CN114908144A - Additive-assisted one-tube nucleic acid detection method - Google Patents

Additive-assisted one-tube nucleic acid detection method Download PDF

Info

Publication number
CN114908144A
CN114908144A CN202210548632.6A CN202210548632A CN114908144A CN 114908144 A CN114908144 A CN 114908144A CN 202210548632 A CN202210548632 A CN 202210548632A CN 114908144 A CN114908144 A CN 114908144A
Authority
CN
China
Prior art keywords
nucleic acid
amplification
tube
reaction
reaction solution
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210548632.6A
Other languages
Chinese (zh)
Inventor
周小明
林梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China Normal University
Original Assignee
South China Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Normal University filed Critical South China Normal University
Priority to CN202210548632.6A priority Critical patent/CN114908144A/en
Publication of CN114908144A publication Critical patent/CN114908144A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an additive-assisted one-tube nucleic acid detection method, which comprises the following steps: adding a nucleic acid detection reaction solution to the bottom of a reaction tube, adding a nucleic acid amplification reaction solution to the tube wall of the same reaction tube, centrifuging for a short time to enable the reaction solution on the tube wall to sink and contact and mix with the reaction solution at the bottom of the tube, and detecting a fluorescent signal in the reaction tube; the nucleic acid detection reaction liquid contains glycerol, and the glycerol accounts for 10-20% of the volume of the reaction system. Compared with a step-by-step reaction system, the detection method of the invention achieves the same detection sensitivity, avoids aerosol pollution and simplifies the experimental steps. Compared with a one-tube reaction system based on physical separation, the detection method simplifies the experimental operation steps. Relatively optimizing a Cas reaction system, the detection method can realize high-sensitivity nucleic acid detection by only using one guide RNA, and simplifies the reaction system.

Description

Additive-assisted one-tube nucleic acid detection method
Technical Field
The invention belongs to the field of biological detection, and particularly relates to an additive-assisted one-tube nucleic acid detection method.
Background
At present, CRISPR/Cas systems, such as CRISPR/Cas12 and CRISPR/Cas13 systems, have been widely used in the field of nucleic acid detection due to their advantages of specificity, programmability, and ease of use. However, the sensitivity of CRISPR-Cas detection system alone is still difficult to meet clinical analysis requirements. Therefore, the nucleic acid detection method based on the CRISPR/Cas technology is mostly combined with the nucleic acid amplification technology at present.
In the one-tube nucleic acid detection method based on nucleic acid amplification and CRISPR/Cas system, the CRISPR/Cas system can recognize and degrade an amplification target, so that an amplification template is deleted, and the amplification efficiency is greatly reduced. In addition, the CRISPR/Cas system activated by the target nucleic acid can nonspecifically degrade primers required for nucleic acid amplification, which in turn leads to a decrease in amplification efficiency. Due to the factors, the detection efficiency of the existing one-tube method based on the combination of nucleic acid amplification and CRISPR/Cas technology is low, and the requirement of high-sensitivity nucleic acid detection cannot be met.
In order to solve the above problems, many studies separate CRISPR/Cas detection and nucleic acid amplification, and although the improvement of sensitivity can be achieved, the detection procedure involves transfer of amplification products, which easily causes aerosol pollution and thus false positive detection results.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide an additive-assisted one-tube nucleic acid detection method.
The purpose of the invention is realized by the following technical scheme:
a method for detecting nucleic acid, comprising the following steps:
adding a nucleic acid detection reaction solution to the bottom of a reaction tube, adding a nucleic acid amplification reaction solution to the tube wall of the same reaction tube, centrifuging for a short time to enable the reaction solution on the tube wall to sink and contact and mix with the reaction solution at the bottom of the tube (gradually mix after contact and not mix uniformly), incubating and detecting a fluorescent signal in the reaction tube;
the nucleic acid detection reaction liquid contains glycerol, and the glycerol accounts for 10-20% of the volume of the reaction system, preferably 15%; the reaction system comprises a nucleic acid detection reaction solution and a nucleic acid amplification reaction solution;
the nucleic acid detection reaction solution contains a fluorescent reporter probe, and the final concentration of the fluorescent reporter probe is 200nM-1uM, so that sufficient fluorescent reporter probe existing near the target nucleic acid can be cut;
the nucleic acid detection reaction solution also contains crRNA with the final concentration of 10-500nM, Cas protein with the final concentration of 10-500nM and reaction buffer solution;
the volume ratio of the nucleic acid detection reaction solution to the nucleic acid amplification reaction solution is 1 (0.1-10);
the incubation is carried out at a temperature of 25-65 ℃;
the nucleic acid amplification reaction solution comprises amplification primers with the final concentration of 120-480nM, protease required for amplification, an amplification buffer solution and a to-be-detected object containing target nucleic acid;
the nucleic acid amplification reaction solution may be a reaction system of the following nucleic acid amplification type:
recombinase polymerase isothermal amplification (RPA), nucleic acid sequence dependent amplification (NASBA), recombinase mediated isothermal amplification (RAA), Transcription Mediated Amplification (TMA), helicase dependent isothermal amplification (HDA), Strand Displacement Amplification (SDA), loop mediated isothermal amplification (LAMP), chimera displacement Reaction (RDC), isothermal chimeric nucleic acid amplification (ICAN), linear isothermal polymerization amplification (LIMA), smart amplification process (SMAP), double primer isothermal amplification (DAMP), self-extension amplification (SEA), Rolling Circle Amplification (RCA), exponential isothermal amplification (EXPAR), or single primer isothermal amplification technique (SPIA), preferably recombinase polymerase isothermal amplification (RPA)
(RPA)。
The reaction system for the recombinase polymerase isothermal amplification comprises a single-stranded DNA binding protein (SSB), a recombinase and a strand displacement polymerase.
The nucleic acid detection reaction solution may be a reaction system of the following detection systems:
a V-type CRISPR/Cas detection system, a bioluminescence detection system, a colorimetric detection system or an electrochemical detection system, preferably the V-type CRISPR/Cas detection system;
the reaction system of the V-type CRISPR/Cas detection system comprises Cas12, Cas13, Cas9 or Cas14 endonuclease, one CRISPR RNA (crRNA) and one single-stranded reporter probe, wherein the crRNA comprises a sequence which can be complementary to a target nucleic acid.
The principle of the invention is as follows:
the Cas protein binds to the guide RNA to form a protein nucleic acid complex, which recognizes and degrades the nucleic acid target in the presence of the target nucleic acid under guide RNA mediation, while the activated trans-cleavage activity of the Cas protein cleaves the surrounding fluorescent reporter probe in a non-specific manner. One end of the fluorescent reporter probe is modified with a fluorescent group, and the other end of the fluorescent reporter probe is modified with a quenching group, and the fluorescent reporter probe is excited to generate a fluorescent signal after being degraded.
The invention adds glycerol for improving viscosity into a CRISPR-Cas system.
When the two CRISPR-Cas detection systems with certain viscosity and the amplification system technology are combined into one tube of reaction, the fusion of the two systems is delayed due to the viscosity of each other, and further, at the initial stage of the amplification reaction, the nucleic acid amplification template and the amplification primer cannot be degraded by the CRISPR-Cas, so that the amplification efficiency is not influenced. And the two systems are gradually fused along with the time extension, and when the nucleic acid amplification is completed, the two systems are completely fused, and the CRISPR-Cas detects the amplification product.
Compared with the prior art, the invention has the following advantages and effects:
1. compared with a step-by-step reaction system, the detection method of the invention achieves the same detection sensitivity, avoids aerosol pollution and simplifies the experimental steps.
2. Compared with a one-tube reaction system based on physical separation, the detection method simplifies the experimental operation steps.
3. The detection method can realize high-sensitivity nucleic acid detection by only one guide RNA and simplifies the reaction system by relatively optimizing the Cas reaction system (for example, two or more guide RNAs are needed).
Drawings
FIG. 1 shows the fluorescence signal intensity obtained when different additives are added into a tube of isothermal amplification-based CRIPSR/Cas system detection method; the diagonal bar of the legend indicates the relationship of "or", and glycerol and DMSO are liquid, and the amount added is expressed in volume percent (%) of the reaction system; betaine, aminobutyric acid, taurine and aminobutyric acid are solids, and the addition amount of the solid is expressed by the molar concentration (M) of the reaction system.
FIG. 2 shows the fluorescence signal intensities obtained when different target Scales (DNAs) were detected by the method of the present invention.
FIG. 3 shows the fluorescence signal intensities obtained for different target scalars (RNA) using the method of the invention.
FIG. 4 is a graph of fluorescence signal intensities obtained when different target Scales (DNAs) are detected using a conventional one-tube isothermal amplification-based detection method in combination with a CRIPSR/Cas system.
Figure 5 is the fluorescence signal intensity obtained for different target scalar (DNA) detection using a typical two-tube nucleic acid detection method based on isothermal amplification separate from CRISPR/Cas detection.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.
Example 1
A method for detecting nucleic acid, comprising the following steps:
(1) preparing CRISPR/Cas detection reaction solution
The CRISPR/Cas detection reaction solution comprises 1 xCas protein buffer solution, 100nM Cas12 protein (purchased from Hilies Biotech Co., Ltd., Guangzhou), 100nM crRNA (uaauuucuacuaaguguagaugggguuugagguccauuaca), 400nM FQ probe (FAM-CCCCCC-BHQ1) and different kinds of additives with different concentrations (as shown in FIG. 1).
(2) Preparing isothermal amplification reaction solution
In this example, recombinase polymerase isothermal amplification was used to amplify DNA targets using a twist Amp Basic Kit. The recombinase polymerase isothermal amplification reaction solution comprises a Primer (F Primer: gccgaagggaatggatactgagggaatagcaa; R Primer: gccgaagggaatggatactgagggaatagcaa) with the final concentration of 240nM, an amplification buffer solution, an amplification enzyme, a PCR product containing a partial sequence of African Swine Fever Virus (ASFV) B646L gene, and 280mM magnesium acetate.
(3) 10uL of CRISPR/Cas detection reaction solution is placed at the bottom of a reaction tube, 10uL of isothermal amplification reaction solution is placed on the tube wall, and the reaction tube is centrifuged for a short time (5 s at 5000 rpm). Incubating for 60min at 37 ℃, and determining the fluorescence signal intensity of the reaction solution by adopting a real-time quantitative PCR instrument.
The experimental result is shown in figure 1, and at a concentration of 10-20%, the glycerol additive has a very obvious enhancement effect on the detection efficiency of the one-tube nucleic acid detection method based on the combination of isothermal amplification and CRISPR/Cas system. The enhancement effect of the compound is concentration-dependent, and the final concentration of the system is 15 percent to achieve the optimal enhancement effect.
Example 2
The one-tube nucleic acid detection method for African Swine Fever Virus (ASFV) comprises the following steps:
(1) preparing CRISPR/Cas detection reaction solution
The CRISPR/Cas detection reaction solution included 1 × Cas protein buffer, 100nM Cas12 protein, 100nM crRNA, 400nM FQ probe, 30% glycerol (15% by volume relative to the whole reaction system).
(2) Preparing reaction liquid of isothermal amplification system
In this example, recombinase polymerase isothermal amplification was used to amplify DNA targets using a twist Amp Basic Kit. The recombinase polymerase isothermal amplification reaction solution comprises primers, an amplification buffer solution, an amplification enzyme, DNA targets with different concentrations and magnesium acetate.
(3) And (3) placing the CRISPR/Cas detection reaction solution at the bottom of a reaction tube, placing the reaction solution of the isothermal amplification system on the tube wall, and centrifuging for a short time. Incubating for 60min at 37 ℃, and determining the fluorescence signal intensity of the reaction solution by adopting a real-time quantitative PCR instrument.
The target DNA is a PCR product of a partial sequence of the B646L gene of the African swine fever virus. The amount of target added was 10 each 3 aM、10 2 aM、10 1 aM、10 0 aM、10 -1 aM、0aM(NTC)。
As shown in FIG. 2, when the method is applied to the sensitivity detection of ASFV, the method has good detection sensitivity, and the minimum detection limit can reach 10 0 aM。
Example 3
A one-tube nucleic acid detection method for a novel coronavirus (SARS-CoV-2) N gene, comprising the steps of:
(1) the N gene (genome coordinates: 28274-29533, GenBnak: MN908947.3) for the novel coronavirus (SARS-CoV-2).
(2) Preparing a CRISPR/Cas detection reaction solution as in example 2;
(3) preparing a reverse transcription amplification reaction solution, performing RNA target amplification by adopting a reverse transcription recombinase polymerase isothermal amplification mode (RT-RPA), and using a twist Amp Basic Kit. The reverse transcription recombinase polymerase isothermal amplification reaction solution comprises a primer, an amplification buffer solution, an amplification enzyme, a reverse transcriptase, a target and magnesium acetate.
(4) And (3) placing the CRISPR/Cas detection reaction solution at the bottom of a reaction tube, placing the reaction solution of the isothermal amplification system on the tube wall, and centrifuging for a short time. Incubating for 60min at 37 ℃, and determining the fluorescence signal intensity of the reaction solution by adopting a real-time quantitative PCR instrument.
The target used in this example was an RNA standard containing part of the N gene sequence of the novel coronavirus (SARS-CoV-2) purchased from the national institute of metrology science. The amount of target added was 10 each 5 copies、10 4 copies、10 3 copies、10 2 copies、10 1 copies、10 0 copies、0copies(NTC)。
As shown in FIG. 3, when applied to the sensitivity detection of SARS-CoV-2, the method has good detection sensitivity, and the lowest detection limit can reach 10 copies.
Comparative example 1
The comparative example is a conventional single-tube detection method based on combination of isothermal amplification and CRISPR/Cas system, and selects the target DNA, the Cas12a protein, the guide RNA, the fluorescent reporter probe and the buffer solution in the example 2.
(1) The CRISPR/Cas detection reaction solution comprises a 1 × Cas protein buffer solution, 100nM Cas12 protein, 100nM crRNA and 400nM FQ probe.
(2) Preparing isothermal amplification reaction solution
And (3) carrying out DNA target amplification by adopting a recombinase polymerase isothermal amplification mode and using a twist Amp Basic Kit. The recombinase polymerase isothermal amplification reaction solution comprises 240nM primer, amplification buffer solution, amplification enzyme, PCR product containing African Swine Fever Virus (ASFV) B646L gene partial sequence and 280mM magnesium acetate.
(3) And (3) placing the CRISPR/Cas detection reaction solution at the bottom of a reaction tube, placing the reaction solution of the isothermal amplification system on the tube wall, and centrifuging for a short time. Incubating for 60min at 37 ℃, and determining the fluorescence signal intensity of the reaction solution by adopting a real-time quantitative PCR instrument.
As shown in fig. 4, when a DNA target is detected using a conventional single-tube isothermal amplification-based detection method combined with CRIPSR/Cas system, the method can only detect 100 aM. In contrast, the detection sensitivity of the method of the present invention (example 2) was 1aM, which is 2 orders of magnitude higher than that of the conventional method.
Comparative example 2
This comparative example is a typical two-tube isothermal amplification-based nucleic acid detection method separate from CRISPR/Cas detection.
(1) Isothermal amplification reaction
In this example, recombinase polymerase isothermal amplification was used to amplify DNA targets using a twist Amp Basic Kit. The recombinase polymerase isothermal amplification reaction solution comprises primers, an amplification buffer solution, an amplification enzyme, DNA targets with different concentrations (same as example 2) and magnesium acetate. The reaction mixture was left to react at 37 ℃ for 30 min.
(2) CRISPR/Cas detection reaction
The CRISPR/Cas detection reaction system comprises a Cas protein reaction buffer, a Cas12 protein, guide RNA, an FQ probe and the amplification product obtained in the step (1). The final concentrations of the components in the reaction solution are respectively as follows: the final concentration of Cas protein reaction buffer was 1 ×, the final concentration of Cas12 protein was 100nM, the final concentration of silencing guide RNA was 10nM, and the final concentration of FQ probe was 400 nM.
The CRISPR/Cas detection reaction system is reacted for 60min at 37 ℃. Measuring the fluorescence signal intensity of the reaction system per minute.
As shown in fig. 5, when DNA targets were detected using a typical two-tube isothermal amplification-based nucleic acid detection method separate from CRISPR/Cas detection, the method detected a target of 1 aM. In contrast, the detection sensitivity of the method of the present invention (example 2) was also 1aM, reaching the same detection sensitivity as that of the typical two-tube monitoring method.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Claims (10)

1. A method for detecting nucleic acid, which is characterized by comprising the following steps:
adding a nucleic acid detection reaction solution to the bottom of a reaction tube, adding a nucleic acid amplification reaction solution to the tube wall of the same reaction tube, centrifuging for a short time to enable the reaction solution on the tube wall to sink and contact and mix with the reaction solution at the bottom of the tube, incubating and detecting a fluorescent signal in the reaction tube;
the nucleic acid detection reaction liquid contains glycerol, and the glycerol accounts for 10-20% of the volume of the reaction system; the reaction system comprises a nucleic acid detection reaction solution and a nucleic acid amplification reaction solution.
2. The one-tube nucleic acid detection method of claim 1, wherein: the glycerol accounts for 15 percent of the volume of the reaction system.
3. The one-tube nucleic acid detection method of claim 1, wherein: the volume ratio of the nucleic acid detection reaction solution to the nucleic acid amplification reaction solution is 1 (0.1-10).
4. The one-tube nucleic acid detection method of claim 1, wherein: the incubation is carried out at a temperature of 25-65 ℃.
5. The one-tube nucleic acid detection method of claim 1, wherein: the nucleic acid detection reaction solution contains a fluorescent reporter probe, crRNA, Cas protein and a reaction buffer solution.
6. The one-tube nucleic acid detection method according to claim 5, wherein: in the nucleic acid detection reaction solution, the final concentration of the fluorescent reporter probe is 200nM-1 uM.
7. The one-tube nucleic acid detection method of claim 1, wherein: the nucleic acid amplification reaction solution comprises an amplification primer, protease required for amplification, an amplification buffer solution and a substance to be detected containing target nucleic acid.
8. The one-tube nucleic acid detection method of claim 1, wherein: the nucleic acid amplification reaction solution is a reaction system of the following nucleic acid amplification types:
recombinase polymerase isothermal amplification (RPA), nucleic acid sequence dependent amplification (NASBA), recombinase mediated isothermal amplification (RAA), Transcription Mediated Amplification (TMA), helicase dependent isothermal amplification (HDA), Strand Displacement Amplification (SDA), loop mediated isothermal amplification (LAMP), chimera displacement Reaction (RDC), isothermal chimeric nucleic acid amplification (ICAN), linear isothermal polymerization amplification (LIMA), smart amplification process (SMAP), double primer isothermal amplification (DAMP), self-extension amplification (SEA), Rolling Circle Amplification (RCA), exponential isothermal amplification (EXPAR), or single primer isothermal amplification technique (SPIA).
9. The one-tube nucleic acid detection method of claim 8, wherein: the reaction system for the recombinase polymerase isothermal amplification comprises a single-stranded DNA binding protein (SSB), a recombinase and a strand displacement polymerase.
10. The one-tube nucleic acid detection method according to claim 1, wherein: the nucleic acid detection reaction solution is a reaction system of the following detection systems:
a V-type CRISPR/Cas detection system, a bioluminescence detection system, a colorimetric detection system or an electrochemical detection system.
CN202210548632.6A 2022-05-20 2022-05-20 Additive-assisted one-tube nucleic acid detection method Pending CN114908144A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210548632.6A CN114908144A (en) 2022-05-20 2022-05-20 Additive-assisted one-tube nucleic acid detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210548632.6A CN114908144A (en) 2022-05-20 2022-05-20 Additive-assisted one-tube nucleic acid detection method

Publications (1)

Publication Number Publication Date
CN114908144A true CN114908144A (en) 2022-08-16

Family

ID=82769581

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210548632.6A Pending CN114908144A (en) 2022-05-20 2022-05-20 Additive-assisted one-tube nucleic acid detection method

Country Status (1)

Country Link
CN (1) CN114908144A (en)

Similar Documents

Publication Publication Date Title
US11859238B2 (en) Multiphase nucleic acid amplification
US11788119B2 (en) Padlock probe detection method
CN102465120A (en) Fluorescence quantitative PCR reaction solution and fluorescence quantitative PCR method
CN102399866A (en) Generic buffer for amplification
Yao et al. Tagging the rolling circle products with nanocrystal clusters for cascade signal increase in the detection of miRNA
AU2022204316C1 (en) Method of isolating nucleic acid from specimens in liquid-based cytology preservatives containing formaldehyde
CN115948614B (en) Nucleic acid detection kit and detection method based on CRISPR/Cas12a system
CN114908144A (en) Additive-assisted one-tube nucleic acid detection method
CN114045330B (en) Nucleic acid isothermal amplification method based on sliding replication
CN117126925A (en) Crispr-Cas nucleic acid detection kit capable of being stored stably for long term
US9771572B2 (en) Method of isolating nucleic acid from specimens in liquid-based cytology preservatives containing formaldehyde
US9771571B2 (en) Method of isolating nucleic acid from specimens in liquid-based cytology preservatives containing formaldehyde
CN114908191A (en) Method and kit for improving LAMP amplification reaction of novel coronavirus
CN117660692A (en) CRISPR nucleic acid diagnosis method based on AIEgens fluorescent probe
GB2559919A (en) Method of isolating nucleic acid from specimens in liquid-based cytology preservatives containing formaldehyde

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination