CN114920833B

CN114920833B - New coronavirus RBD specific monoclonal antibody and application

Info

Publication number: CN114920833B
Application number: CN202210564962.4A
Authority: CN
Inventors: 胡超; 王应明; 韩晓建; 高凤霞; 申美莹; 李罗; 金艾顺
Original assignee: Chongqing Medical University
Current assignee: Chongqing Medical University
Priority date: 2020-08-19
Filing date: 2020-08-19
Publication date: 2023-10-17
Anticipated expiration: 2040-08-19
Also published as: CN115925903A; CN111909261B; CN114920833A; CN111909261A

Abstract

The application belongs to the technical field of monoclonal antibodies, and particularly discloses a novel coronavirus RBD specific monoclonal antibody and application thereof. The application has important scientific significance and application prospect for the prevention, clinical treatment and research and development of diagnostic reagents of diseases caused by novel coronavirus SARS-CoV-2.

Description

New coronavirus RBD specific monoclonal antibody and application

The application is a divisional application of patent with application date 2020.08.19, application number 202010839228.5 and patent name of new coronavirus RBD specific monoclonal antibody and application.

Technical Field

The application belongs to the technical field of monoclonal antibodies, and particularly relates to a novel coronavirus RBD specific monoclonal antibody and application thereof.

Background

Antibodies are immunoglobulin molecules composed of four polypeptide chains, including two heavy chains (H chains) and two light chains (L chains). The H chain consists of a heavy chain variable region (VH) and a heavy chain constant region consisting of three regions CH1, CH2 and CH 3. The L chain consists of an L chain variable region (VL) and a light chain constant region consisting of a CL region. VH and VL can be further divided into hypervariable regions called Complementarity Determining Regions (CDRs) and conserved regions called Framework Regions (FR) alternating.

The current research finds that: the novel coronavirus (SARS-CoV-2) has four major structural proteins, spike protein (S protein), nucleocapsid protein (N protein), membrane protein (M protein) and envelope protein (E protein), respectively, wherein the S protein has two subunits: s1 and S2, receptor Binding Sites (RBDs) are located on the S1 subunit, whose primary function is to recognize host cell surface receptors, mediating fusion with host cells.

There is no specific drug targeted therapy against the new pathogen covd-19 at present, and vaccine development is still required. The plasma of the recently cured discharged patient contains high-concentration specific antigen neutralizing antibodies, and after the high-concentration specific antigen neutralizing antibodies are input into the patient, the novel coronavirus can be neutralized to mediate effective immune response, so that the recovery-period plasma is expected to provide effective treatment means for curing patients infected with the novel coronavirus, the death rate is reduced, and the life safety of the patient is ensured.

The chinese patent application publication No. CN111303280a discloses a fully human monoclonal antibody against SARS-CoV-2 with high neutralizing activity, which provides a fully human monoclonal antibody with a recognition region of S1 non-RBD region, but since the invasion of a new coronavirus into host cells is bound to ACE2 of the host cells by RBD, the blocking effect of the fully human monoclonal antibody obtained by the above patent against the virus is limited, and the above patent is an antibody cDNA obtained by labeling plasma cells, but the memory B cells react rapidly after activation compared to the plasma cells, so that the memory B cells can elicit a faster and stronger humoral immune response than the primary reaction, and the humoral immune response elicited by the plasma cells is limited.

Disclosure of Invention

The object of the present application is to provide a novel coronavirus RBD-specific monoclonal antibody and use directed against RBD and capable of eliciting a more intense humoral immune response.

In order to achieve the aim, the application provides a novel coronavirus RBD specific monoclonal antibody, in particular to a monoclonal antibody with the heavy chain variable region amino acid sequence shown in SEQ ID NO. 1; the amino acid sequence of the light chain variable region is shown in SEQ ID NO. 2 (monoclonal antibody 11-CQTS 103). The amino acid sequence of the heavy chain variable region can be also shown as SEQ ID NO. 3; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 4 (monoclonal antibody 12-CQTS 104). The amino acid sequence of the heavy chain variable region can be also shown as SEQ ID NO. 5; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 6 (monoclonal antibody 13-CQTS 105). The amino acid sequence of the heavy chain variable region can be also shown as SEQ ID NO. 7; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 8 (monoclonal antibody 14-CQTS 106). The amino acid sequence of the heavy chain variable region can also be shown as SEQ ID NO. 9; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 10 (mab 15-CQTS 107). The amino acid sequence of the heavy chain variable region can be also shown as SEQ ID NO. 11; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 12 (monoclonal antibody 16-CQTS 108). The amino acid sequence of the heavy chain variable region can also be shown as SEQ ID NO. 13; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 14 (monoclonal antibody 17-CQTS 109). The amino acid sequence of the heavy chain variable region can be also shown as SEQ ID NO. 15; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 16 (mab 18-CQTS 110). The amino acid sequence of the heavy chain variable region can be also shown as SEQ ID NO. 17; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 18 (monoclonal antibody 19-CQTS 111). The amino acid sequence of the heavy chain variable region can also be shown as SEQ ID NO. 19; the amino acid sequence of the light chain variable region can also be shown as SEQ ID NO. 20 (mab 20-CQTS 112).

The application also provides application of the novel coronavirus RBD specific monoclonal antibody in preparing a reagent or vaccine or medicament for detecting or diagnosing SARS-CoV-2, wherein the medicament comprises the novel coronavirus RBD specific monoclonal antibody and pharmaceutically acceptable excipient, diluent or carrier; nucleic acid molecules encoding the novel coronavirus RBD specific monoclonal antibodies are also provided; also provided are expression cassettes, recombinant vectors, recombinant bacteria or transgenic cell lines comprising the above nucleic acid molecules; also provides the application of the expression cassette, the recombinant vector, the recombinant bacterium or the transgenic cell line in preparing products.

The application also provides a product comprising the novel coronavirus RBD specific monoclonal antibody; the product uses are any one of the following (b 1) - (b 4): (b 1) binding to the novel coronavirus SARS-CoV-2; (b 2) detecting the binding of the novel coronavirus SARS-CoV-2; (b 3) binding to the S protein of the novel coronavirus SARS-CoV-2; (b 4) detecting the S protein of the novel coronavirus SARS-CoV-2.

Preferably, the monoclonal antibodies specific to RBD of the novel coronavirus are prepared by sorting RBD specific memory B cells and obtaining cDNA of the variable region of the antibody by mRNA of the RBD specific memory B cells.

The principle and the beneficial effects of the application are as follows:

(1) Compared with the monoclonal antibody aiming at the S1 non-RBD region, the monoclonal antibody provided by the application combines with RBD, and provides wider application value for screening antibody medicines, diagnosing, preventing and treating new coronaries pneumonia.

(2) The monoclonal antibody provided by the application is obtained by sorting RBD specific memory B cells, and compared with the prior art by sorting plasma cells, the monoclonal antibody prepared by the application can trigger stronger humoral immune response. In addition, the application only carries out subsequent RT-PCR, nested PCR and antibody function analysis aiming at RBD specific memory B cells, thereby greatly improving the specific binding capacity of monoclonal antibodies and RBD.

Drawings

FIG. 1 is a diagram of cell sorting using flow cytometry to analyze RBD specific memory B cells;

FIG. 2 is a diagram of cell sorting using flow cytometry to analyze RBD specific memory B cells;

FIG. 3 is a gel electrophoresis diagram of a single cell antibody gene PCR product;

FIG. 4 is a diagram of agarose gel electrophoresis after PCR amplification of an antibody gene expression cassette comprising a CMV promoter, WPRE-gamma or WPRE-kappa element;

FIG. 5 is a graph showing RBD specificity detection results.

Detailed Description

The following description of the embodiments of the present application will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the application. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

Example 1

The embodiment provides a novel coronavirus RBD specific monoclonal antibody, and the amino acid sequence of a heavy chain variable region is shown as SEQ ID NO. 1; the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 2.

The embodiment also provides the application of the novel coronavirus RBD specific monoclonal antibody in preparing reagents or medicines for detecting or diagnosing SARS-CoV-2.

In practice, the RBD-specific monoclonal antibody of the present example can be used to prepare a nucleic acid molecule, or to prepare an expression cassette, recombinant vector, recombinant bacterium or transgenic cell line comprising the nucleic acid molecule, or to prepare a pharmaceutical composition comprising the novel RBD-specific monoclonal antibody of coronavirus described above and a pharmaceutically acceptable excipient, diluent or carrier.

When applied, the relevant product of the RBD-specific monoclonal antibody preparation obtained in this example can have the uses as any one of the following (b 1) to (b 4): (b 1) binding to the novel coronavirus SARS-CoV-2; (b 2) detecting the binding of the novel coronavirus SARS-CoV-2; (b 3) binding to the S protein of the novel coronavirus SARS-CoV-2; (b 4) detecting the S protein of the novel coronavirus SARS-CoV-2.

Examples 2 to 10

Examples 2-10 differ from example 1 in that: the variable region amino acid sequences of the RBD specific monoclonal antibodies are different, and the variable region amino acid sequences of examples 2-10 are shown in the following table:

the RBD-specific monoclonal antibodies provided in examples 1-10 above were all obtained by the following method: firstly, single RBD specific memory B cells are obtained from peripheral blood of a new patient suffering from coronary pneumonia, then mRNA of the RBD specific memory B cells is obtained, then an antibody variable region gene expression cassette is constructed through RT-PCR and nested PCR, then the antibody variable region gene expression cassette is transduced into 293T cells to express antibodies, the supernatant is collected, the RBD specificity of the supernatant is detected by an ELISA method, and the RBD specific monoclonal antibodies are obtained through screening.

The method specifically comprises the following steps:

s1, collecting peripheral blood of a plurality of new patients suffering from coronary pneumonia, separating to obtain PBMC, and freezing in a refrigerator at-80 ℃ for later use.

S2, firstly removing Dead cells of PBMC obtained in the step S1 by adopting a Dead Dye (Dead Dye), and then adopting CD19, mIg-G, mIg-D and S-RBD to Dye and mark the memory B cells with high binding capacity and specificity to the living RBD in the PBMC, so as to screen out the memory B cells specific to the RBD; the specific memory B cells are sorted on a 96-well plate by using a flow cell sorter, and each well is internally provided with one specific memory B cell, and the specific memory B cells are frozen in a refrigerator at the temperature of minus 80 ℃ for standby.

Specifically, the preferred concentration range for the Dye of the present example is 1-2. Mu.g/mL, and the preferred concentration for the Dye of the present example is 1.5. Mu.g/mL; CD19 is a B cell marker produced by Biolegend and is stained at a concentration ranging from 1 to 2. Mu.g/mL, with a concentration of 1.5. Mu.g/mL being preferred for the staining of CD19 in this example. mIg-G is a B cell surface receptor produced by Biolegend and is stained at a concentration ranging from 1 to 2. Mu.g/mL, with mIg-G being preferred in this example at a concentration of 1.5. Mu.g/mL; mIg-D is a B cell surface receptor produced by Biolegend, and the concentration range is 1-2 μg/mL when staining, and the preferred concentration of mIg-D in this example is 1.5 μg/mL when staining; the novel coronavirus produced by S-RBD is a protein receptor domain and is stained at a concentration ranging from 1 to 2. Mu.g/mL, with the preferred concentration for S-RBD staining of this example being 1.5. Mu.g/mL.

Sorting of RBD-specific memory B cells by flow cytometry cell sorting of PBMC by CD19, mIg-G, mIg-D and S-RBD cell sorting charts of B cells with specific memory for S-RBD are shown in FIGS. 1 and 2, wherein Batch ID 0428, 0505, 0522, 0528 in FIG. 2 are screening batches. The principle of screening the memory B cells specific to RBD by adopting CD19, mIg-G, mIg-D and S-RBD in the embodiment is as follows: PBMC were stained with DedDye, B cell marker CD19, memory B cell markers mIg-G positive and mIg-D negative and memory B cells expressing RBD specific IgG, and then CD19 cell populations were divided from the cell populations using a flow cytometer, followed by dividing mIg-G from the CD19 positive cell populations ⁺ mIg-D ^- Cell populations, again from mIg-G ⁺ mIg-D ^- The cell population divides RBD positive memory B cells, and then the RBD positive memory B cells are sorted by a flow cell sorter.

S3, sorting to obtain mRNA of a single RBD specific memory B cell, and amplifying by RT-PCR to obtain the antibody variable region cDNA. Specifically, when the RT-PCR is used for amplifying the cDNA of the antibody variable region, a general Leader (see a primer sequence table I and a primer sequence table II) is designed at the front section of the primer designed in the embodiment, so that the amplification rate of the antibody gene is effectively improved, and the experimental result is shown in figure 3.

S4, amplifying the cDNA of the antibody variable region obtained by the S1-S3 by adopting nested PCR, and constructing an antibody variable region gene expression cassette.

S3 and S4 are performed in total by the following six parts: (1) extracting mRNA of RBD specific memory B cells; (2) single cell mRNA Reverse Transcription (RT); (3) adding a G tail (TDT); (4) first round PCR (1 st PCR); (5) a second round of PCR (2 nd PCR); (6) BCR-ORFPCR amplification construction of a gene expression cassette; (7) CMV, WPRE-gamma/kappa/l fragment amplification and CMV, BCR-V gamma/kappa/l ((6) product), WPRE-gamma/kappa/l overlap PCR (Overlap PCR) pre-ligation; (8) amplification of BCR-gamma ORF, BCR-kappa ORF, and BCR-lPCR.

The preparation and reaction conditions of each part of reaction liquid are as follows:

(1) By Dynabeads ^TM mRNA DIRECT ^TM Single-cell mRNA extraction is carried out by using a Purification Kit (Thermo Fisherscientific), and the method specifically comprises the following steps:

(1) and (3) centrifuging: taking out the 96-well plate with single RBD specific memory B cells from the refrigerator at-80 ℃, and centrifuging at 600 Xg for 30s to make the cells centrifuged at the bottom of the well;

(2) cleaning: taking out Dynabeads oligo (dT) 25 microsphere bottles, uniformly vortex and mix, sucking enough microspheres according to 2 μl/hole, placing the microspheres on a magnet block, standing for 30s, discarding the supernatant, and re-suspending with 500 μl of Lysis Buffer;

(3) preparing: adding 9 μl/well of Lysis Buffer into a 50mL centrifuge tube, adding the 500 μl microsphere suspension, and blowing with a gun;

(4) and (5) subpackaging: dispensing the microspheres with eight tubes, then adding them to the cell plate at 9 μl/well using a lance;

(5) and (3) rinsing: pasting a film on a 96-hole plate, and then rinsing the periphery of the pipe wall for 2 cycles;

(6) incubation: standing at room temperature for 5min to fully release mRNA of RBD specific memory B cells and combine the mRNA with the microsphere, and centrifuging at 600 Xg instant after incubation, so that the microsphere is centrifuged at the bottom of the hole. Place 96-well plates in DynaMag ^TM -96side Magnet magnetic plates, and removing the supernatant with a gun;

(7) wash A cleaning: adding a Washing Buffer A according to 8 μl/well, removing the plate 7-8 times, washing the microspheres thoroughly, and discarding the supernatant;

(8) wash B cleaning: wash Buffer B was added at 8. Mu.l/well and the plate was run back and forth 7-8 times to allow the microspheres to wash well, the supernatant was discarded, and then a pre-prepared Reverse Transcription (RT) reaction was added at 10. Mu.l/well. Reagent formulation and reaction conditions are described in (2) below.

(2) Reverse Transcription (RT) (10. Mu.l System)

The reagents required to be formulated are shown in table 1 below:

reagent name	Volume of
		DEPC-H ₂ O	4.5μl
5×primerscript Buffer	2.0μl
		2.5mM dNTP	2.0μl
RNase Inhibitor	1μl
		Sample	beads
PrimerScriptⅡRTase	0.5μl
		Total volume of	10μl

Reaction conditions: 42 ℃ for 60min (mixing every 20 min);

after completion of the reaction, the 96-well plate was subjected to instantaneous centrifugation at 600 Xg, and then the 96-well plate was placed in DynaMag ^TM The supernatant was pipetted off on a 96side Magnet magnetic plate, and then 10. Mu.l/well of the pre-formulated TDT reaction solution was added, and the reagent formulation and reaction conditions were as described in (3) below.

(3) Add G tail (TDT) (10 μl System)

The reagents required to be formulated are shown in table 2 below:

reagent name	Volume of
		H ₂ O	6.4μl
5×TdT buffer	2.0μl
		10mM dGTP	0.5μl
0.1％BSA	1.0μl
		Sample	beads
TdT	0.1μl
		Total volume of	10μl

Reaction conditions: 37℃for 40min (mixing every 20 min).

At the end of the reaction, the 96-well plate was transiently centrifuged at 600 Xg and then placed in DynaMag ^TM The supernatant was pipetted off on a 96side Magnet magnetic plate, and then 10. Mu.l/well of the pre-formulated first round PCR (1 st PCR) reaction solution was added, and the reagent formulation and reaction conditions were as described in (4) below.

(4) 1st PCR (10. Mu.l System) (primer sequence see primer sequence Listing)

The reagents required to be formulated are shown in table 3 below:

reagent name	Volume of
		H ₂ O	1.9μl
2×GC Buffer	5μl
		2.5mM dNTP	1μl
FP:AP3-dC(10μM)	0.5μl
		RP1:Cg-1st(10μM)	0.5μl
RP2:Ck-1st(10μM)	0.5μl
		RP3:CI-RT(10μM)	0.5μl
PrimesTAR	0.1μl
		sample	beads
Overall (L)Product of	10μl

Based on the PCR principle, the experimental reaction conditions of the 1st PCR are as follows: (1) pre-denaturation at 95℃for 3min; (2) denaturation at 95℃for 15sec, annealing at 60℃for 5sec, extension at 72℃for 1min,30-35cycles, 30cycles being preferred in this example; (3) the extension was carried out at 72℃for 5 minutes and stored at 4 ℃.

(5) Second round PCR (2 nd PCR) (10. Mu.l System) (primer sequence see primer sequence Listing first and primer sequence Listing second)

The reagents required to be formulated are shown in table 4 below:

reagent name	Volume of
		H ₂ O	1.5μl
2×GC Buffer	5μl
		2.5mM dNTP	1μl
FP:MAC-AP3/AP3(10μM)	0.5μl
		RP:Cg-nest/K20/CI-nest(10μM)	0.5μl
PrimesTAR	0.5μl
		sample	1μl
Total volume of	10μl

Based on the PCR principle, the experimental reaction conditions of 2nd PCR are as follows: (1) pre-denaturation at 95℃for 3min; (2) denaturation at 95℃for 15sec, annealing at 60℃for 5s, extension at 72℃for 1min,30-35cycles, 35cycles being preferred in this example; the extension was carried out at 72℃for 5 minutes and stored at 4 ℃.

After the PCR is finished: mu.l of each well was subjected to 1.5% agarose gel electrophoresis. The cell wells paired with either Kappa or Lamada chains were sequenced.

(6) Amplification and construction of antibody expression cassettes (BCR-ORFs)

PCR amplified promoter region (CMV promoter), WPRE-gamma (antibody gamma chain) and WPRE-kappa (antibody kappa chain), PCR amplified system is shown in Table 5 below:

the PCR amplification conditions were: (1) pre-denaturation at 95℃for 3min; (2) denaturation at 95℃for 15sec, annealing at 56℃for 15sec, extension at 72℃for 1min,30cycles; (3) the extension was carried out at 72℃for 5 minutes and stored at 12 ℃.

(7) CMV, WPRE-gamma/kappa/l fragment amplification and CMV, BCR-V gamma/kappa/l, WPRE-gamma/kappa/l overlap PCR (Overlap PCR) pre-ligation

The experimental system is shown in table 6 below:

the PCR amplification conditions were: pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 50℃for 15sec, extension at 72℃for 1.5min,10cycles; the extension was carried out at 72℃for 5 minutes and stored at 12 ℃.

(8) BCR-gamma ORF, BCR-kappa ORF, and BCR-l PCR amplification

The experimental system is shown in table 7 below:

PCR amplification procedure: pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 58℃for 15sec, extension at 72℃for 1.5min,30cycles; the extension was carried out at 72℃for 5 minutes and stored at 12 ℃.

After amplification, agarose gel electrophoresis is adopted, gel imaging analysis is carried out to obtain whether the size of the antibody variable region gene is correct, the experimental result is shown in figure 4, the Marker is at the middle position, and the band is at 5000 bp.

BCR-gamma ORF and BCR-kappa/ORF ethanol precipitation: respectively taking 30 mu l of PCR products of the BCR-gamma ORF and the BCR-kappa ORF, placing the PCR products in 8 connecting tubes, adding 120 mu l of absolute ethyl alcohol and 6 mu l of sodium acetate solution, fully and uniformly mixing, and standing at-80 ℃ for 30min;10000rpm, centrifuging for 20min, discarding supernatant, sequentially rinsing with 200 μl of 70% ethanol and absolute ethanol, volatilizing at 56 deg.C, adding 40 μl of sterile water, shaking, dissolving precipitate, and detecting antibody variable region gene concentration.

The Leader primers used in S3 and S4 are shown in the following primer sequence table I:

the J-region primers used in S3 and S4 are described in the following primer sequence Listing II:

primer ID	sequence
		IGHJ_01	GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAGT
IGHJ_02	GATGGGCCCTTGGTGGAGGGTGAGGAGACAGTGACCAGGGTGCCACGGCCCCAGA
		IGHJ_03	GATGGGCCCTTGGTGGAGGGTGAAGAGACGGTGACCATTGTCCCTTGGCCCCAGA
IGHJ_04	GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCGTGGTCCCTTGCCCCCAGA
		IGKJ_01	GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC
IGKJ_02	GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC
		IGKJ_03	GATGGTGCAGCCACAGTTCGTTTGATATCCACTTTGGTCCCAGGGCCGAAAGTGA
IGKJ_04	GATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGTGA
		IGKJ_05	GATGGTGCAGCCACAGTTCGTTTAATCTCCAGTCGTGTCCCTTGGCCGAAGGTGA
IGLJ_01	GGGGCAGCCTTGGGCTGACCTAGGACGGTGACCTTGGTCCCAGTTCCGAAGACAT
		IGLJ_02	GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCA
IGLJ_03	GGGGCAGCCTTGGGCTGACCTAAAATGATCAGCTGGGTTCCTCCACCAAATACAA
		IGLJ_04	GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCGGTCCCCTCACCAAACACCC
IGLJ_05	GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCCGTCCCCTCACCAAACACCC
		IGLJ_06	GGGGCAGCCTTGGGCTGACCGAGGACGGTCACCTTGGTGCCACTGCCGAACACAT
IGLJ_07	GGGGCAGCCTTGGGCTGACCGAGGACGGTCAGCTGGGTGCCTCCTCCGAACACAG
		IGLJ_08	GGGGCAGCCTTGGGCTGACCGAGGGCGGTCAGCTGGGTGCCTCCTCCGAACACAG

s5, transferring the antibody variable region gene expression cassette obtained in the S4 into 293T cells for 48 hours to express the antibody, collecting supernatant, detecting RBD specificity of the supernatant by an ELISA method, and screening RBD specific fully human monoclonal antibodies.

(A) Antigen was diluted with PBS (final concentration 2. Mu.g/mL), 10. Mu.l/well, coated 384 well ELISA plates overnight at 4℃or coated for 2h at 37℃in this example, preferably overnight at 4 ℃. NOTE: after the addition, the liquid was kept at the bottom by instantaneous centrifugation.

The experimental system is shown in table 8 below:

reagent name	Goods number	Original concentration	Final concentration	Dilution ratio
					SARS-COV-2RBD	Cat:40592-V08H	200μg/mL	2μg/mL	1:100
Goat pab to Hu IgG－ALP	Cat:ab97221	1mg/mL	2μg/mL	1:500

(B) PBST (0.05% Tween 20, cat#tb220) was formulated: 1L of PBS was added with 0.5mL of Tween 20;

the PBST machine washed the plates (Thermoscientific wellwash versa) or hand washed (the machine washed plates still had to be manually clapped/centrifuged for 1min using a microplate centrifuge (MPC-P25)) to make the plates invisible with water and air bubbles.

Closing: mu.l of 5% BSA (BioFroxx, cat.NO:4240GR 100) (PBST formulation) was added to the above washed plates and incubated in an incubator at 37℃for 1h. PBST machine washing the plates or hand washing.

(C) And (5) adding samples and standard substances. Wherein, standard substance: the 10. Mu.l/well stock concentration was 1. Mu.g/mL, and the gradient dilutions were 250ng/mL, 125ng/mL, 62.5ng/mL, 31.25ng/mL, 15.63ng/mL, 7.81ng/mL, 3.9ng/mL, and 1.95ng/mL. (blocking fluid dilution); sample: cell supernatants transfected with antibody genes. Negative control/blank wells: blocking solution 10. Mu.l/well.

Incubate at 37℃for 30min. PBST machine washing the plates or hand washing.

(D) The secondary antibody was added at a concentration of 10. Mu.l/well and then incubated at 37℃for 30min.

The experimental system is shown in table 9 below:

second antibody name	Goods number	Original concentration	Final concentration	Dilution ratio
					goat-anti-human IgG-ALP	A18808	1.5mg/ml	0.3μg/ml	1:5000
Goat pab to Hu IgG-ALP	Ab98532	0.5mg/ml	0.25μg/ml	1:2000

PBST machine washing the plates or hand washing. PNPP (disodium p-nitrophenylphosphate) at 10. Mu.l/well was used (Thermoscientific Muttiskan GO) to detect OD (450 mm) values of 5min,10 min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min and 60 min. 50mg PNPP powder (Thermo, prod # 34045) +40mL ddH ₂ O+10mL of Diethanol aminesubstrate Buffer (5X), PNPP was stored at 4℃in the dark.

The experimental results are shown in FIG. 5, and the OD value is greater than 0.1 and positive.

The foregoing description of the preferred embodiments of the present application is merely illustrative, and not restrictive, of the application. It will be appreciated by those skilled in the art that many variations, modifications and even equivalent changes may be made thereto within the spirit and scope of the application as defined in the appended claims, but are still within the scope of the application.

<110> university of Chongqing medical science Feng Yulin

<120> New coronavirus RBD-specific monoclonal antibodies and uses

<160>20

<210>1

<211>122

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>1

Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser

1 5 10 15

Glu Thr Leu Ser Leu Ile Cys Thr Val Ser Gly Gly Ser Ile Thr

20 25 30

Ser Tyr Tyr Trp Thr Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu

35 40 45

Glu Trp Ile Gly Tyr Ile Tyr Tyr Asn Gly Ser Ser Asn Tyr Asn

50 55 60

Pro Ser Leu Glu Ser Arg Val Thr Ile Ser Val Asp Ala Ser Lys

65 70 75

Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr

80 85 90

Ala Val Tyr Tyr Cys Ala Thr Asp Tyr Tyr Asp Ser Ser Gly Tyr

95 100 105

Arg Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val

110 115 120

Ser Ser

<210>2

<211>107

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>2

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Leu

1 5 10 15

Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser

20 25 30

Gly Trp Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Met

35 40 45

Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile

65 70 75

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln

80 85 90

Ala Asn Ser Phe Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu

95 100 105

Ile Lys

<210>3

<211>119

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>3

Arg Gly Pro Gly Asn Gly Val Trp Ala Glu Val Lys Lys Pro Gly

1 5 10 15

Ser Ser Val Lys Val Ser Cys Lys Thr Ser Gly Gly Thr Phe Ser

20 25 30

Ser Tyr Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

35 40 45

Glu Trp Met Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr

50 55 60

Ala Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser

65 70 75

Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp

80 85 90

Thr Ala Val Tyr Tyr Cys Ala Ser Phe Gly Ser Leu Trp Asp Leu

95 100 105

Arg Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

110 115

<210>4

<211>107

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>4

Glu Ser Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro

1 5 10 15

Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser

20 25 30

Ser Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro

35 40 45

Arg Leu Leu Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75

Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln

80 85 90

Gln Tyr Gly Thr Ser Arg Thr Phe Gly Gly Gly Thr Lys Val Glu

95 100 105

Ile Lys

<210>5

<211>122

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>5

Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly

1 5 10 15

Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser

20 25 30

Ser Phe Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

35 40 45

Glu Trp Val Ser Val Ile Ser Ser Ser Gly Asp Tyr Thr Ser Tyr

50 55 60

Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser

65 70 75

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu

75 80 85

Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asp Val Gly Ser Arg Leu

90 95 100

Ile Tyr Asp Val Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr

105 110 115

Val Ser Ser

120

<210>6

<211>108

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>6

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val

1 5 10 15

Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Arg

20 25 30

Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys

35 40 45

Leu Leu Met Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

65 70 75

Asn Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln

80 85

Gln Ser Tyr Ser Thr Pro Pro Tyr Ser Phe Gly Gln Gly Thr Lys

90 95 100

Leu Glu Ile Lys

105

<210>7

<211>118

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>7

Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr

1 5 10 15

Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu

20 25

Asn Thr Ser Gly Met Ser Val Ser Trp Ile Arg Gln Pro Pro Gly

30 35 40

Lys Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp

45 50 55

Lys Tyr Tyr Ser Thr Ser Leu Lys Thr Arg Leu Ser Ile Ser Lys

60 65 70

Asp Thr Ser Lys Asn Gln Val Val Leu Thr Met Thr Asn Val

75 80 85

Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Thr Arg Thr Ala Thr

90 95 100

Val Val Lys Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

105 110 115

Ser

<210>8

<211>107

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>8

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val

1 5 10 15

Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr Ile Ser

20 25 30

Arg Tyr Leu Asn Trp Tyr Gln Gln Arg Pro Gly Lys Ala Pro Lys

35 40 45

Leu Leu Ile Tyr Ile Ala Ser Asn Leu Gln Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

65 70 75

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln

80 85 90

Ser Tyr Ser Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu

95 100 105

Ile Lys

<210>9

<211>119

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>9

Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr

1 5 10 15

Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu

20 25

Asn Thr Ser Gly Met Cys Val Ser Trp Ile Arg Gln Pro Pro Gly

30 35 40

Lys Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Glu Lys

45 50 55

Tyr Tyr Ser Thr Ser Leu Gln Thr Arg Leu Thr Ile Ser Lys Asp

60 65 70

Thr Ser Lys Asn Gln Val Val Leu Thr Met Thr Asn Met Asp

75 80 85

Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Met Ile Pro Ile

90 95 100

Pro Ala Leu Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

105 110 115

Ser

<210>10

<211>107

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>10

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Thr Ser Val

1 5 10 15

Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser

20 25 30

Arg Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys

35 40 45

Leu Leu Ile Tyr Thr Ala Ser Ser Leu Gln Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asn Phe Thr Leu Thr Ile

65 70 75

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Phe Tyr Cys Gln Gln

80 85 90

Ser Tyr Ser Thr Pro His Thr Phe Gly Gln Gly Thr Lys Leu Glu

95 100 105

Ile Lys

<210>11

<211>120

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>11

Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr

1 5 10 15

Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser

20 25 30

Thr Ser Gly Met Cys Val Ser Trp Ile Arg Gln Pro Pro Gly Lys

35 40 45

Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Tyr

50 55 60

Tyr Ser Thr Ser Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr

65 70 75

Ser Lys Asn Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val

80 85 90

Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Glu Glu Ala Ala Gly Thr

95 100 105

Lys Leu Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

110 115 120

<210>12

<211>107

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>12

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val

1 5 10 15

Gly Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Ile Arg

20 25 30

Val Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys

35 40 45

Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

65 70 75

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln

80 85 90

Ser Tyr Ser Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu

95 100 105

Ile Lys

<210>13

<211>123

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>13

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly

1 5 10 15

Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser

20 25 30

Thr Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

35 40 45

Val Trp Val Ala Phe Ile Ser Tyr Asp Glu Ser Asn Lys Tyr Tyr

50 55 60

Thr Asp Ser Val Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ser

65 70 75

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu

80 85

Asp Thr Ala Val Tyr Tyr Cys Ala Gly Gly Gly Val Leu Val Thr

90 95 100

Ser Asp Pro Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Met Val

105 110 115

Thr Val Ser Ser

120

<210>14

<211>110

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>14

Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly

1 5 10 15

Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly

20 25 30

Ser Asn Ser Val Asn Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro

35 40 45

Lys Phe Phe Met Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala

65 70 75

Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala

80 85 90

Ala Trp Asp Asp Ser Leu Asn Gly Trp Val Phe Gly Gly Gly

95 100

Thr Lys Leu Thr Val Leu

105 110

<210>15

<211>127

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>15

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly

1 5 10 15

Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser

20 25 30

Ser Tyr Val Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

35 40 45

Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr

50 55 60

Ala Asp Ser Val Lys Gly Arg Ser Thr Ile Ser Arg Asp Asn Ser

65 70 75

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu

80 85

Asp Thr Ala Val Tyr Tyr Cys Ala Lys Arg Gly Gly Thr Tyr Cys

90 95 100

Ser Gly Gly Ile Cys Tyr Gly Gly Tyr Phe Asp Tyr Trp Gly Gln

105 110 115

Gly Met Leu Val Thr Val Ser Ser

120 125

<210>16

<211>111

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>16

Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly

1 5 10 15

Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly

20 25 30

Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala

35 40 45

Pro Lys Leu Met Ile Tyr Asp Val Thr Glu Arg Pro Ser Gly Val

50 55 60

Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu

65 70 75

Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys

80 85 90

Ser Ser Phe Thr Ser Ser Ser Thr Pro Tyr Val Phe Gly Thr Gly

95 100 105

Thr Lys Val Thr Val Leu

110

<210>17

<211>128

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>17

Gln Val Gln Leu Val Glu Ser Gly Gly Asp Val Val Gln Pro Gly

1 5 10 15

Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser

20 25 30

Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

35 40 45

Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr

50 55 60

Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser

65 70 75

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Val Glu

80 85

Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asp Pro Thr Ser Leu Tyr

90 95 100

Cys Ser Gly Gly Ser Cys Tyr Asn Asn Trp Phe Asp Pro Trp

105 110 115

Gly Gln Gly Thr Leu Val Thr Val Ser Ser

120 125

<210>18

<211>107

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>18

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val

1 5 10 15

Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser

20 25 30

Arg Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn

35 40 45

Leu Leu Ile Tyr Ala Ala Ala Ser Leu Gln Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

65 70 75

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln

80 85 90

Thr Tyr Ser Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu

95 100 105

Ile Lys

<210>19

<211>119

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>19

Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser

1 5 10 15

Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser

20 25 30

Ser Phe Tyr Trp Ser Trp Ile Arg Gln Pro Ala Gly Lys Gly Leu

35 40 45

Glu Trp Ile Gly Arg Met Ser Ala Ser Gly Ser Thr Asn Tyr Asn

50 55 60

Pro Ser Leu Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Glu

65 70 75

Asn Gln Ile Ser Leu Lys Leu Gly Ser Val Thr Ala Ala Asp Thr

80 85 90

Ala Val Tyr Tyr Cys Ala Gly Glu Gln His Ile Val Thr Thr Ile

95 100 105

Ile Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

110 115

<210>20

<211>110

<212>PRT

<213> Artificial sequence (Artificial Sequence)

<400>20

Gln Ser Val Leu Thr Gln Pro Leu Ser Ala Ser Gly Thr Pro Gly

1 5 10 15

Gln Arg Val Thr Ile Ser Cys Ser Gly Lys Ser Ser Asn Ile Gly

20 25 30

Ser Asn Thr Val Asn Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro

35 40 45

Lys Leu Leu Ile Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala

65 70 75

Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala

80 85 90

Thr Trp Asp Asp Ser Leu Asn Gly Arg Val Phe Gly Gly Gly

95 100

Thr Lys Leu Thr Val Leu

105 110

Claims

SARS-CoV-2RBD specific monoclonal antibody, characterized by that the heavy chain variable region amino acid sequence is shown in SEQ ID NO. 1; the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 2.
SARS-CoV-2RBD specific monoclonal antibody, characterized by that the heavy chain variable region amino acid sequence is shown in SEQ ID NO. 9; the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 10.