetic materials and exogenous energy into an extracting solution, combines the TX-TL system with a riboswitch designed by the invention, is applied to the detection of pathogenic microorganisms, and can improve the convenience and timeliness of the detection. Experimental data shows that the detection of the v.vulnificus conserved sequence can be achieved within 3h without depending on equipment.
3. In the practical application scene, the pathogenic microorganism content in the sample to be detected is low, a large number of target gene fragments are required to be obtained through nucleic acid amplification, the RPA isothermal amplification technology is utilized for amplification in the practical application, the amplification time is shortened, the stability is high, and the exponential amplification of the target gene fragments at normal temperature can be realized; the invention couples the RPA isothermal amplification technology with the riboswitch, combines the TX-TL system to detect the conserved sequence of V.vulnificus, and realizes the detection sensitivity of 4.30 multiplied by 10 3 copies/μL。
Drawings
FIG. 1 is a schematic diagram showing the reaction results of a Sensor plasmid and a Trigger plasmid of V.vulnificus in a TX-TL system at different concentrations when the riboswitch reporter of the invention is a degfp gene;
wherein, the diagrams (A) and (B) are Sensor-V1 plasmids; panels (C) and (D) are Sensor-V2 plasmids; panels (E) and (F) are plasmids of Sensor-V3;
FIG. 2 is a schematic diagram showing the reaction results of the Sensor-V2 plasmid at different concentrations when the riboswitch reporter of the present invention is the lacZ gene;
wherein, the graphs (A), (B), (C), (D) and (E) are respectively graphs of real-time reaction results when the concentration of the Sensor-V2 plasmid is 0, 5, 10, 20 and 30 nM; panel (F) shows the end point values of the reaction at each concentration of the Sensor-V2 plasmid at a reaction time of 3 hours;
FIG. 3 is a schematic representation of the reaction of different volumes of RPA isothermal amplification products with riboswitch at appropriate concentrations in the present invention;
FIG. 4 is a graph showing the real-time results of detecting sensitivity of the Trigger-V2 plasmid DNA of the RPA-riboswitch of the invention;
wherein, the graph (A) is a real-time result graph of the sensitivity of detecting Trigger-V2 plasmid DNA of an RPA-riboswitch under templates with different DNA concentrations; the graph (B) shows the final plot at a reaction time of 3 h.
FIG. 5 is a schematic diagram showing the reaction results of detecting Trigger-V2 before and after lyophilization of riboswitch-V2 plasmid according to the present invention;
FIG. 6 is a schematic diagram showing the results of specific detection of the TX-TL riboswitch Sensor-V2 plasmid of the invention.
Detailed Description
The invention is further described below in connection with the preferred embodiments, and neither the endpoints of the ranges disclosed in the invention nor any of the values are limited to the precise range or value, and such range or value should be understood to include values near the range or value; for numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.
Example 1
A riboswitch based on a cell-free transcription translation system, wherein the riboswitch is an RNA sequence with a foothold structure designed according to a bacterial conserved sequence RNA, can perform base complementary pairing with a V.vulnificus conserved sequence RNA, and activates the expression of a reporter protein; the riboswitch consists of two RNA chains, namely Sensor RNA and Trigger RNA, wherein the Sensor RNA is the riboswitch, and the Trigger RNA is used for activating the riboswitch; the Sensor RNA is transcribed from a Sensor DNA sequence, and the transcribed Sensor RNA sequence can enable a sequence at a Ribosome Binding Site (RBS) to form a special secondary structure, namely a hairpin structure, which can enable a ribosome not to bind with the Ribosome Binding Site (RBS), so that the translation process cannot be started; the Trigger DNA can transcribe Trigger RNA with the length of 60bp in an in vitro expression system;
wherein the Trigger DNA sequence is amplified from V.vulnificus by using isothermal amplification technology from upstream primer (SEQ ID NO: 1) and downstream primer (SEQ ID NO: 2) with pT7 promoter at 37 ℃ to obtain Trigger DNA sequence (SEQ ID NO: 3) with pT7 promoter,
an upstream primer: 5' -AAGTAATACGACTCACTATAGGCACCAGGGATAACTCCCCG; a downstream primer: 5' -AGTTCACTTCAAGACGCAGAAAAATTGGTGTT;
trigger DNA sequence:
5’-AAGTAATACGACTCACTATAGGCACCAGGGATAACTCCCCGAGCTT GCTGGCCAACACCAATTTTTCTGCGTCTTGAAGTGAACT；
wherein, the Sensor DNA sequence is programmable and is designed according to the selected V.vulnificus conserved sequence Trigger DNA;
the Sensor sequence (SEQ ID NO: 4) is:
5’-ACGCAGAAAAATTGGTGTTGGCCAGCAAGCTCGGGGAGTTGTTATGAG ACAAGAACAGAGGAGACATAACATGTCCCCGAGC。
the Trigger RNA and partial sequence of the Sensor RNA are complementarily paired, and after the Trigger RNA and partial sequence are complementarily paired in an in vitro expression system, the hairpin structure of the Sensor RNA is opened, so that the Sensor RNA can normally translate the reporter protein.
Example 2
The degfp gene is used as a riboswitch Sensor reporter, and riboswitches with good performance for detecting V.vulnificus are screened in a TX-TL system;
1. design of riboswitch for detecting v.vulnificus; selecting three specific gene sequences of V.vulnificus from a database of MetaPhlAn, randomly selecting a DNA sequence with a length of 60bp from each specific marker gene as a recognition sequence in a Trigger DNA of the V.vulnificus, wherein the Trigger DNA comprises a pT7 promoter-specific gene sequence-terminator, wherein an upstream primer contains the pT7 promoter, a downstream primer contains the terminator, and the two primers are utilized to amplify the specific gene sequences to obtain complete Trigger DNA which is named as Trigger-V1, trigger-V2 and Trigger-V3 respectively; inputting the selected Trigger sequences into NCBI-BLAST pages for alignment to prove that the sequences have species specificity; sequentially connecting gene elements such as a plasmid skeleton, a promoter pJ23151, a triggerDNA sequence, a T500 and the like by adopting a Golden Gate Assembly method to construct a complete plasmid, namely a triggerer plasmid; after the sequence of V.vulnificus Trigger DNA is determined, a riboswitch Sensor DNA sequence is designed according to the Trigger DNA sequence, and then a plasmid skeleton, a promoter pJ23151, a Sensor DNA sequence, degfp, T500 and other genetic elements are sequentially connected by adopting a Golden Gate Assembly method to construct a complete plasmid, namely a Sensor plasmid;
2. adding a V.vulnificus riboswitch Sensor plasmid and a Trigger plasmid into a TX-TL reaction system by using a degfp gene as a riboswitch reporter, wherein the concentration of the riboswitch Sensor plasmid is 0, 5, 10 and 20nM respectively, the concentration of the Trigger plasmid is 0, 10, 20 and 30nM respectively, reacting for 8 hours at 29 ℃, and detecting the fluorescence value of GFP green fluorescent protein by using an enzyme-labeled instrument;
3. screening a V.vulnificus riboswitch in a TX-TL system, and the result is shown in figure 1; as can be seen from the graph, the fluorescence value did not increase significantly with increasing Trigger-V1 concentration, indicating that the riboswitch was not activated; this is probably because the riboswitch Sensor-V1 RNA forms a stable foothold, and thus binding of the Trigger-V1 RNA to the Sensor-V1 RNA does not destroy the riboswitch foothold, so that the expression level of the reporter protein is low and riboswitch Sensor-V1 needs to be discarded; the riboswitch Sensor-V2 has low leakage expression under different concentrations, and the fluorescence value gradually rises along with the increase of the concentration of the Trigger-V2, and the highest activation times of the riboswitch Sensor-V2 and the Trigger-V2 are 8.38 when the concentrations are respectively 20nM and 30nM (figure 1C), which shows that the riboswitch has good performance; riboswitch Sensor-V3 concentration within 20nM riboswitch was not activated by Trigger-V3; at a concentration of 30nM, the maximum fold activation was only 2.86, and these results indicate that riboswitch Sensor-V3 recognizes Trigger-V3 poorly and cannot be used to detect V.vulnificus. Therefore, sensor-V2 was chosen as riboswitch for detecting V.vulnificus in this example.
Example 3
The lacZ gene is used as a riboswitch Sensor reporter to verify riboswitch performance, and CPRG is used as an enzyme substrate to realize the visualization of the detection result of the V.vulnificus riboswitch;
1. selecting Sensor-V2 in example 1 as a riboswitch for detecting V.vulnificus, sequentially connecting a plasmid skeleton, a promoter pJ23151, a Sensor-V2 sequence, lacZ, T500 and other gene elements by adopting a Golden Gate Assembly method to construct a complete plasmid;
2. adding V.vulnificus riboswitch Sensor plasmid and Trigger plasmid into TX-TL reaction system with lacZ gene as riboswitch reporter, respectively having riboswitch plasmid concentration of 0, 5, 10, 20, 30nM, trigger plasmid concentration of 0, 5, 10, 20nM, reacting at 29 deg.C for 3 hr, detecting absorbance values at 420nM and 570nM wavelength with enzyme-labeled instrument, and measuring absorbance (A 570 /A 420 ) To characterize the color of the reactants;
3. Sensor-V2 is a riboswitch of V.vulnificus obtained by screening with the degfp gene as a reporter, and the riboswitch was verified with the lacZ gene as a reporter, and the result is shown in FIG. 2; as can be seen from the graph, when the concentration of Sensor-V2 was 5nM, although the leakage expression was low, the riboswitch Sensor-V2 could be activated only when the concentration of Trigger-V2 plasmid was 20nM, indicating that the expression level of riboswitch Sensor-V2 was very small at 5 nM; leakage expression was lower when the Sensor-V2 concentration was 10nM, while A was increased with increasing Trigger-V2 concentration 570 /A 420 The values gradually increased, and were clearly distinguished from leaky expression, with a concentration of 20nM for Sensor-V2, the reaction reached plateau in the 150-180 min period, and 20nM Trigger-V2 significantly activated riboswitch Sensor-V2 at 120min reaction time (FIG. 2F).
Example 4
Use of a riboswitch based on a cell-free transcriptional translation system in clinical assays of v.vulnificus, comprising the steps of:
amplifying a V.vulnificus conserved sequence by using an RPA isothermal amplification method, and under the action of T7 RNA polymerase, the amplification product starts a transcription process by using a T7 promoter in a cell-free transcription translation system so as to obtain a large amount of Trigger RNA;
in a cell-free transcription and translation system, a riboswitch Sensor RNA is obtained through transcription of Sensor DNA so as to identify Trigger RNA and activate the expression of a reporter protein; the Trigger RNA and partial sequence of the Sensor RNA are complementarily paired, and after the Trigger RNA and partial sequence of the Sensor RNA are complementarily paired in an in-vitro expression system, the hairpin structure of the Sensor RNA is opened, so that the Sensor RNA can normally translate the reporter protein;
and determining the target bacteria as the detected V.vulnificus according to the color reaction of the expressed reporter protein and the substrate.
Example 5
The RPA isothermal amplification technology is coupled with a riboswitch, and is used for clinically detecting V.vulnificus and improving detection sensitivity.
1. Amplifying the Trigger DNA sequence by using a V.vulnificus Trigger DNA as a template and using an RPA isothermal amplification kit; placing the reaction system in a metal bath at 37 ℃ for incubation for 30min, taking out samples at intervals of 4min, mixing uniformly by vortex, then incubating for 10min at 80 ℃, and terminating the amplification reaction; under the action of T7 RNA polymerase, the T7 promoter starts the transcription process to obtain a large amount of Trigger RNA;
2. determining the concentration of the Sensor-V2 plasmid to be 20nM, transcribing the riboswitch Sensor RNA from the Sensor DNA in a cell-free transcription and translation system, wherein the RPA amplification product is Trigger RNA, the volumes of the RPA amplification product are respectively 0, 0.5, 1 and 1.5 mu L, and the riboswitch Sensor RNA recognizes the Trigger RNA in a reaction system; transferring the reaction system into 384-well plates, placing the 384-well plates in an enzyme-labeled instrument, detecting the light absorption value of a sample in real time, wherein the reaction temperature is 29 ℃, the reaction time is 180min, and the relative light absorption value A570/A420 is taken as an ordinate, and the result is shown in FIG. 3, and when 1 mu L of RPA amplification product and 1.5 mu L of RPA amplification product are added, the difference from a control group (0 mu L of RPA) can be obviously seen within 3 hours;
to explore the sensitivity of RPA-riboswitch detection, trigger-E4, trigger-S3 and Trigger-V2 were usedCarrying out 10-time gradient dilution on plasmid DNA, and respectively carrying out isothermal amplification by using an RPA amplification kit; DNA concentration was 1X 10 in this order -1 、1×10 -2 、1×10 -3 、1×10 -4 、1×10 -5 、1×10 -6 、1×10 -7 、1×10 -8 0 ng/. Mu.L. Using Trigger DNA with different concentration gradients as a template, performing RPA amplification, and reacting an amplification product with a riboswitch Sensor plasmid in a cell-free transcription and translation system, wherein the result is shown in FIG. 4; as can be seen from FIG. 4, the riboswitches Sensor-S3 and Sensor-V2 have lower leakage when no RPA amplification product is added, and the activating effect of the riboswitch is best when the addition amount of the RPA amplification product is 1.5 mu L, and the sensitivity of the coupling of the RPA isothermal amplification and the riboswitch for detecting V.vulnificus is 1×10 respectively -7 ng/μL。
Example 6
In order to facilitate the storage and transportation of the reagent, the method is applied to various scenes, and the reaction system is freeze-dried to prepare granular solid matters in the embodiment;
adding a proper amount of sterile water to make the final volume consistent with that before freeze-drying, and comparing the reaction results before freeze-drying and after freeze-drying; shaking and mixing the sample uniformly, putting the sample into liquid nitrogen for quick freezing, then putting the sample into a refrigerator at the temperature of minus 80 ℃ for freezing and drying for 5 hours, wherein the freeze drying temperature is minus 55 ℃ and the vacuum degree is 5.4Pa, adding a proper amount of sterile water into a reaction system after freeze drying to ensure that the final volume is consistent with that before freeze drying, and comparing the reaction results before freeze drying and after freeze drying respectively, as shown in figure 5; as can be seen from fig. 5, the relative absorbance of Sensor after lyophilization is lower than before lyophilization in the activated state. However, the RPA amplified Trigger-V2 has a significant activation of riboswitch Sensor-V2 in TX-TL, either before or after lyophilization. These results demonstrate that the overall activity of the reaction system is reduced after lyophilization, but that riboswitch detection of the target DNA is still achieved.
Example 7
In order to explore the specificity based on riboswitch and TX-TL system detection, 14 strains are selected in the embodiment to carry out a specificity detection test;
the single bacterial colony is picked up and evenly mixed in sterile deionized water, boiled in boiling water for 20min, a sample to be detected is prepared, RPA isothermal amplification is carried out on the treated sample by using a Trigger-V2 primer, the amplified product is detected by using a riboswitch Sensor-V2 reaction system based on TX-TL, incubation is carried out for 3h at 29 ℃, and the relative absorbance A570/A420 of the reaction solution is detected, and the result is shown in figure 6;
as can be seen from FIG. 6, of the fourteen bacteria, only the amplified product of V.vulnificus ATCC29307 was able to be detected as a positive result by the riboswitch Sensor-V2-based reaction system, and the other bacteria amplified products were not detected, indicating that the detection of V.vulnificus based riboswitch and TX-TL system has good specificity.
The foregoing description is only illustrative of the present invention and is not intended to limit the scope of the invention, and all equivalent structures or equivalent processes or direct or indirect application in other related arts are included in the scope of the present invention.
Sequence listing
<110> university of Fuzhou
<120> riboswitch based on cell-free transcription translation System and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
aagtaatacg actcactata ggcaccaggg ataactcccc g 41
<210> 2
<211> 32
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
agttcacttc aagacgcaga aaaattggtg tt 32
<210> 3
<211> 85
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
aagtaatacg actcactata ggcaccaggg ataactcccc gagcttgctg gccaacacca 60
atttttctgc gtcttgaagt gaact 85
<210> 4
<211> 82
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
acgcagaaaa attggtgttg gccagcaagc tcggggagtt gttatgagac aagaacagag 60
gagacataac atgtccccga gc 82

Claims (1)

1. A riboswitch based on a cell-free transcriptional translation system, comprising: the riboswitch is an RNA sequence with a footed structure designed according to the RNA of a bacterial conserved sequence and can be matched withV. vulnificusThe conserved sequence RNA is subjected to base complementary pairing to activate the expression of the reporter protein; the riboswitch consists of two RNA chains, namely Sensor RNA and Trigger RNA; the Sensor RNA and the triggerRNA are transcribed by a Sensor DNA and a triggerer DNA in-vitro expression system respectively; the Trigger DNA sequence is prepared from an upstream primer and a downstream primer with pT7 promoterV. vulnificusThe sequence of the upstream primer is shown as SEQ ID NO. 1, the sequence of the downstream primer is shown as SEQ ID NO. 2, the sequence of the Trigger DNA is shown as SEQ ID NO. 3, and the sequence is transcribed in an in vitro expression system to obtain the Trigger RNA sequence; the Sensor DNA sequence is programmable according to the choiceV. vulnificusThe conserved sequence Trigger DNA is designed, and the sequence of the Sensor DNA is shown as SEQ ID NO. 4.
CN202210647219.5A 2022-06-09 2022-06-09 Riboswitch based on cell-free transcription translation system and application thereof Active CN114940993B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210647219.5A CN114940993B (en) 2022-06-09 2022-06-09 Riboswitch based on cell-free transcription translation system and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210647219.5A CN114940993B (en) 2022-06-09 2022-06-09 Riboswitch based on cell-free transcription translation system and application thereof

Publications (2)

Publication Number Publication Date
CN114940993A CN114940993A (en) 2022-08-26
CN114940993B true CN114940993B (en) 2023-07-25

Family

ID=82908831

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210647219.5A Active CN114940993B (en) 2022-06-09 2022-06-09 Riboswitch based on cell-free transcription translation system and application thereof

Country Status (1)

Country Link
CN (1) CN114940993B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004027035A2 (en) * 2002-09-20 2004-04-01 Yale University Riboswitches, methods for their use, and compositions for use with riboswitches.
CN107227377A (en) * 2017-08-10 2017-10-03 广东出入境检验检疫局检验检疫技术中心 Detect the RPA IAC primers and method of Vibrio vulnificus
CN110184326A (en) * 2019-05-13 2019-08-30 华侨大学 A kind of TPP riboswitch aligning primer and intestinal flora classification method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004027035A2 (en) * 2002-09-20 2004-04-01 Yale University Riboswitches, methods for their use, and compositions for use with riboswitches.
CN107227377A (en) * 2017-08-10 2017-10-03 广东出入境检验检疫局检验检疫技术中心 Detect the RPA IAC primers and method of Vibrio vulnificus
CN110184326A (en) * 2019-05-13 2019-08-30 华侨大学 A kind of TPP riboswitch aligning primer and intestinal flora classification method

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Comparative Study between Transcriptionally- and Translationally-Acting Adenine Riboswitches Reveals Key Differences in Riboswitch Regulatory Mechanisms;Jean-François Lemay等;《PLoS Genetics》;第7卷(第1期);第e1001278号第1-16页 *
The application of riboswitch sequencing for human gut bacterial classification and identification;Yaoyao Wu等;《Molecular Phylogenetics and Evolution》;第169卷;第107409号第1-10页 *
一种新发现的基因表达调控机制——核糖开关;赵谨等;《中国生物化学与分子生物学报》(第02期);第151-157页 *

Also Published As

Publication number Publication date
CN114940993A (en) 2022-08-26

Similar Documents

Publication Publication Date Title
EP4198142A1 (en) Kit and method for detecting nucleic acid and uses thereof
CN111321234B (en) Method for detecting microorganisms based on CRISPR-Cas13a system and application
WO2022077687A1 (en) Novel crispr nucleic acid testing method and use
CN113234856B (en) DENV one-step method nucleic acid detection method based on CRISPR/Cas12a and isothermal amplification
CN107988326A (en) Prawn Acute Hepatic pancreatic necrosis（AHPND）RAA constant temperature fluorescence detection method and reagent
US20090226895A1 (en) Method of detecting vibrio parahaemolyticus via real-time PCR-hybridization
CN114940993B (en) Riboswitch based on cell-free transcription translation system and application thereof
CN115747361B (en) Real-time fluorescence MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method
CN111440887A (en) Pseudomonas proteorum TaqMan real-time fluorescence quantitative PCR detection kit and preparation method thereof
CN101294226A (en) RT-PCR method for testing hantavirus genome
EP3827096A1 (en) Method for assessing fecal pollution in water
CN116254349A (en) Rapid visualization detection kit and method for clonorchis sinensis based on RPA-CRISPR/Cas12a system
CN115747351A (en) Kit for detecting Shigella based on CRISPR/Cas12a method and use method thereof
CN114480682A (en) Composition and kit for detecting mycobacterium tuberculosis and application of composition and kit
CN115747353A (en) Primer group, reagent, kit and detection method for detecting Listeria monocytogenes
CN109988860B (en) Primer and probe composition for detecting phytophthora hibernalis, kit and detection method thereof
Oldham et al. Methods for detection and identification of beer-spoilage microbes
Wang et al. Integration of a CRISPR Cas12a-assisted multicolor biosensor and a micropipette tip enables visible point-of-care testing of foodborne Vibrio vulnificus
CN111996272A (en) RPA detection primer group, kit and method for drug-resistant gene mcr-8
CN111996271A (en) RPA detection primer group, kit and method for drug-resistant gene NDM-1 of superbacteria
CN103911460A (en) Kit for detecting isothermal amplification of H1 type influenza virus
CN109266786A (en) African swine fever virus detection kit and detection method based on E184L gene
CN116334264B (en) Electrochemical chip detection kit and detection method for infectious diarrhea pathogen
KR102237098B1 (en) Method for detection and quantification of probiotic yeast Saccharomyces unisporus using real-time polymerase chain reaction
CN109609668B (en) Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant