CN114908146A

CN114908146A - Method for rapidly detecting and judging alcohol content by gene

Info

Publication number: CN114908146A
Application number: CN202210608204.8A
Authority: CN
Inventors: 何荣军; 王堃
Original assignee: Inton Health Technology Suzhou Co Ltd
Current assignee: Inton Health Technology Suzhou Co Ltd
Priority date: 2022-05-31
Filing date: 2022-05-31
Publication date: 2022-08-16

Abstract

The invention discloses a method for judging alcohol content by rapid gene detection, which relates to the technical field of nucleic acid detection and comprises the following steps: sample lysis: adding the sample into the lysis solution, and fully mixing to obtain a lysis sample; adding the reagent A into a qPCR reaction tube, adding a cracking sample, and uniformly mixing; amplification: putting the obtained qPCR reaction tube into qPCR equipment to react according to a PCR program; collecting a detection result on a qPCR instrument to obtain gene data of a sample, formatting the obtained gene data, and inputting the formatted data into a liquor capacity judgment model constructed in advance to obtain a liquor capacity judgment conclusion of gene detection; the PCR amplification system comprises a primer of a target gene related to the wine volume. The invention can finish gene detection to judge the wine volume in a very short time based on a rapid gene detection method and a wine volume judgment model constructed in advance, and lays a foundation for the commercial service application of the technology.

Description

Method for rapidly detecting and judging alcohol content by gene

Technical Field

The invention relates to the technical field of nucleic acid detection, in particular to a method for rapidly detecting genes and judging the alcohol content.

Background

Wine is one of the main beverages in human life. The Chinese liquor has long history, various varieties, and high reputation. Yellow wine is one of the oldest wines in the world, and is originally created by Chinese in the period of business week by more than three thousand years, and a large amount of yellow wine is brewed. The wine permeates the whole civilization history of five thousand years in China, and plays an important role in the life of Chinese people from the aspects of literature and art creation, cultural entertainment, diet cooking, health preservation and health care and the like.

However, it is known that excessive drinking often causes health risks and accidental injuries, and therefore, it becomes important to know the amount of wine in an individual, not rainy, and not rainy, in China where wine culture prevails.

In humans, two genes, ADH1B and ALDH2, are the codes for determining the amount of alcohol. The ADH1B and ALDH2 genes are responsible for controlling the decomposition amount of enzyme in human body, namely determining the speed of converting ethanol into acetaldehyde and converting acetaldehyde into acetic acid in the body. If the ethanol is not decomposed fast enough, the ethanol can enter blood and affect the brain of people, and the cause is dizziness and headache after drinking; however, acetaldehyde is not decomposed fast enough, so people can regurgitate and vomit, and is also the reason for drinking wine and flushing, and more seriously, acetaldehyde can kill liver cells of people, and if the acetaldehyde is stimulated for a long time, cirrhosis and even liver cancer are easily caused. Therefore, the alcohol capacity of a person is not good enough, and from the biological point of view, the conversion rate of ethanol to acetaldehyde and the conversion rate of acetaldehyde to acetic acid are not high enough. The mutation rates of Asian ADH1B gene and ALDH2 gene are high, and it is unlikely that both of them will mutate at the same time, therefore, the difference in alcohol content between individuals is considerable. By detecting the mutant types of the two genes through nucleic acid, the potential alcohol capacity of a person can be judged at the gene level.

The substance for nucleic acid detection is genetic material carried in a sample, and nucleic acid detection is currently applied to diagnosis of various genetic diseases and judgment of whether a sample is infected with a virus carrying a specific recognizable genetic material. Another relatively new field of application is the use of nucleic acid detection to determine certain characteristics or capabilities of an individual to be tested. Whether the nucleic acid is used commercially or in medical use, the detection of the nucleic acid needs to be completed in a short time to obtain a result.

Traditional nucleic acid detection methods, such as chip detection, DNA sequencing and the like, need to be performed in a central laboratory, and need to follow strict experimental steps, which generally takes more than 12 hours, and some even one week; the conventional qPCR technique also requires about 2 hours to complete the detection, and the steps of DNA extraction, centrifugation, shaking, etc. need to be performed on the sample (these steps need to use additional special equipment, such as a centrifuge, etc.). Due to the urgent global situation, people have an increasing interest in rapid nucleic acid detection, and some methods for completing detection in a short time, such as loop-mediated isothermal amplification (LAMP) technology, have been developed, but the current nucleic acid detection technology generally has some or all of the following problems: firstly, the detection time is long: the sequencing or chip sequencing requires variable time periods ranging from 12 hours to 1 week; conventional qPCR takes about 2 hours; secondly, the constant temperature amplification technology has the following problems: 1) the accuracy rate is low, and is about 80% on average, and although the accuracy rate has no fatal influence on the commercial detection of common properties, the error of the accuracy rate cannot be tolerated once the accuracy rate is used for infectious disease detection; 2) the resolution is low, the single base resolution is difficult to achieve, and is generally more than 10 bp; thirdly, the requirement on the operating environment is high: conventional sequencing and qPCR require extraction, centrifugation, purification and other steps on a sample, are carried out in a qPCR laboratory, and need to be contacted with related equipment operation; fourthly, the requirement of personnel is high: because the operation is carried out under the severe environment, the operation personnel is qualified.

That is, the prior art does not provide a method for detecting nucleic acid which is truly rapid and accurate.

Disclosure of Invention

In order to solve the problems, the invention provides a method for judging the potential alcohol content through gene detection, which can improve the detection speed and ensure the accuracy of the detection result, and the specific scheme is as follows:

a method for rapidly detecting genes to judge the alcohol content comprises the following steps:

s1, sample cracking: adding the sample into the lysis solution, and fully mixing to obtain a lysis sample;

s2, adding the reagent A into a qPCR reaction tube, adding the lysis sample into the qPCR reaction tube, and uniformly mixing;

s3, amplification: putting the obtained qPCR reaction tube into qPCR equipment to react according to a PCR program;

s4, collecting the detection result on a qPCR instrument to obtain gene data of the sample, and judging the wine capacity of the sample according to the corresponding relation between the gene data and the wine capacity;

the PCR amplification system comprises a primer of a target gene related to the wine volume.

Preferably, the step S4 of judging the alcohol content of the sample according to the correspondence between the gene data and the alcohol content specifically includes: formatting the obtained gene data, and inputting the formatted data into a liquor volume judgment model constructed in advance to obtain a conclusion of liquor volume judgment through gene detection;

the construction method of the alcohol content judgment model comprises the following steps:

s01, acquiring the relation between the drinking capacity and the drinking amount of the sample, and establishing a database;

s02, acquiring gene data of the sample and formatting the gene data;

and S03, selecting a machine learning model according to the gene data of the formatted sample and the database, and constructing a drinking capacity judgment model for judging the drinking capacity based on the sample gene data.

Preferably, the method of acquiring genetic data of a sample of S02 includes:

s021, sample lysis: adding the sample into the lysis solution, and fully mixing to obtain a lysis sample;

s022, adding the reagent A into a qPCR reaction tube, adding a lysis sample into the qPCR reaction tube, and uniformly mixing;

s023 and amplification: putting the obtained qPCR reaction tube into qPCR equipment to react according to a PCR program;

s024, collecting a detection result on a qPCR instrument to obtain gene data of a sample;

Wherein, the specific reagents and parameters of the steps S021, S022, S023 and S024 are the same as those of the steps with corresponding names and the reagents and the corresponding parameters of the steps S1-S4 (S021 corresponds to S1, S022 corresponds to S2, and so on).

Preferably, the target gene related to the wine volume comprises an rs1229984 gene locus and an rs671 gene locus, wherein the rs1229984 gene locus is positioned on an ADH1B gene, and when the result of the rs1229984 gene locus is TT type, the alcohol dehydrogenase activity is strong, and the alcohol metabolism is fast; the results show that the activity of the ethanol dehydrogenase is moderate in the CT type, and the metabolism speed of the ethanol is moderate; the result shows that the activity of the alcohol dehydrogenase is weak in the CC type, and the metabolism speed of the alcohol is slow; the rs671 gene locus is positioned on an ALDH2 gene, and the result of the rs671 gene locus is that acetaldehyde dehydrogenase activity is strong and acetaldehyde metabolism is fast when GG type genes are adopted; as a result, the activity of acetaldehyde dehydrogenase was weak in GA \ AA type, and acetaldehyde metabolism was slow.

It is known that the liver metabolizes alcohol mainly by the following 3 steps:

the first step is as follows: ethanol → acetaldehyde: alcohol, chemically known as ethanol, has small molecules and readily passes through the intestinal wall and into the blood vessels, which mainly pool in the liver. Therefore, alcohol consumed is almost always transported to the liver, and is converted into acetaldehyde by the action of alcohol dehydrogenase.

The second step is that: acetaldehyde → acetic acid: ethanol is processed by primary processing of liver to produce a large amount of acetaldehyde, which is converted into acetic acid under the action of acetaldehyde dehydrogenase.

The third step: acetic acid → carbon dioxide and water: acetic acid enters the biochemical reaction of tricarboxylic acid cycle, and is finally converted into carbon dioxide and water and discharged out of the body.

Alcohol enters the body, is finally metabolized into carbon dioxide and water, and is discharged out of the body, and the function of detoxification of the liver is indispensable. However, some people do not wake up after drinking one cup, while some people can do not wake up after drinking one cup, and the difference of the drinking amount is the key point of the acetaldehyde dehydrogenase. Because, in different humans, the acetaldehyde dehydrogenase content varies.

The difference of the wine capacity is the second step. In persons with a relative deficiency of acetaldehyde dehydrogenase, acetaldehyde is not converted to acetic acid and accumulates in the body. This herb is more toxic than alcohol and is a primary carcinogen, which can cause telangiectasia and produce discomfort such as flushing, palpitation, nausea, etc. People relatively rich in acetaldehyde dehydrogenase can quickly metabolize acetaldehyde into non-toxic acetic acid, decompose acetaldehyde into carbon dioxide and discharge the carbon dioxide and water out of the body. The talent is really 'big in wine amount' and not easy to get drunk. So those who "drink blush" are not too much, but rather, their acetaldehyde dehydrogenase may be relatively deficient and more intoxicated.

Based on the above general knowledge, preferably, one method of judging the alcohol amount (segmentation) based on the genotype is:

when the result of the rs671 gene locus is GG and the result of the rs1229984 gene locus is CT, the wine volume is set as 1 segment; when the result of the rs671 gene locus is GG and the result of the rs1229984 gene locus is TT, the wine volume is set to 2 segments; when the result of the rs671 gene locus is GG and the result of the rs1229984 gene locus is CC, the wine capacity is set as 3 segments; when the result of the rs671 gene site is AG and the result of the rs1229984 gene site is CT \ TT, the wine capacity is set to be 4 segments; when the result of the rs671 gene locus is AG and the result of the rs1229984 gene locus is CC, the wine capacity is set as 5 segments; when the result of the rs671 gene locus is AA and the result of the rs1229984 gene locus is CT \ TT, the wine capacity is set as 6 segments; the wine volume is segmented from 1 segment to 6 segments, and the actual wine volume is decreased gradually under similar conditions, wherein the difference between the segments 1 to 2 and 2 to 3 is smaller, the difference between the segments 4 to 5 and 5 to 6 is smaller, and the difference between the

whole segments

1, 2 and 3 and the

whole segments

4, 5 and 6 is larger (the difference between the

segments

3 and 6 is larger).

Preferably, the reagent A of S2 comprises Taq DNApolymerase, Tris-HCl, MgSO ₄ 、dNTP。

Further, the dosage or concentration of each component in the reagent A of S2 is as follows: taq DNApolymerase: 0.5-1.5U; Tris-HCl: 30-50 mM; MgSO (MgSO) ₄ ：2.6-3.1mM；dNTP:0.05-0.4mM。

Preferably, the reagent A of S2 comprises Taq DNApolymerase, Tris-HCl, KCl, MgSO ₄ 、dNTP、BSA。

Further, the dosage or concentration of each component in the reagent A of S2 is as follows: taq DNAPolymerase: 0.5-1.5U; Tris-HCl: 30-50 mM; KCl: 100-120 mM; MgSO (MgSO) ₄ ：2.6-3.1mM；dNTP:0.05-0.4mM；BSA:0.1mg/ml-2mg/ml。

Preferably, the amount of the reagent A used in S2 is 1-1.5% wt of the mass of the lysis sample.

Preferably, the PCR program of S3 comprises: pre-deforming at 95 ℃ for 2min for 1 cycle; 5s at 95 ℃, 30-45s at 60 ℃ and 40 cycles.

Preferably, in the PCR process of S3, qPCR collects the fluorescence signal at a stage of 60 ℃.

Preferably, the fluorescence signal is collected, and the collected fluorescence amplification signal comprises FAM, VIC, and CY5, with the internal reference ROX.

Preferably, in the PCR process of S3, the temperature-rising rate is 6-8 ℃/S and the temperature-lowering rate is 4-6 ℃/S after the program is started.

Preferably, the sample of S1 includes food samples, dust, sundries and other articles, and oral swabs, saliva, biological tissues and other samples.

Preferably, the intimately mixing of S1 comprises: shaking vigorously for 5-10 times or mixing with vortex for 5-10s, standing for 5-10s, and shaking vigorously for 5-10 times or mixing with vortex for 5-10 s.

Preferably, the lysate of S1 is used after being heated to 35-39 ℃ in a water bath.

Preferably, the amount of the lysis solution of S1 is based on the sample, and more preferably, the volume of the lysis solution is 3 to 5 times of the sample volume.

Preferably, the lysis solution of S1, comprising: SDS, tris (hydroxymethyl) aminomethane, DTC.

Further, the concentration of each component of the lysis solution is as follows: SDS (sodium dodecyl sulfate): 0.4-1% wt; tris (hydroxymethyl) aminomethane: 0.3M-0.5M; DTC: 30mM-100 mM.

Preferably, before S3, reagent B is further added to the qPCR reaction tube, and reagent B includes lysine, 2, 5-dimercapto-134-thiadiazole, and arginine.

Preferably, in the reagent B, the mass ratio of lysine, 2, 5-dimercapto-134-thiadiazole and arginine is (2-3): (0.05-0.1): (2.5-3).

Preferably, the amount of reagent B is 1.9-2.1% wt of the mass of the lysed sample.

Advantageous effects

The invention has the beneficial effects that:

nucleic acid detection is currently basically operated in a central laboratory, the application scenario is limited, the nucleic acid detection is mainly used for medical treatment, and the nucleic acid detection is greatly limited in the field of rapid real-time outdoor detection or commercial use.

The invention provides the method for breaking through the central laboratory limit and the detection time limit and enabling the nucleic acid detection to serve more industries and scenes, and particularly, the invention optimizes the reagent formula particularly for the wine volume detection, so that the obtained formula has more excellent performance (higher resolution accuracy reaching more than 99%) in the aspect of detection of the wine volume related genes, and can directly obtain the wine volume judgment result in a very short time after the gene detection is quickly completed by matching with a judgment model for realizing training, thereby providing a technical basis for related commercial services. The invention realizes the breakthrough of the following effects:

1. the detection period is short and is finished in about 25 minutes;

2. nucleic acid detection with high detection resolution and single base resolution:

3. the accuracy is high and can reach 100%:

4. the operation is simple, a central laboratory is not needed, and the requirement on operators is low.

According to the invention, by adopting the specific reagent A, the lysate and the reagent B, the influence effect of various substances which have influence on the amplification result in the lysed sample is effectively eliminated (the substances are not eliminated, but the influence is eliminated), the nucleic acid detection can be finished at high accuracy even if the nucleic acid extraction is not carried out, the time for nucleic acid detection is greatly saved (at least over half an hour is saved), and the application of the nucleic acid detection in the field detection and the commercial field has more possibility.

Drawings

FIGS. 1-1 to 1-8 are amplification curves for 8 samples listed in example 1, respectively;

FIGS. 2-1 to 2-4 are amplification curves of 4 samples listed in example 2 (the samples listed are the same as those of FIGS. 1-1 to 1-4 in example 1), respectively;

FIGS. 3-1 to 3-4 are amplification curves of 4 samples listed in example 3 (the same samples as those of FIGS. 1-1 to 1-4 in example 1), respectively;

FIGS. 4-1 to 4-4 show the amplification curves of 4 samples listed in example 4 (the samples listed are the same as those of FIGS. 1-1 to 1-4 in example 1).

Detailed Description

The following embodiments of the present invention are provided by way of specific examples, and other advantages and effects of the present invention will be readily apparent to those skilled in the art from the disclosure herein. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The following examples and comparative examples are parallel runs, with the same processing steps and parameters, unless otherwise indicated.

Preparation of a reagent:

reagent A-0

Taq DNAPolymerase：1.5U；Tris-HCl：50mM；MgSO ₄ ：3.1mM；dNTP:0.4mM。

Reagent A-1

Taq DNAPolymerase：0.5U；Tris-HCl：30mM；KCl：100mM；MgSO ₄ ：2.6mM；dNTP:0.05mM；BSA:0.1mg/ml。

Reagent A-2

Taq DNAPolymerase：1.5U；Tris-HCl：50mM；KCl：120mM；MgSO ₄ ：3.1mM；dNTP:0.4mM；BSA:2mg/ml。

Reagent A-3

Taq DNAPolymerase：1.5U；Tris-HCl：30mM；KCl：120mM；MgSO ₄ ：2.6mM；dNTP:0.4mM；BSA:2mg/ml。

Reagent A-4

Taq DNAPolymerase：1.5U；Tris-HCl：50mM；KCl：100mM；MgSO ₄ ：3.1mM；dNTP:0.4mM；BSA:2mg/ml。

Reagent A-5 (comparative)

Taq DNAPolymerase：1.5U；Tris-HCl：20mM；KCl：100mM；MgSO ₄ ：3.1mM；dNTP:0.4mM；BSA:2mg/ml。

Reagent A-6 (comparative)

Taq DNAPolymerase：1.5U；Tris-HCl：60mM；KCl：100mM；MgSO ₄ ：3.1mM；dNTP:0.4mM；BSA:2mg/ml。

Reagent A-7 (comparative)

Taq DNAPolymerase：1.5U；Tris-HCl：50mM；KCl：100mM；MgSO ₄ ：2.4mM；dNTP:0.4mM；BSA:2mg/ml。

Reagent A-8 (comparison)

Taq DNAPolymerase：1.5U；Tris-HCl：50mM；KCl：100mM；MgSO ₄ ：3.3mM；dNTP:0.4mM；BSA:2mg/ml。

Reagent A-9 (comparative)

Taq DNAPolymerase：1.5U；Tris-HCl：50mM；KCl：90mM；MgSO ₄ ：3.1mM；dNTP:0.4mM；BSA:2mg/ml。

Reagent A-10 (comparative)

Taq DNAPolymerase：1.5U；Tris-HCl：50mM；KCl：130mM；MgSO ₄ ：3.1mM；dNTP:0.4mM；BSA:2mg/ml。

Lysate a

SDS (sodium dodecyl sulfate): 0.4% wt; tris (hydroxymethyl) aminomethane: 0.3M; DTC: 30 mM.

Lysis solution b

SDS (sodium dodecyl sulfate): 1% wt; tris (hydroxymethyl) aminomethane: 0.5M; DTC: 100 mM.

Lysate c

SDS (sodium dodecyl sulfate): 1% wt; tris (hydroxymethyl) aminomethane: 0.3M; DTC: 100 mM.

Lysate d

SDS (sodium dodecyl sulfate): 0.4 percent; tris (hydroxymethyl) aminomethane: 0.5M; DTC: 100 mM.

Lysate e (comparison)

SDS (sodium dodecyl sulfate): 0.3 percent; tris (hydroxymethyl) aminomethane: 0.5M; DTC: 100 mM.

Lysate f (comparison)

SDS (sodium dodecyl sulfate): 1.2 percent; tris (hydroxymethyl) aminomethane: 0.5M; DTC: 100 mM.

Lysate g (comparative)

SDS (sodium dodecyl sulfate): 0.4 percent; tris (hydroxymethyl) aminomethane: 0.2M; DTC: 100 mM.

Lysate h (comparative)

SDS (sodium dodecyl sulfate): 0.4 percent; tris (hydroxymethyl) aminomethane: 0.6M; DTC: 100 mM.

Lysate i (comparative)

SDS (sodium dodecyl sulfate): 0.4 percent; tris (hydroxymethyl) aminomethane: 0.5M; DTC: 120 mM.

Lysate j (comparative)

SDS (sodium dodecyl sulfate): 0.4 percent; tris (hydroxymethyl) aminomethane: 0.5M; DTC: 20 mM.

Preparation work: constructing a liquor volume judgment model:

s02, acquiring gene data of the sample and formatting the gene data;

S02 the method of obtaining genetic data of a sample, comprising:

s022, adding the reagent A into a qPCR reaction tube, adding a primer probe of a target gene related to the wine capacity into the qPCR reaction tube, adding a lysis sample into the qPCR reaction tube, and uniformly mixing;

The reagent A comprises Taq DNApolymerase, Tris-HCl and MgSO ₄ 、dNTP。

Further, the dosage or concentration of each component in the reagent A is as follows: taq DNApolymerase: 0.5-1.5U; Tris-HCl: 30-50 mM; MgSO (MgSO) in vitro ₄ ：2.6-3.1mM；dNTP:0.05-0.4mM。

The reagent A may further comprise Taq DNApolymerase, Tris-HCl, KCl, MgSO ₄ 、dNTP、BSA。

Further, the dosage or concentration of each component in the reagent A is as follows: taq DNApolymerase: 0.5-1.5U; Tris-HCl: 30-50 mM; KCl: 100-120 mM; MgSO (MgSO) ₄ ：2.6-3.1mM；dNTP:0.05-0.4mM；BSA:0.1mg/ml-2mg/ml。

The dosage of the reagent A is 1-1.5 wt% of the mass of the cracking sample.

The PCR program comprises: pre-deforming at 95 ℃ for 2min for 1 cycle; 5s at 95 ℃, 30-45s at 60 ℃ and 40 cycles.

In the PCR process, qPCR collects fluorescent signals at a 60 ℃ stage.

The fluorescence signal is collected, and the collected fluorescence amplification signal comprises FAM, VIC and CY5, and the internal reference is ROX.

In the PCR process, the temperature rising rate is 6-8 ℃/s and the temperature reduction rate is 4-6 ℃/s after the program is started.

The samples include food samples, dust, debris, and other item samples, as well as buccal swabs, saliva, biological tissue, and other samples.

The intensive mixing comprises the following steps: shaking vigorously for 5-10 times or mixing with vortex for 5-10s, standing for 5-10s, and shaking vigorously for 5-10 times or mixing with vortex for 5-10 s.

The lysis solution can be used after being heated to 35-39 ℃ in a water bath.

The amount of the lysis solution is based on the sample, and the volume of the lysis solution is more preferably 3 to 5 times of the volume of the sample.

The lysis solution comprises: SDS, tris (hydroxymethyl) aminomethane, DTC.

The concentration of each component of the lysis solution is as follows: SDS (sodium dodecyl sulfate): 0.4-1% wt; tris (hydroxymethyl) aminomethane: 0.3M-0.5M; DTC: 30mM-100 mM.

The method can also comprise the following steps:

before amplification, a reagent B is added into the qPCR reaction tube, wherein the reagent B comprises lysine, 2, 5-dimercapto-134-thiadiazole and arginine.

In the reagent B, the mass ratio of lysine, 2, 5-dimercapto-134-thiadiazole and arginine is (2-3): (0.05-0.1): (2.5-3).

The dosage of the reagent B is 1.9-2.1% wt of the mass of the cracking sample.

In the process of judging the alcohol content based on the model, the method for acquiring the gene data of the sample in the model construction process is the same as the method for judging the corresponding steps in the alcohol content based on the model rapid gene detection in the next step, namely: S021-S024 and S1-S4 in the following text adopt the same gene, the same steps and the same parameters, the steps and the parameters are all within the range limited by the invention, and detection is carried out on different genes by adopting a primer or an amplification system, and a corresponding model is reconstructed.

The embodiment is based on a liquor capacity judging model constructed by preparation work, and the liquor capacity is judged by rapid gene detection:

s1, sample lysis: adding the sample into the lysis solution, and fully mixing to obtain a lysis sample;

s2, adding the reagent A into a qPCR reaction tube, adding a primer probe of a target gene related to the wine volume into the qPCR reaction tube, adding a lysis sample into the qPCR reaction tube, and uniformly mixing;

S4, judging the sample alcohol content according to the corresponding relation between the gene data and the alcohol content, which specifically comprises the following steps: formatting the obtained gene data, and inputting the formatted data into a wine capacity judgment model constructed in advance to obtain a conclusion of the wine capacity judgment by gene detection.

The reagent A comprises Taq DNAPolymerase、Tris-HCl、MgSO ₄ 、dNTP。

Further, the dosage or concentration of each component in the reagent A is as follows: taq DNAPolymerase: 0.5-1.5U; Tris-HCl: 30-50 mM; MgSO (MgSO) ₄ ：2.6-3.1mM；dNTP:0.05-0.4mM。

The dosage of the reagent A is 1-1.5 wt% of the mass of the cracking sample.

In the PCR process, qPCR collects fluorescent signals at a 60 ℃ stage.

The lysis solution can be used after being heated to 35-39 ℃ in a water bath.

The lysis solution comprises: SDS, tris (hydroxymethyl) aminomethane, DTC.

The method can also comprise the following steps:

The dosage of the reagent B is 1.9-2.1% wt of the mass of the cracking sample.

In the process of judging the alcohol content based on the model, the method for acquiring the gene data of the sample in the model construction process is the same as the method for judging the alcohol content based on the model rapid gene detection in the next step, namely: S021-S024 and S1-S4 adopt the same gene, the same steps and the same parameters, the steps and the parameters are all within the range limited by the invention, and the corresponding model is reconstructed when the detection is carried out by adopting a primer or an amplification system aiming at different genes.

Example 1 method for determining alcohol content by rapid gene detection of specific genes within the above range: the target genes related to the wine volume are rs1229984 gene locus and rs671 gene locus, and the sequences of the primer probes are as follows:

rs1229894-F	ACACAATTTCAGGAATTTGGGTATG
			rs1229894-R	TCACCAGGTTGCCACTAACCA
rs1229894-P1-C	TGGTCATCTGTGCGACAGATTCCTACAG	5’FAM；3’TAMRA
			rs1229894-P2-T	TGGTCATCTGTGTGACAGATTCCTACAG	5’VC；3’TAMRA
rs671-F	GGGAGTTGGGCGAGTACG
			rs671-R	AGACCCTCAAGCCCCAACAG
rs671-P1-G	CAGGCATACACTGAAGTGAAAACTG	5’ROX；3’BHQ1
			rs671-P2-A	CAGGCATACACTAAAGTGAAAACTG	5’CY5；3’BHQ2

reagent A-0.

The amount of reagent A is 1.5% wt of the mass of the lysed sample.

In the PCR process, the temperature rise rate is 8 ℃/s and the temperature drop rate is 6 ℃/s after the program is started.

The full mixing comprises the following steps: vortex mixing for 5-10s, standing for 5-10s, and vortex mixing for 5-10 s.

The amount of lysate added was 5 times the volume of the sample solution.

Lysate d.

In the process of judging the alcohol content based on the model, the method for acquiring the gene data of the sample in the model construction process is the same as the method for judging the corresponding steps in the alcohol content based on the model rapid gene detection in the next step, namely: S021-S024 and S1-S4 adopt the same gene, the same steps and the same parameters, the steps and the parameters are all within the range limited by the invention, and a corresponding model is reconstructed when the detection is carried out by adopting a primer or an amplification system aiming at different genes.

Table 1 example 1 lists the actual test effect data of 7 samples of known genotypes:

example 1 the number of samples 1500 were tested, all samples were control samples with accurate genotype by sequencing, and the test results were all correct with an accuracy of 100%. The invention only lists specific detection results of 4 samples, and the detailed results are shown in table 1 and fig. 1-1 to fig. 1-8: the method comprises the following steps of adopting four channels of FAM/VIC/ROX/CY5, judging the genotype of the FAM/VIC/ROX/CY5 by respectively corresponding to C/T/G/A genotypes, wherein corresponding to rs1229984 loci, judging the genotype to be CC when the FAM channel has a reading and the VIC channel does not have a reading (NA), judging the genotype to be TT when the FAM channel does not have a reading and the VIC channel has a reading, and judging the genotype to be CT when the FAM channel has a reading and the VIC channel has a reading; corresponding to the locus of the rs671 gene, when the ROX channel has a reading and the CY5 channel has no reading (NA), the genotype is judged to be GG, when the ROX channel has no reading (NA) and the CY5 channel has a reading, the genotype is judged to be AA, when the ROX channel has a reading and the CY5 channel has a reading, the genotype is judged to be AG. The total time for each sample was about 23-25 min.

Example 2 method for determining alcohol content by rapid gene detection of specific genes within the above range: the target genes related to the wine volume are rs1229984 gene locus and rs671 gene locus, and the sequences of the primer probes are as follows:

and (3) a reagent A-4.

Reagent A was used at 1.5% wt of the mass of the lysed sample.

The amount of lysate added was 5 times the volume of the sample solution.

Lysate d.

Table 2 example 2 lists the actual test effect data of 4 samples of known genotypes:

example 2 the number of samples 1500 was determined, all samples were control samples of known accurate genotypes (samples were the same as in example 1), and the results were all correct with an accuracy of 100%. The invention only lists specific detection results of 4 samples, and the detailed results are shown in table 2 and fig. 2-1 to fig. 2-4: the method comprises the following steps of adopting four channels of FAM/VIC/ROX/CY5, judging the genotype of the FAM/VIC/ROX/CY5 by respectively corresponding to C/T/G/A genotypes, wherein corresponding to rs1229984 loci, judging the genotype to be CC when the FAM channel has a reading and the VIC channel does not have a reading (NA), judging the genotype to be TT when the FAM channel does not have a reading and the VIC channel has a reading, and judging the genotype to be CT when the FAM channel has a reading and the VIC channel has a reading; corresponding to the locus of the rs671 gene, when the ROX channel has a reading and the CY5 channel has no reading (NA), the genotype is judged to be GG, when the ROX channel has no reading (NA) and the CY5 channel has a reading, the genotype is judged to be AA, when the ROX channel has a reading and the CY5 channel has a reading, the genotype is judged to be AG. As can be seen from the amplification curve and the specific Ct value, the Ct values of the same sample and under the same conditions are all smaller than those of the sample in example 1, the effect of the sample in example 2 is slightly better than that of the sample in example 1, and the detection effect is optimized to a certain extent by adding potassium chloride and BSA into the reagent A. The total time of each sample is about 23min-25 min.

Example 3 method for determining the amount of alcohol by rapid genetic testing for specific genes within the above range: the target genes related to the wine volume are rs1229984 gene locus and rs671 gene locus, and the sequences of the primer probes are as follows:

and (3) a reagent A-4.

The amount of reagent A is 1.5% wt of the mass of the lysed sample.

The full mixing comprises the following steps: vortex for 5-10s, standing for 5-10s, and vortex for 5-10 s.

The amount of lysis solution added was 5 times the volume of the sample solution.

Lysate d.

The lysate was used after heating to 39 ℃ in a water bath.

In the process of judging the alcohol content based on the model, the method for acquiring the gene data of the sample in the model construction process is the same as the method for judging the corresponding steps in the alcohol content based on the model rapid gene detection in the next step, namely: S021-S024 and S1-S4 adopt the same gene, the same steps and the same parameters, the steps and the parameters are all within the range limited by the invention, and the corresponding model is reconstructed when the detection is carried out by adopting a primer or an amplification system aiming at different genes.

Table 3 example 3 lists the actual test effect data of 4 samples of known genotypes:

example 3 the number of samples 1500 was determined, all samples were control samples of known accurate genotypes (samples identical to those of example 1), and the results were all correct with an accuracy of 100%. The invention only lists specific detection results of 4 samples, and the detailed results are shown in table 3 and fig. 3-1 to fig. 3-4: the method comprises the following steps of adopting four channels of FAM/VIC/ROX/CY5, judging the genotype of the FAM/VIC/ROX/CY5 by respectively corresponding to C/T/G/A genotypes, wherein corresponding to rs1229984 loci, judging the genotype to be CC when the FAM channel has a reading and the VIC channel does not have a reading (NA), judging the genotype to be TT when the FAM channel does not have a reading and the VIC channel has a reading, and judging the genotype to be CT when the FAM channel has a reading and the VIC channel has a reading; corresponding to the locus of the rs671 gene, when the ROX channel has a reading and the CY5 channel has no reading (NA), the genotype is judged to be GG, when the ROX channel has no reading (NA) and the CY5 channel has a reading, the genotype is judged to be AA, when the ROX channel has a reading and the CY5 channel has a reading, the genotype is judged to be AG. As can be seen from the amplification curve and the specific Ct value, the Ct value of the same sample under the same conditions is smaller than that of the sample in example 2, the effect of the sample in example 3 is slightly better than that of the sample in example 2, and the lysate is heated for use, so that the detection effect is optimized to a certain extent. The total time for each sample is about 23min-25 min.

Example 4 method for determining alcohol content by rapid gene detection of specific genes within the above range: the target genes related to the wine volume are rs1229984 gene locus and rs671 gene locus, and the sequences of the primer probes are as follows:

and (4) a reagent A-4.

The amount of reagent A is 1.5% wt of the mass of the lysed sample.

The amount of lysate added was 5 times the volume of the sample solution.

Lysate d.

The lysate was used after heating to 39 ℃ in a water bath.

In the reagent B, the mass ratio of lysine, 2, 5-dimercapto-134-thiadiazole to arginine is 2:0.1: 2.5.

The dosage of the reagent B is 1.9 percent wt of the mass of the cracking sample.

Table 4 example 4 lists the actual test effect data of 4 samples of known genotypes:

example 4 the number of samples 1500 was determined, all samples were control samples of known accurate genotypes (samples identical to those of example 1), and the results were all correct with an accuracy of 100%. The invention only lists specific detection results of 4 samples, and the detailed results are shown in Table 4 and FIGS. 4-1 to 4-4: the method comprises the following steps of adopting four channels of FAM/VIC/ROX/CY5, judging the genotype of the FAM/VIC/ROX/CY5 by respectively corresponding to C/T/G/A genotypes, wherein corresponding to rs1229984 loci, judging the genotype to be CC when the FAM channel has a reading and the VIC channel does not have a reading (NA), judging the genotype to be TT when the FAM channel does not have a reading and the VIC channel has a reading, and judging the genotype to be CT when the FAM channel has a reading and the VIC channel has a reading; corresponding to the locus of the rs671 gene, when the ROX channel has a reading and the CY5 channel has no reading (NA), the genotype is judged to be GG, when the ROX channel has no reading (NA) and the CY5 channel has a reading, the genotype is judged to be AA, when the ROX channel has a reading and the CY5 channel has a reading, the genotype is judged to be AG. As can be seen from the amplification curve and the specific Ct value, the Ct values of the same sample and under the same conditions are all smaller than those of the sample in example 3, the effect of the sample in example 4 is slightly better than that of the sample in example 3, and the detection effect is optimized to a certain extent by adding the reagent B before the lysis. The total time for each sample is about 23min-25 min.

Example 1A-0 lysate d

Example 2A-4 lysate d

EXAMPLE 3 heating of lysate

EXAMPLE 4 addition of reagent b

Comparative example 1:

the difference from example 4 is that: reagent A-5 was used.

Comparative example 2:

the difference from example 4 is that: reagent A-6 was used.

Comparative example 3:

the difference from example 4 is that: reagent A-7 was used.

Comparative example 4:

the difference from example 4 is that: reagent A-8 was used.

Comparative example 5:

the difference from example 4 is that: reagent A-9 was used.

Comparative example 6:

the differences from example 4 are: reagent A-10 was used.

Comparative example 7:

the difference from example 4 is that: lysate e was used.

Comparative example 8:

the difference from example 4 is that: lysis solution f was used.

Comparative example 9:

the difference from example 4 is that: lysate g was used.

Comparative example 10:

the difference from example 4 is that: lysis buffer h was used.

Comparative example 11:

the differences from example 4 are: lysis solution i was used.

Comparative example 12:

the difference from example 4 is that: lysate j was used.

Comparative examples 13, 14, 15, 16:

the differences from comparative examples 1, 3, 5, 12 are:

In the reagent B, the mass ratio of lysine, 2, 5-dimercapto-134-thiadiazole and arginine is (2-3): (0.05-0.1): 2.5-3.

The dosage of the reagent B is 1.9-2.1% wt of the mass of the lysis sample.

Comparative example 17:

the difference from example 4 is that: in the PCR process, the temperature rise rate is 6 ℃/s and the temperature drop rate is 8 ℃/s after the program is started.

Comparative example 18:

the difference from example 4 is that: the lysate was used after heating to 39 ℃ in a water bath.

All comparative examples and all examples used the same 1500 sets of samples.

Tests prove that the effects of the reagents A-2, 3 and 4 have no obvious difference or change trend, but the results are slightly better than those of the reagent A-1; the reagents A-5, 6, 7 and 8 (comparative examples 1, 2, 3 and 4) are adopted, and the detection results of 17 groups of samples, 8 groups of samples, 10 groups of samples and 13 groups of samples in the same 1500 groups of samples are wrong, so that the accuracy is reduced; 6 groups of sample detection results and 3 groups of sample detection results are wrong in 1500 groups of same samples by adopting the reagents A-9 and 10 (comparative examples 5 and 6), so that the accuracy is reduced; however, after reagent B was added (comparative examples 13-15), the results of the 1500 samples were all correct, and the accuracy rate reached 100% again.

The detection results of the lysis solutions b, c and d have no obvious difference and no obvious change trend, but the amplification curve is slightly superior to that of the lysis solution a; the detection results of 12 groups of samples, 7 groups of samples, 9 groups of samples, 15 groups of samples, 11 groups of samples and 6 groups of samples in the same group of 1500 by adopting the lysate e-j (comparative examples 7 to 12) are wrong, the accuracy is reduced, and the defect cannot be compensated by adding the reagent B (the detection results of 8 groups of samples in the same group of 1500 in the comparative example 16 are wrong); meanwhile, the Ct value of the comparative examples 7-12 under the same condition of the amplification curve is larger than that of the example 4, and the detection effect is slightly poor. Comparative example 17 Ct value under the same condition of the amplification curve is larger than that of example 4, and the detection effect is slightly poor. In the comparative example 18, the detection results of 26 samples in the same 1500 and the same samples are wrong, the accuracy is greatly reduced, and the defect cannot be compensated by adding the reagent B; meanwhile, the Ct value of the comparative example 18 under the same condition of the amplification curve is larger than that of the example 4, and the detection effect is slightly poor.

In the conventional gene detection method, DNA in a sample is extracted once and then sequenced according to the conventional method, the time is more than 12 hours, the conventional qPCR is about 2 hours at present, and the accuracy is generally below 85% (89%). The method of the invention is used for quickly detecting two genes related to the wine capacity, and the wine capacity is judged by a model, the whole time consumption is about 23min-27min, the accuracy rate is ensured to be 100%, and the method is suitable for large-scale quick gene detection and has wide application prospect.

While the preferred embodiments and examples of the present invention have been described in detail, the present invention is not limited to the embodiments and examples, and various changes can be made without departing from the spirit of the present invention within the knowledge of those skilled in the art.

Claims

1. A method for rapidly detecting and judging the alcohol content by gene is characterized in that: the method comprises the following steps:

2. The method for determining alcohol content by rapid gene detection according to claim 1, wherein: s4, judging the sample alcohol content according to the corresponding relation between the gene data and the alcohol content, which specifically comprises the following steps: formatting the obtained gene data, and inputting the formatted data into a liquor volume judgment model constructed in advance to obtain a conclusion of liquor volume judgment through gene detection;

s02, acquiring gene data of the sample and formatting the gene data;

3. The method for determining alcohol content by rapid gene detection according to claim 2, wherein: s02 the method of obtaining genetic data of a sample, comprising:

the PCR amplification system comprises a primer of a target gene related to the wine volume; wherein, the specific reagents and parameters of S021, S022, S023 and S024 steps are the same as those of S1-S4.

4. The method for determining the amount of alcohol by rapid genetic testing as claimed in claim 1, wherein: the target gene related to the alcohol content comprises an rs1229984 gene locus and an rs671 gene locus.

5. The method for determining alcohol content by rapid gene detection according to claim 1 or 3, wherein: the reagent A comprises Taq DNA Polymerase, Tris-HCl and MgSO ₄ 、dNTP。

6. The method for determining alcohol content by rapid gene detection according to claim 5, wherein: the dosage or concentration of each component in the reagent A is as follows: taq DNA Polymerase: 0.5-1.5U; Tris-HCl: 30-50 mM; MgSO (MgSO) ₄ ：2.6-3.1mM；dNTP:0.05-0.4mM。

7. Rapid as claimed in claim 1 or 3The method for judging the wine capacity by gene detection is characterized by comprising the following steps: the reagent A comprises Taq DNA Polymerase, Tris-HCl, KCl and MgSO ₄ 、dNTP、BSA。

8. The method for determining alcohol content by rapid gene detection according to claim 7, wherein: the dosage or concentration of each component in the reagent A is as follows: taq DNA Polymerase: 0.5-1.5U; Tris-HCl: 30-50 mM; KCl: 100-120 mM; MgSO (MgSO) ₄ ：2.6-3.1mM；dNTP:0.05-0.4mM；BSA:0.1mg/ml-2mg/ml。

9. The method for determining alcohol content by rapid gene detection according to claim 1 or 3, wherein: the lysis solution comprises: SDS, tris (hydroxymethyl) aminomethane, DTC.

10. The method for determining alcohol content by rapid gene detection according to claim 9, wherein: the concentration of each component of the lysis solution is as follows: SDS (sodium dodecyl sulfate): 0.4-1% wt; tris (hydroxymethyl) aminomethane: 0.3M-0.5M; and (3) DTC: 30mM-100 mM.