CN114934129A - Method for judging whether fault is vertically closed by utilizing surface microbial exploration technology - Google Patents
Method for judging whether fault is vertically closed by utilizing surface microbial exploration technology Download PDFInfo
- Publication number
- CN114934129A CN114934129A CN202210578289.XA CN202210578289A CN114934129A CN 114934129 A CN114934129 A CN 114934129A CN 202210578289 A CN202210578289 A CN 202210578289A CN 114934129 A CN114934129 A CN 114934129A
- Authority
- CN
- China
- Prior art keywords
- fault
- microbial
- analysis
- hydrocarbon
- sequencing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
- G16B30/10—Sequence alignment; Homology search
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Computational Biology (AREA)
- Evolutionary Biology (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for judging whether a fault is vertically closed by using a surface microbial exploration technology, which comprises the following steps: s1: determining a target exploration area; s2: sampling and storing; s3: detecting a sample; s4: and (6) analyzing the data. The fault is opened vertically, the oil gas seepage is macro seepage, and the crack of macro seepage is bigger, and great molecule can be from the channel migration to the earth's surface of macro seepage in the oil and gas reservoir, and the crack of micro seepage is little, and light hydrocarbon molecule in the oil and gas reservoir can only be from the migration to the earth's surface in the micro crack, consequently the different hydrocarbon composition of migration to the earth's surface for the ecological population of earth's surface microorganism is inconsistent. The invention analyzes the population change of the surface hydrocarbon microorganisms by extracting DNA in a soil sample and adopting a high-throughput sequencing method.
Description
Technical Field
The invention relates to a method for judging whether a fault is vertically closed by utilizing a surface microbial exploration technology, and belongs to the technical field of oil-gas exploration.
Background
The sealing degree of the fault depends on the sealing capacity of the fault zone material and rocks on two sides of the fault zone material, and the sealing performance is realized by membrane sealing. There are many methods for studying fault anemometry, such as geological methods, data methods, and computer simulations. The method is mainly based on geological analysis and judgment, and the introduction of a mathematical method and a computer simulation technology enhances the judgment means and the display method of the heterogeneity characteristics of fault closure. From the perspective of simplicity and reliability, however, geological methods are the most effective methods for analyzing and judging fault closure.
The geological methodology method generally comprises qualitative analysis and semi-quantitative analysis, wherein the qualitative analysis is mainly used for judging the sealing performance of the fault by researching parameters such as the nature, the age, the section trend, the fault distance and the like of the fault, and the semi-quantitative analysis is used for judging the sealing performance of the fault by an Allen profile, a section positive pressure, a section mudstone smearing effect and the like.
Surface hydrocarbon chemical exploration techniques identify the presence of subsurface reservoirs by detecting abnormalities in the geochemical indices (including microbiological indices) in the surface soil. While hydrocarbon molecules in subterranean reservoirs are transported to the surface by fissures and microfracture leaks.
Micro-leakage is the migration of hydrocarbon molecules in existing oil and gas reservoirs to the surface through micro-fractures, and if geochemical abnormality caused by micro-leakage is detected on the surface, the oil and gas reservoirs which are well preserved are represented underground, and the condition is 'true abnormality'. Macroseepage is the migration of hydrocarbon molecules in existing reservoirs to the surface by fractures that are detrimental to reservoir preservation, so detection of microbiological or geochemical abnormalities at the surface due to macroseepage does not indicate well-preserved reservoirs underground, which is a "false abnormality". The geochemical anomaly detected at the surface therefore needs to be counterfeited and preserved, and the true geochemical anomaly (microbial anomaly) is identified at the surface, thus indicating its hydrocarbon prospect. The identification of macro-leaks from micro-leaks is particularly important.
The existing methods for identifying whether the fault is vertically closed mainly comprise two methods:
(1) geological analysis and judgment:
usually, several well-crossing sections of a certain fault are selected to calculate the fault mud ratio (SGR), then the SGR values of different types of faults in various regions are counted according to the fault sealing relation, and the evaluation standard of the fault mud ratio (SGR index) of the region is comprehensively determined by combining the reality of the region.
(2) The geochemical value in the near surface soil is judged as follows:
mainly by detecting the magnitude of the geochemical values in the near surface soil. The main detection indexes comprise the following indexes:
detecting acidolysis hydrocarbon of surface soil. Acid hydrolysis hydrocarbons refer to occluded gases present in the crystal lattice of the deposit mineral particles and their cement, and are chemically (by adding acid) removed from the medium to form free hydrocarbons. The hydrocarbon has high concentration and high stability and is greatly influenced by the lithology of the soil on the earth surface. However, such hydrocarbons represent an enrichment of hydrocarbons over historical conditions and therefore do not represent a leak-off condition in present day subterranean reservoirs.
And detecting free hydrocarbon of the soil on the earth surface. Free hydrocarbons are collected from the soil, and the concentration of the hydrocarbons in the free hydrocarbons is low, so that the collection requirement is high, special equipment is often required, and the collection efficiency is low.
Detecting the number of surface hydrocarbon oxidizing bacteria and the abnormal shape distribution of planar microbes. Although the number of hydrocarbon oxidizing bacteria above the macroleak is higher than the number of hydrocarbon oxidizing bacteria at the microleakage, the difference in the numbers is not the same as the acid-hydrolyzed hydrocarbon and the free hydrocarbon, and the difference in the numbers is not large enough, so that it is difficult to distinguish the macroleak from the microleakage by the size of the numbers alone. The abnormal distribution of macroseepage hydrocarbon oxidation bacteria is in linear distribution, and the abnormal distribution of micro seepage hydrocarbon oxidation bacteria is in block distribution. However, this method is based on grid-like sample collection, but the line-type sample collection cannot be distinguished, and thus is not suitable.
The patent CN113702620A discloses a method for judging hydrocarbon sources by using microbial fingerprints, which is a method for judging hydrocarbon sources by using microbial fingerprints, wherein microbes have the characteristics of real-time dynamic property and vertical positive correlation with underground oil-gas reservoirs, and the knowledge of oil sources obtained by the method has real-time property and can effectively eliminate the influences of factors such as geological accumulation and the like.
The existing geological method needs to perform data analysis after drilling a well through a fault plane, so that the difficulty of obtaining the data is high. The geochemical method has low accuracy, large acquisition difficulty and more influencing factors. Therefore, a method for determining whether a fault is vertically closed, which is simple and easy to operate, is needed.
Disclosure of Invention
Aiming at the defects in the prior art, the invention aims to provide a method for judging whether a fault is vertically closed by using a surface microbial exploration technology.
In order to achieve the purpose, the invention is realized by the following technical scheme: a method for judging whether a fault is vertically closed by utilizing a surface microbial exploration technology comprises the following steps:
s1: determining a target exploration area;
s2: sampling and storing;
s3: detecting a sample;
s4: and (4) analyzing data, analyzing abnormal gene quantity and microbial community similarity, and judging fault closure.
Preferably, step S1 includes the steps of:
s1.1: based on geological background and early-stage research results of an exploration area, the trend of a fault is clear, 2-3 parallel measuring lines are designed to be perpendicular to the trend of the fault, and the point distance and the line distance are designed according to the distance of the fault;
s1.2: according to the design scheme, the surveying personnel calculate the coordinates of each station.
Preferably, the sampling in step S2 is specifically: 10-100g of samples are taken from the position with the depth of 20-60cm from the earth surface.
By adopting the technical scheme, the method is adopted and operated within the range of 20-60cm of the surface depth, and hydrocarbon oxidizing bacteria within the range are most active.
Preferably, the saving in step S2 is specifically: and (3) storing the collected sample at-20 ℃ or storing the sample by using a soil DNA protective solution.
Preferably, step S3 includes the steps of:
s3.1: performing DNA extraction on the collected sample;
s3.2: carrying out fluorescent quantitative PCR detection on the hydrocarbon oxidation related gene of the collected sample;
s3.3: and (3) carrying out high-throughput sequencing on the hydrocarbon oxidation related genes on the collected samples.
Preferably, the genes associated with the metabolism of different hydrocarbon components are selected by the fluorescent quantitative PCR assay in step S3.2.
Preferably, high throughput sequencing in step S3.2 selects for detection of the entire population of microorganisms or for selection of genes associated with the metabolism of different hydrocarbon components.
By adopting the technical scheme, the invention adopts the existing soil DNA extraction kit to extract DNA of the collected sample, and adopts conventional instruments and kits to carry out PCR detection and high-throughput sequencing on hydrocarbon oxidation related genes.
Preferably, in step S4, colony structure and correlation analysis is performed on the sequencing results of each abnormal region/band sequencing result and the background value region.
By adopting the technical scheme, the average value of the gene quantitative data is counted, and a background value is drawn; outliers were background +2.5 times standard deviation.
Preferably, step S4 specifically includes:
s4.1: sequencing sequence partitioning OTU: performing bioinformatics analysis on OTUs at 97% similarity level;
s4.2: OTU notes: comparing and analyzing OTU representative sequences by adopting an RDP Classifier algorithm or a blast method, and annotating species information of communities of the OTU representative sequences at each level; according to the gene selected by sequencing, different databases are selected for comparison during annotation;
s4.3: bioinformatics analysis: analyzing the sequencing depth of the Alpha diversity analysis of organisms, analyzing the microbial composition and relative content in different classification levels and different samples by using species composition, and analyzing the similarity among a plurality of samples by using Beta diversity;
s4.4: and according to the design sampling point and the related results of quantification and sequencing, analyzing the composition characteristics and the similarity according to microorganisms at different sampling positions, and judging the fault closure.
Preferably, two conditions are set in the analysis of the results at step S4.4:
the first condition is as follows: the copy number of the high-carbon hydrocarbon metabolism genes collected along the fault area is 3-10 times of that of the non-fault collection points;
and a second condition: the relative content of part of the microbial ecological population in the fault area is 3-10 times that in the non-fault area;
if the conditions I and II are met simultaneously, the fault is indicated to be opened vertically; if only one item is satisfied or both items are not satisfied, the fault is indicated to be vertically closed.
The invention has the beneficial effects that:
(1) the fault is opened vertically, and light hydrocarbon in the oil-gas reservoir is transported to the earth's surface through the fault, and the amount of hydrocarbon oxidizing bacteria in the earth's surface is very high because the permeation amount is large. The method collects the sample of the surface soil, and can detect a large amount of hydrocarbon oxidizing bacteria.
(2) The fault is opened vertically, the oil gas seepage is macro seepage, and the crack of macro seepage is bigger, and great molecule can be from the channel migration to the earth's surface of macro seepage in the oil and gas reservoir, and the crack of micro seepage is little, and light hydrocarbon molecule in the oil and gas reservoir can only be from the migration to the earth's surface in the micro crack, consequently the different hydrocarbon composition of migration to the earth's surface for the ecological population of earth's surface microorganism is inconsistent. The invention analyzes the population change of the surface microorganisms by extracting DNA in the soil sample and adopting a high-throughput sequencing method.
(3) The sample is easy to obtain, and only a soil sample of the superficial layer of the earth surface needs to be collected; the detection indexes are direct and dynamic in real time, and only fluorescent quantitative PCR detection and high-throughput sequencing detection are needed to analyze the microbial quantity and community composition; the result indicates that the fault opening can be identified through quantized data. .
Drawings
FIG. 1 is a dot map in embodiment 1 of the present invention;
FIG. 2 is a diagram showing an abnormality in fluorescent quantitative PCR detection in example 1 of the present invention;
FIG. 3 is a high throughput sequencing selected sample anomaly map selected in example 1 of the present invention;
FIG. 4 is a graph showing the measurement results of the sample in example 1 of the present invention;
FIG. 5 is a graph showing the similarity analysis of the colony structure in example 1 of the present invention.
Detailed Description
In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further explained by combining the specific embodiments.
Example 1 sampling analysis in Xinjiang
S1: determining a target survey area
The dots are laid out in a parallel line manner, such as the dot bitmap of 4 × 20 shown in fig. 1. Wherein the dot spacing is 100 meters and the line spacing is 200 meters.
S2: sampling and saving
Collecting soil samples with the depth of 20-30cm, collecting 100g, adding commercially sold DNA protective solution, and storing at normal temperature.
S3: sample detection
S3.1, DNA extraction is carried out on the sample stored at normal temperature, and the DNA extraction is carried out on the collected sample by adopting the existing soil DNA extraction kit to obtain soil microorganism DNA.
S3.2: taking soil microorganism DNA as a template, carrying out fluorescence quantitative PCR detection by using a complete set of reagents for identifying hydrocarbon oxidation bacterium genes, and determining the number of the hydrocarbon oxidation bacterium genes in a soil sample according to the fluorescence intensity of a PCR product, wherein primers for identifying the hydrocarbon oxidation related genes are specifically shown in Table 1.
TABLE 1 primer sequence Listing
| Primer full scale | Primer sequences (5'to3') |
| F2 | AACTACATCGAGCACTACGG |
| R2 | TGAAGATGTGGTTGCTGTTCC |
S3.3: and (3) carrying out high-throughput sequencing on samples on two sides of the fault layer in the work area and the high-abnormal samples in the work area to obtain the composition and relative quantity (namely sequence number) of the microorganisms in the high-abnormal soil samples.
S4: data analysis
All data were divided into 5 grades, and the number of samples in each grade was equal, and a map of the abnormality of the fluorescent quantitative PCR assay was obtained as shown in FIG. 2.
And selecting abnormal points close to the fault (namely along the fault region) and abnormal points far away from the fault (namely the non-fault region) according to the fluorescent quantitative PCR result for high-throughput sequencing. The samples selected for high throughput sequencing in this example are shown in FIG. 3.
(1) And (3) detection results: the number of hydrocarbon oxidation bacteria genes is detected quantitatively by fluorescence, and the composition and relative number (sequence number) of microorganisms are detected by high-throughput sequencing.
(2) And (4) quantitative display: as shown in FIG. 4A, the number of copies of the gene for metabolism of higher hydrocarbons at the collection point along the section B (average 4.78X 10) 4 Copy/g) as non-fault collection point (average 1.19X 10) 4 Copy/gram) indicating the presence of a greater number of higher hydrocarbon metabolizing microorganisms.
(3) High throughput sequencing showed: as shown in fig. 4B, the microbial community composition (genus level) along fault B collection sites is significantly different from the non-fault collection site microbial community composition. The results are shown in that the relative content (the predominant average number of 12 sequences of 252) along the fault region part is about 3 times that of the non-fault region (the average number of 12 sequences is 82) and the individual sequences are not found in the non-fault region.
(4) Similarity analysis microbial community characteristics were high-throughput sequenced along fault and non-fault distribution sampling points for community structure similarity analysis, with the results referring to fig. 5.
As shown in fig. 5, the microbial community structure along the fault acquisition site (D) differed significantly from the non-fault distribution acquisition site (M).
In summary, the fluorescence quantitative PCR values of the sampling points along the slice B are highly abnormal, and the microbial community composition (genus level) is significantly different from that of the non-slice collection point, so that the slice B is judged to be vertically open. Although the fluorescence quantitative PCR value of the sampling point along the fault A has high value discontinuously, the microbial population characteristics are consistent with other abnormal areas, so that the fault A is judged to be vertically closed.
While there have been shown and described what are at present considered to be the basic principles and essential features of the invention and advantages thereof, it will be apparent to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, but is capable of other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.
Furthermore, it should be understood that although the present specification describes embodiments, not every embodiment includes only a single embodiment, and such description is for clarity purposes only, and it is to be understood that all embodiments may be combined as appropriate by one of ordinary skill in the art to form other embodiments as will be apparent to those of skill in the art from the description herein.
Claims (6)
1. A method for judging whether a fault is vertically closed by utilizing a surface microbial exploration technology is characterized by comprising the following steps:
s1: determining a target exploration area
S1.1: setting a sampling point plane matrix in the exploration area;
s1.2: determining coordinates of sampling points by combining the landform and the planar matrix of the exploration area;
s2: sampling and saving
S2.1: sampling 10-100g from the position with the depth of 20-60cm from the earth surface;
s2.2: storing the collected sample at-20 ℃ or storing the sample by using a soil DNA protective solution;
s3: sample detection
S3.1: performing DNA extraction on the collected sample;
s3.2: carrying out fluorescent quantitative PCR detection on hydrocarbon oxidation related genes on the collected sample;
s3.3: carrying out high-throughput sequencing on the hydrocarbon oxidation related genes of the collected sample;
s4: data analysis
And analyzing the abnormal gene quantity and the similarity of microbial communities to judge fault closure.
2. The method for determining whether a fault is vertically confined by surface microbiological exploration techniques according to claim 1 wherein in step S3.2 the genes associated with the metabolism of different hydrocarbon components are detected by fluorescent quantitative PCR.
3. The method for determining whether a fault is vertically closed by using surface microbial exploration technology as claimed in claim 2, wherein high throughput sequencing detects microbial whole communities or genes related to metabolism of different hydrocarbon components in step S3.2.
4. The method for determining whether a fault is vertically closed according to the earth surface microbial exploration technology as claimed in claim 3, wherein step S4 is to perform colony structure and correlation analysis on the sequencing result of each abnormal region/zone and the sequencing result of the background value region.
5. The method for determining whether a fault is vertically closed according to the earth surface microbial exploration technology as claimed in claim 4, wherein the step S4 is specifically as follows:
s4.1: sequencing sequence partitioning OTU: performing bioinformatic analysis on OTUs at 97% similar level;
s4.2: OTU notes: comparing and analyzing OTU representative sequences by adopting an RDP Classifier algorithm or a blast method, and annotating species information of communities at each level; selecting different databases for comparison during annotation according to the genes selected by sequencing;
s4.3: bioinformatics analysis: biological Alpha diversity analysis sequencing depth, species composition analysis of different classification levels, microbial composition and relative content in different samples, Beta diversity analysis of similarity among multiple samples;
s4.4: and according to the design sampling point and the related results of quantification and sequencing, analyzing the composition characteristics and the similarity according to microorganisms at different sampling positions, and judging the fault closure.
6. The method of claim 5, wherein two conditions are provided in the analysis of the result of step S4.4:
the first condition is as follows: the copy number of the high-carbon hydrocarbon metabolism genes collected along the fault area is 3-10 times of that of the non-fault collection points;
and a second condition: the relative content of part of the microbial ecological population in the fault area is 3-10 times that in the non-fault area;
if the conditions I and II are met simultaneously, the fault is indicated to be opened vertically; if only one item is satisfied or both items are not satisfied, the fault is indicated to be vertically closed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210578289.XA CN114934129B (en) | 2022-05-25 | 2022-05-25 | Method for judging whether fault is vertically closed by utilizing surface microbial exploration technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210578289.XA CN114934129B (en) | 2022-05-25 | 2022-05-25 | Method for judging whether fault is vertically closed by utilizing surface microbial exploration technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114934129A true CN114934129A (en) | 2022-08-23 |
| CN114934129B CN114934129B (en) | 2023-04-11 |
Family
ID=82865074
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210578289.XA Active CN114934129B (en) | 2022-05-25 | 2022-05-25 | Method for judging whether fault is vertically closed by utilizing surface microbial exploration technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114934129B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104101914A (en) * | 2014-07-31 | 2014-10-15 | 盎亿泰地质微生物技术（北京）有限公司 | Method for oil-gas resource exploration indicating by utilizing molecular ecology |
| CN112301138A (en) * | 2020-11-06 | 2021-02-02 | 新方舟能源科技(天津)有限公司 | Oil gas microbial gene exploration method |
| CN113702620A (en) * | 2021-08-02 | 2021-11-26 | 英索油能源科技（北京）有限责任公司 | Method for determining hydrocarbon source by using microbial fingerprint |
-
2022
- 2022-05-25 CN CN202210578289.XA patent/CN114934129B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104101914A (en) * | 2014-07-31 | 2014-10-15 | 盎亿泰地质微生物技术（北京）有限公司 | Method for oil-gas resource exploration indicating by utilizing molecular ecology |
| CN112301138A (en) * | 2020-11-06 | 2021-02-02 | 新方舟能源科技(天津)有限公司 | Oil gas microbial gene exploration method |
| CN113702620A (en) * | 2021-08-02 | 2021-11-26 | 英索油能源科技（北京）有限责任公司 | Method for determining hydrocarbon source by using microbial fingerprint |
Non-Patent Citations (1)
| Title |
|---|
| 闫亮等: "塔里木盆地顺北断溶体油气藏微生物特征及有利区预测", 《石油与天然气地质》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114934129B (en) | 2023-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Krásný | Classification of transmissivity magnitude and variation | |
| US5286651A (en) | Determining collective fluid inclusion volatiles compositions for inclusion composition mapping of earth's subsurface | |
| EP0415672B1 (en) | Method for exploring the earth's subsurface | |
| CN112301138A (en) | Oil gas microbial gene exploration method | |
| EP0414564B1 (en) | Apparatus and method for use in the analysis of fluid inclusions | |
| CN112029896A (en) | Method for detecting diversity of macrophytes based on environmental DNA technology | |
| US5416024A (en) | Obtaining collective fluid inclusion volatiles for inclusion composition mapping of earth's subsurface | |
| CN107505344A (en) | The lithologic interpretation method of " least square product " method of utilization | |
| Te Stroet et al. | Predicting sweet spots in shale plays by DNA fingerprinting and machine learning | |
| CN107389648A (en) | A kind of 3-D quantitative fluorescent characteristics peak identification and fluid type determination methods | |
| Sechman et al. | Soil gas composition above gas deposits and perspective structures of the Carpathian Foredeep, SE Poland | |
| EP3256599B1 (en) | Computer supported exploration and production of heterogeneous distributed hydrocarbon sources in subsurface formations based on microbial prospecting | |
| CN114934129B (en) | Method for judging whether fault is vertically closed by utilizing surface microbial exploration technology | |
| CN107267623B (en) | A kind of Microbial Prospecting of Oil and Gas method | |
| CN105064987A (en) | Interpretation and evaluation method for water layer recognition by logging while drilling Q parameter | |
| CN113702620B (en) | Method for determining hydrocarbon source by using microbial fingerprint | |
| CN114015794B (en) | Method for constructing liquid production profile map based on geological microbial community characteristics | |
| RU2298816C2 (en) | Method for geo-chemical testing of local objects during prognosis of oil content | |
| CN104975067A (en) | Method for carrying out oil exploration, oil deposit characterization and abnormity identification by taking total bacteria count abnormity and viable bacteria count abnormity of butane-oxidizing bacteria as indexes | |
| Sachsenhofer et al. | Characterization of organic matter in late Cretaceous black shales of the Eastern Alps (Kainach Gosau Group, Austria) | |
| Sechman et al. | Influence of soil moisture on the results of surface geochemical survey applied to petroleum exploration | |
| CN113554066B (en) | Method and system for identifying hydraulic connection between underground brine reservoirs in coastal zone | |
| Zijp et al. | Eagle Ford and Bakken productivity prediction using soil microbial fingerprinting and machine learning | |
| Riley et al. | Statistical analysis of the hydrochemistry of ground waters in Columbia River basalts | |
| CN114958964B (en) | Oil gas exploration method based on microbial genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230324 Address after: 1F-A144, No. 79, Siping East Road, Quanyechang Street, Heping District, Tianjin, 300000 Applicant after: New ark energy technology (Tianjin) Co.,Ltd. Address before: Room 801, Building 10, No. 1, Chaoqian Road, Changping Science and Technology Park, Changping District, Beijing 100000 Applicant before: INSOIL ENERGY TECHNOLOGIES (BEIJING) Co.,Ltd. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |