CN114908099B

CN114908099B - Recombinant adeno-associated virus carrying designed SMN1 gene expression frame and application thereof

Info

Publication number: CN114908099B
Application number: CN202210112645.9A
Authority: CN
Inventors: 马文豪; 吴小兵
Original assignee: Beijing Jinlan Gene Technology Co ltd
Current assignee: Beijing Jinlan Gene Technology Co ltd
Priority date: 2018-06-28
Filing date: 2018-06-28
Publication date: 2024-07-02
Anticipated expiration: 2038-06-28
Also published as: CN108795946A; CN114908099A; CN108795946B

Abstract

The invention provides a series of recombinant adeno-associated viruses carrying an artificially designed SMN1 gene expression cassette. In vivo experiments show that the recombinant adeno-associated virus vector can be efficiently introduced into the central nervous system, continuously and stably express SMN1 protein, prolong the survival time of Spinal Muscular Atrophy (SMA) model animals, increase the weight of the animals and restore the growth and development of the animals. The result shows that the recombinant adeno-associated virus vector can be developed into a novel spinal muscular atrophy treatment drug caused by SMN1 gene mutation.

Description

Recombinant adeno-associated virus carrying designed SMN1 gene expression frame and application thereof

The application relates to a split application of Chinese patent application 201810686041.9 with the application date of 2018, 6, 28 and the name of recombinant adeno-associated virus carrying a designed SMN1 gene expression frame and application.

Technical Field

The invention relates to the field of biotechnology, in particular to an artificial SMN1 gene expression frame carried by a recombinant adeno-associated virus vector and application thereof in the treatment of spinal muscular atrophy.

Background

Spinal muscular atrophy (spinal muscular astrophy, SMA) is a group of common autosomal recessive genetic diseases in children and adolescents. Foreign literature suggests that the incidence rate is 1/6000 to 1/10000 (Nicole S, et al, muscul & nerve.2002;26 (1): 4-13.) and that the frequency of carriers in the population is between about 1/40 and 1/50. The incidence rate of the southern population in China is estimated to be 1/53000 (Chung B, et al J Child neurol 2003; 18 (3): 217-219.).

The disease is characterized by muscle atrophy and paralysis caused by degeneration of spinal cord anterior horn motor neurons and is characterized by (Maryam Oskoui,et al. Neurotherapeutics.2008;5:499-506.Nicole S,et al.Muscle&Nerve.2002;26(1):4-13.Talbot K.Journal of Inherited Metabolic Diseases.1999;22(4):545-554.), symptoms mainly appearing in limbs, wherein the proximal end is heavier than the distal end, and symptoms of the lower limb often appear before the upper limb (Thomas TH, et al, neuroomuscular disorders 1994;4 (5-6): 497-502.). If the intercostal muscles are affected, the respiratory function is also affected, and the life is endangered. Patient survival rate generally depends on whether respiratory function is affected, and exercise-related muscle groups tend to reduce patient quality of life, but not life threatening (Thomas TH,et al.Neuromuscular Disorders.1994;4(5-6):497-502.Kroksmark AK,et al.European Journal of Pediatric Neurology.2001;5(5):191-198.Russman BS,et al.J Child Neuro.1992;7(4):347-353.). some patients may also develop finger fibrillation (Iannaccone ST. Settings in biology 1998;18 (1): 19-26.). Facial muscles are generally rarely affected (Iannaccone ST, et al, pediometric biology 1993; 9 (3): 187-193.). The cognitive function of the SMA patient is normal, and the serious separation of the mental level and the exercise capacity of the patient usually occurs at the later stage of the SMA disease (Thomas TH,et al.Neuromuscular Disorders.1994;4(5-6):497-502.Iannaccone ST.Seminars in Neurology.1998;18(1):19-26.).

The international SMA union established classification guidelines for SMA based on age of onset, motor capacity and life of the patient. SMA is classified into 3 types of I type, II type and III type (Munsat T.Neuromuscular Disorders.1991;1(2):81.Munsat TL,et al. Neuromuscular disorders.1992;2(5-6):423-428.).

Spinal muscular atrophy type I is the most common type (also known as Werdnig-Hofffmann disease, model SMA, infancy SMA). Generally within 6 months after birth. Children with SMA type I generally cannot sit alone and die before age two (Cobben JM, et al Neuromuscular disorders.2008;18 (7): 541-544). This type is characterized by severe progressive muscle weakness and weakening of muscle tone (Iannaccone ST. Settings in biology 1998;18 (1): 19-26.). Type I SMA is one of the most important genetic disorders responsible for death in infants (Nicole S, et al Muscul & nerve.2002;26 (1): 4-13.).

SMA type II is an intermediate type (also known as juvenile SMA, chronic SMA). Onset is 6-18 months. Such patients may be sitting alone, but cannot walk alone. And respiratory tract dysfunction is common (Bertini E, et al, neuroomuscular disorders 2005;15 (11): 802-816.). Typically such patients live beyond two years, sometimes even survive to adolescence and even longer (Zerres K, et al journal of the Neurological sciences 1997;146 (1): 67-72.).

SMA type III is light SMA (also known as Kugelberg-Welander disease, wohlfart-Kugelberg-Welander disease). Usually onset is 18 months later, and the patient can walk independently, and the adolescence disease is likely to occur repeatedly. The life span is more normal (Zerres K, et al journal of the Neurological sciences 1997;146 (1): 67-72.).

There is a literature report that a severe form of SMA, known as SMA type 0, begins to develop before birth and dies one month after birth (Dubowitz v. European Journal of Pediatric neuroloy.1999;3 (2): 49-51.). The other extreme in the spectrum of SMA disease is SMA type IV, also known as adult SMA, which generally develops after age 35 (Maryam Oskoui, et al, neurotherapeutics.2008; 5:499-506.).

SMA actually has a broad clinical spectrum, with each subtype under the three major forms and overlapping between the genotypes. For example, some infants, while unable to sit alone, have long survival times (Thomas TH, et al, neuromedical disorders 1994;4 (5-6): 497-502). Some children suffer from SMA type I, but can autonomously move their head (the characteristic of SMA type I means that the head cannot autonomously move); some SMA type I infants do not progress rapidly after onset, and some infants develop disease 6 months ago but still can sit alone; some develop within 18 months, but can be isolated (Russman BS, et al J Child neuro.1992;7 (4): 347-353.). It has therefore been proposed that the maximum motor capacity of the infant after onset of the disease is predicted by a legal person better than the onset time (Zerres K, et al Neuromuscular disorders.1999;9 (4): 272-278).

The SMA causative gene is localized to 5q13.3 and is designated as SMN (motor neuron survival gene) gene (Brzustowicz LM, et al Nature.1990;344 (6266): 540-541.). The SMN gene was 20kb in length, and the cDNA was 1.7kb, containing 8 exons. The gene has 2 forms, SMN1 (SMNt) near the telomere and SMN2 (SMNc) near the centromere (Nicole S, et al Muscul & Nerve 2002;26 (1): 4-13.). Both are highly homologous (99%), the difference in coding region is only a synonymous mutation of exon 7 (codon 280, SMN1 is TTC and SMN2 is TTT), the other differences are all in the non-coding region, and none affect coding function (Nicole S, et al Muscule & Nerve 2002;26 (1): 4-13).

SMN encodes the full length SMN transcript fl-SMN (full-length survival motor neuron, full length motor neuron survival gene transcript) encoding 1 protein comprising 294 amino acids with a molecular weight of 38kD, referred to as SMN protein. SMN protein is widely expressed in tissues and cells of all mammalian organisms, at high levels in brain, kidney, liver, especially motor neurons, at moderate levels in skeletal muscle and cardiac muscle cells, and at low levels in lymphocytes. The expression level of SMN protein in motor neurons was found to be stable at various ages, while the amount of SMN protein in other tissues and organs decreased with age, suggesting that survival and function of motor neurons are strictly dependent on high levels of SMN protein expression (Wu Zhiguo, et al J.Zhonghua. Medical genetics 2003;20 (5): 430-432).

The specific function of SMN proteins is currently unknown (Sumner CJ.J Child neuro.2007;22 (8): 979-989.). In motor neurons, mRNA splicing is likely dependent on the SMN protein (Lefebvre S, et al cell.1995;80 (1): 155-165.). Motor neuron survival proteins may also play a key role in the growth of neuronal axons (McWhorter ML, the Journal of Cell biology 2003; 162 (5): 919-931.) SMN proteins also play a role in combating the toxicity of SOD1 and protecting nerve cells. However, a decrease in SMN protein was found in all cells of SMA patients. It is not known whether this protein deficiency merely affects the function of motor neurons (Zou T, et al biochemical and Biophysical Research communication.2007;364 (4): 850-855). There are a number of other assumptions about the pathological processes of SMA, including dysregulation of the apoptosis program, glutamate-produced excitotoxicity, oxidative stress, and the like (Takeuchi Y, et al J Child neuro.1994;9 (3): 287-289.).

SMN proteins are distributed in the central nervous system predominantly in the cytoplasm and in skeletal muscle predominantly in the nucleus, aggregating into one gems structure within the nucleus (Patrizi AL, et al Eur J Hum Genet.1999;7 (3): 301-309.) and play an important role in gene transcription and splicing. The cause of SMA is that the SMN1 gene is homozygous deletion or compound heterozygous mutation, so that the expression level of the functional protein SMN is reduced, and the spinal cord anterior horn motor neuron cells are denatured, so that muscle atrophy and paralysis are caused (Wu Zhiguo, et al, J.Zhonghua. Medical science genetics 2003;20 (5): 430-432).

The SMN1 gene expression product 90% is SMN protein, whereas the SMN2 gene transcript 90% lacks exon 7, only 10% of the transcript containing exon 7 expresses only about 10% of SMN protein (Lorson Cl,et al.Proceedings of the National Academy of Sciences of the United States of America.1999;96(11):6307-6311.),, so that the presence of SMN2 cannot completely compensate for the deletion of SMN protein caused by mutation of SMN1 gene. Transcripts lacking exon 7 formed by aberrant splicing of SMN2 are referred to as Δ7smn2. The mechanism of Δ7smn2 production has two main views: cartegni et al believe that mutation of base C at +6 of exon 7 of the SMN2 gene to T disrupts the exon splicing enhancer (exonic SPLICING ENHANCER, ESE), resulting in cleavage of SMN2 exon 7 (CARTEGNI L, et al, american Journal of Human genetics 2006;78 (1): 63-77.); kashima and Manley found that mutation of C to T produced an exon splice silencer (exonic SPLICING SILENCER, ESS) that recruited hnRNP A1 inhibitor to SMN2, resulting in cleavage of SMN2 exon 7 (Tsuyoshi Kashima, et al Nature genetics.2003; 34:460-463.). It was demonstrated that a further oligonucleotide change at position +100 of intron 7 produced a binding site for hnRNP A1 at SMN2 which was necessary for cleavage of exon 7, the mutation blocking binding of this protein, and increased yield of fl-SMN RNA containing exon 7 (Tsuyoshi Kashima, et al PNAS.2007; 104 (9): 3426-3431.).

In addition, self-oligomerization of SMN proteins is important for their function (Wolstencroft EC, et al, hum Mol Genet.2005; 14:1199-1210.). While SMN2 gene expression results in a reduced self-oligomerization of the truncated Δ7SMN2 protein, which improves SMA in vitro, but does not prevent the SMA phenotype, and its biochemical properties are unstable and rapidly degraded, failing to compensate for the absence of SMN1 (Le TT, et al hum Mol Genet.2005; 14:845-857.).

In summary, SMNl gene is defective and normal SMN2 gene cannot be completely compensated, and finally, SMN protein deficiency is the main pathogenesis of SMA. Thus, the approach to increase SMN protein expression is the most fundamental and promising therapeutic strategy for SMA. The treatment strategies depending on SMN mainly comprise SMNl gene substitution treatment, enhancing the activity of an SMN2 gene promoter, increasing the expression of the total length transcript of the SMN2 gene, stabilizing the SMN and the like. Specific treatment regimens broadly include 3 classes: gene therapy, antisense oligonucleotides, small molecule compounds. In addition, there are also therapeutic strategies that do not rely on elevation of SMN proteins, such as stem cell therapy, neuromuscular protection-like drugs, etc. Currently, 33 studies of at least 18 SMA candidate drugs have entered the clinical trial phase (http:// clinicaltrias. Gov) for the different treatment regimens described above.

SMN dependent treatment: (1) Gene therapy: the gene therapy method is to directly increase the expression of in vivo SMN protein by introducing exogenous SMN gene through virus vector, and is a promising SMA candidate therapy method. In 2009 Foust et al, it was reported that type 9 self-complementing adeno-associated viral vectors (self-complementary adeno-associated virus type, scaav 9) pass the blood brain barrier more readily than other serotypes adeno-associated viral vectors, can be transported to the central nervous system after intravenous injection, infect about 60% of motor neurons (Foust KD, et al, nat biotechnol 2009; 27 59-65), which provides a new idea for the treatment of SMA. Various scAAV9 (scAAV 9-SMN) bearing SMN1 gene expression cassettes have then begun to be used more widely in SMA therapy studies. Foust et al established a heavy-duty Δ7SMA mouse model (hereinafter referred to as "Δ7SMA mouse"), recombinant 9-self-complementing adeno-associated virus vector scaAAV 9-CB-SMN1 carrying the SMN1 gene expression cassette of CB promoter (consisting of human cytomegalovirus enhancer and chicken beta-actin promoter) was injected into heavy-duty Δ7SMA model mice after the first day of birth by facial intravenous injection at a dose of 5X 10 ¹¹ vg (viral genome)/mouse, Its survival was prolonged to 250d, significantly longer than the average survival of the non-dosed group Δ7sma mice by 15.5d (Foust KD, et al, nat biotechnol.2010; 28 (3):271-274.). In addition, the weight, motor function and pathological manifestations of the mice in the dosing group were significantly better than those of the mice in the non-dosing group. Valori et al designed a scAAV9 virus with a gene expression cassette different from that of scAAV9-CB-SMN 1. The virus uses a human cytomegalovirus promoter (CMV) regulatory sequence to optimize the expression cassette of the SMN1 gene. The virus was injected into Δ7sma mice at a dose of 1×10 ¹¹ vg (viral genome) per mouse by facial intravenous injection after the first day of birth, and the results showed that the average prolongation of 69 days, the mice weight, locomotor ability and pathological manifestations were improved to varying degrees (Valori CF, et al science Translational medicine.2010; 2 (35): 35ra 42.). Domiiguez et al uses phosphoglycerate Promoter (PGK) to regulate and optimize SMN1 gene expression, uses scAAV9 to carry and construct SMN1 expression frame, uses 4.5× ¹⁰ vg (viral genome)/dose to be injected into delta 7SMA mice after birth for the first day by temporal vein, prolongs the survival period of model mice to 160 days (average value), and increases the weight and exercise ability of mice (domiiguez E, et al, human Molecular genetics.2011; 20 (4):681-693.). Three studies designed three different SMN1 expression frame structures, and the three different SMN1 expression frame structures can be effectively introduced into the central nervous system after being carried by a scaV 9 vector to express SMN1 protein, thus showing therapeutic effect. Wherein the effect of scAAV9-CB-SMN1 was also demonstrated in other mammalian models (Duque SI, et al, ann neurol 2015; 77 (3): 399-414.Meyer K,et al.Mol Ther.2015;23 (3): 477-487.). duque and the like, shows that before the appearance of SMA symptoms, the scAAV9-CB-SM,1 gene therapy can prevent the reduction of the muscle strength and the abnormal change of electromyography of the young pigs; after symptoms such as hind limb muscle strength reduction and gait abnormality of the SMA piglet, scAAV9-CB-SMN1 gene therapy is adopted, and the hind limb muscle weakness symptoms are not completely improved, but are not further aggravated or completely paralyzed, so that the further aggravation of the SMA symptoms can be prevented by the gene therapy after the symptoms appear (Duque SI, et al, ann Neurol 2015; 77 (3):399-414.). In vivo experiments in mice and monkeys by Meyer et al have found that the effective dose of scaAAV 9-CB-SMN1 administered intraventricularly is approximately 10-fold lower than that administered intravenously (Meyer K, et al mol Ther.2015;23 (3): 477-487.). Based on the considerable efficacy of this treatment regimen on animal models, the U.S. Food and Drug Administration (FDA) has approved scAAV9-CB-SMN1 (AVXS-101) in 2014 for phase I clinical trials, with 15 subjects of type SMAl. The results reported in the New England medical journal in 2017 show that 15 cases of SMA1 type infants have enhanced motor function and prolonged survival after undergoing AVXS-101 treatment (Mendell JR, et al N Engl J Med.2017;377: 1713-1722.) and demonstrate the feasibility of treating SMA by scAAV9-CB-SMN1 (AVXS-101). Currently, observations on 15 subjects are still ongoing.

(2) Antisense oligonucleotides (ANTISENSE OLIGONUCLEOTIDES, ASOs): the artificially synthesized ASOs fragment is specifically bound to the splice inhibition sequence of exon 7 of the SMN2 gene according to Watson-Crick base pairing rules, and promotes correct splicing of exon 7 so as to promote expression of the full-length SMN2 transcript. In ASOs currently used in SMA treatment research, a plurality of cell model and mouse model experiments developed internationally with (Singh NK,et al.Mol Cell Biol.2006;26(4):1333-1346. Hua YM,et al.PLoS Biology.2007;5(4):e73.Zhou HY,et al.Hum Gene Ther.2013;24(3):331-342.15-17). relatively remarkable effect of splicing silencer Nl sequence (intronie SPLICING SILENCER, ISS-N1) combined with intron 7 of SMN2 gene prove that 2' -O-Methyl (MOE) ASO and morpholino can increase full-length SMN2 gene expression, promote SMN protein level, improve SMA related expression (Mitrpant C,et al.PLoS One.2013;8(4):e62114.Keil JM,et al.Mol Ther Nucleic Acids.2014;3:e174.Osman EY,et al.Hum Mol Genet.2014;23(18):4832-4845. Nizzardo M,et al.Clin Ther.2014;36(3):340-356.18-21).Zhou and the like after single injection of morpholino through lateral ventricle, The expression of the full-length SMN2 transcripts in the brain and spinal cord of the mice was up-regulated, and the survival time was prolonged to 230 days, which was significantly longer than that of the untreated group by about 9 days (Zhou HY, et al hum Gene Ther.2013; 24 (3):331-342.17). Mitrpant et al showed that the survival of heavy SMA mice after ASO treatment was prolonged to 37-126 days, significantly longer than that of the control group for 15 days (MITRPANT C, et al PLoS one.2013;8 (4): e 62114.18). Rigo et al showed that after continuous 7 day infusion or single side ventricle injection of MOE-ASO into SMA mice side ventricles, full length SMN2 gene levels in the lumbar spinal cord were raised to 3-fold and maintained for around 52 and 36 weeks, respectively (Rigo F, et al j Pharmacol Exp tho 2014; 350 (1):46-55.). In addition, rigo, et al have developed a non-human primate model experiment by intrathecally injecting different doses of MOE-ASO into adult macaque to study the distribution of the drug into primate, and the results show that MOE-ASO is widely distributed in each segment of spinal cord, cerebellum, brain bridge and cerebral cortex, especially with the highest concentration of MOE-ASO in lumbar spinal cord, and the experimental results provide theoretical basis for the distribution and metabolism study of drug in human body in clinical trial (Rigo F, et al j Pharmacol Exp thor.2014; 350 (1):46-55.). Candidate drug Nusinersen of MOE-ASO (original name ISIS-SMN _RX) was subjected to a plurality of I, II phase clinical trials, and the intrathecal injection Nusinersen was carried out on hundreds of cases SMAl, 2 and 3 of infants, and the distribution and metabolism of the drug in human bodies were evaluated (Chiriboga CA, et al, neurology.2016;86 (10): 890-897.), and the results showed that Nusinersen was better in safety and tolerance (Chiriboga CA, et al, neurology.2016; 86 (10):890-897.). Subsequent phase III clinical experiments prove that Nusinersen has obvious clinical curative effect on the SMA infant. The Food and Drug Administration (FDA) approved Nusinersen for sale in the United states at 23, 12, 2016, under the trade name SPINRZA, was the first new drug for the treatment of SMA in children and adults (https:// www.accessdata.fda.gov /).

(3) Small molecule compounds: the small molecular compounds which can increase the SMN protein level are more in types, and the action mechanisms of the up-regulating SMN proteins of the small molecular compounds in different types are different (Cherry JJ, et al EMBO Mol Med.2013;5 (7): 1035-1050.). Histone deacetylase inhibitors (HDACI) with valproic acid as a research hotspot may increase the activity of transcription factors by remodelling chromatin, altering the structure of transcription factors, increasing the amount of full-length SMN2 transcripts, and then increasing the level of full-length SMN protein (Mohseni J, et al, genet Mol biol.2013; 36 (3):299-307.). after the up-regulation of full-length SMN2 transcripts is observed in the initial cell level study, although clinical tests report that the effects of improving the SMN protein level and improving the muscle strength of limbs are (Swoboda KJ,et al.PLoS One.2009;4(5):e5268.Piepers S,et al.J Neurol Neurosurg Psychiatry.2011;82(8):850-852.26-27), in SMA type 2 infants, most clinical test results show that the effects of HDACI on improving the SMN protein level and improving the muscle strength of limbs of SMA type 2 infants, type 3 infants and SMA type 4 adult patients are not obvious to heart (Mereuri E,et al.Neuromuscul Disord.2004;14(2):130-135.Darbar IA,et al.BMC Neurology. 2011;11:36.Kissel JT,et al.Muscle Nerve.2014;49(2):187-192.28-30),, so the clinical curative effect and application prospect of the HDACI medicines cannot be fully confirmed yet. Small molecular compounds with the function of increasing the expression of SMN2 genes, such as an RNA uncapping enzyme inhibitor RG3039, which are screened by a high-throughput screening technology (high-throughput screen, HTS), have the function of stabilizing the mRNA structure of the SMN2 genes by inhibiting the hydrolysis of the m7GPPPN cap structure at the 5' end of mRNA, so that the total amount of SMN proteins is increased, the movement function of heavy delta 7SMA mice is improved, the survival time is prolonged (Lutz CM,et al.J Clin Invest.2011;121(8):3029-3041.Gogliotti RG,et al.Hum Mol Genet.2013;22(20):4084-4101.31-32). the current phase I clinical test of RG3039 is ended, The results showed that the drug was safe and well tolerated, but phase II clinical trials were now discontinued and the pharmaceutical company did not publish the specific cause. Similarly, small molecules R006885247 and LMl070 also promote SMN2 gene expression, and phase I and phase II clinical trials (Yang Lan, et al J.P.E.M.; 2016;54 (8): 634-637) have been conducted. Small molecule RO7034067 (RG 7916) is also an activator of SMN2 gene expression, and clinical safety assessment tests have been completed in the Netherlands and Japan at present, and are being prepared for clinical safety assessment in the United states (https:// www.clinicaltrials.gov). Some SMN2 gene splicing regulators SMN-C1, SMN-C2 and SMN-C3 screened by the improved second-generation HTS technology can promote the expression of the full-length SMN2 gene, and the compound can pass through the blood brain barrier after being orally taken and has obvious effect in preclinical research, so that the compound becomes a new research hot spot. NARYSHKIN et al found that both light and heavy delta 7SMA mice had significantly elevated brain and quadriceps femoris levels of SMN protein following continuous 10d oral administration of SMN-C2, SMN-C3, and that heavy delta 7SMA mice had a body weight gain that was comparable to normal mice with significantly longer survival than untreated groups (NARYSHKIN NA, et al science 2014;345 (6197): 688-693.). But SMN-C1, SMN-C2 and SMN-C3 are still in preclinical research stage at present. 2. SMN independent treatment: before irreversible degenerative damage occurs to spinal cord anterior horn motor neurons, some neuromuscular protection measures are also important for maintaining motor function in SMA infants. The stem cell therapy, nerve cell protection factors, muscle strengthening drugs and other therapy methods which do not depend on the promotion of SMN protein expression protect the functions of motor neurons and nerve pathways thereof through different ways, and have certain auxiliary effects on the therapy measures for promoting the SMN protein.

Stem cell therapy is to differentiate induced pluripotent stem cells (induced pluripotentstem cells, iPSCs) into motor neurons, then transplant the motor neurons into spinal cord to replace degenerated motor neurons, thereby restoring the function of the neuromuscular system, and clinical studies have shown that the method can improve the motor function (Zanetta C,et al.J Cell Mol Med.2014;18(2):187-196.Villanova M,et al.Am J Phys Med Rehabil.2015;94(5)：410-415.34-35), of SMAl type children is considered as a potential therapeutic strategy. The neuroprotective factor drugs riluzole and ao Li Suoxi (Olesoxime) are both drugs for treating amyotrophic lateral sclerosis, and the results of SMA clinical experiments show that riluzole can prolong the survival time of SMA1 type infants, but has no obvious effect of improving the motor function (Russman BS, et al, arch neurol 2003; 60 1601-1603) Orinostat is a good means to maintain the motor functions of children suffering from both type 2 and type 3 SMA, so that use of Ordison Li Suoxi for the adjuvant treatment of SMA has been agreed in the United states and European Union. Another drug for the treatment of multiple sclerosis, 4-aminopyridine (4-AP, ampyra), which blocks potassium channels to maintain motor neuron excitability and thus increase muscle contraction (borset T, et al j Pharmacol Exp thor 2007;322 (2): 709-720), has been approved by the FDA for phase iii clinical trials in SMA type 3 infants to evaluate the clinical effects of 4-AP. in addition, the skeletal muscle troponin activator CK-2127107 (Hwee DT, et al J Pharmacol Exp Ther 2015;353 (1): 159-168) used in the study of heart failure mediated skeletal muscle diseases has been used in the study of SMA treatment by improving skeletal muscle strength and improving muscular atrophy and weakness of SMA children, and CK-2127107 has been currently subjected to a clinical trial in SMA II. Since 1995 the pathogenic genes of SMA were located, the pathogenesis of the disease has been a hotspot explored by scientists. Although there is currently a lack of effective therapies, the great success achieved based on therapeutic studies to increase SMN protein expression holds promise for SMA treatment. The gene therapy scAAV9-SMN has the advantages that the therapy requirement can be met through single large-dose administration, multiple injections are avoided, animal experiments also show that the method is remarkable in effect and good in safety, but safety problems possibly brought by small virus use doses (up to 2 x 10 ¹⁴ vg/kg) in clinical experiments still deserve further attention. And how to produce a large amount of virus vectors to meet the treatment requirement of the international SMA infant is also a problem to be solved urgently. SPINRZA can specifically act on SMN2 gene, so that the side effect is few, the effect is obvious, but the blood brain barrier can not be effectively passed, repeated intrathecal injection is needed, and the compliance of the children is reduced. The small molecule compounds have the advantages of convenient administration, acting on the central nervous system through the blood brain barrier after oral administration, and the disadvantage that a wide variety of small molecule compounds do not specifically act on the SMN gene, so adverse reactions to other genes cannot be determined. Furthermore, both animal and clinical trials suggest that there is a relatively narrow window of time for SMA treatment, and how to determine the optimal time of administration is also a critical issue. therefore, there is a need to develop new SMA therapeutics that provide a new option for a wide range of SMA patients.

In the invention, a gene therapy strategy is adopted, and a series of novel SMA gene therapy candidate drugs are designed aiming at the possible limitations of the SMA gene drugs. Firstly, a novel SMN1 gene expression frame structure is designed, a plurality of promoter elements with short sequences and high expression level are independently designed, and the sequence of the SMN1 gene coding region is optimized, so that the expression level of the SMN1 gene after being transduced into a body is improved. Secondly, we also tried to add a human miR-122 target sequence into the 3'UTR (3' -untranslated region) of the SMN1 gene expression frame, and utilize the characteristic of high expression miR-122 in normal liver (Jopling C. RNA biol.2012;9 (2): 137-142.) according to the principle of miRNA inhibition gene expression (Kim VN. Nat Rev Mol Cell biol.2005;6 (5): 376-385.), so as to reduce the expression level of SMN1 in liver after administration and reduce the safety risk possibly brought by overexpression of SMN protein in liver. Then we also provided an autonomously designed double-stranded AAV vector structure, which is mainly characterized in that one or two inverted terminal repeats (INVERTED REPEAT TERMINAL, ITR) in the AAV vector are subjected to deletion mutation, which is helpful for improving the in vivo transduction efficiency of the AAV vector and improving the expression level of the SMN1 gene introduced into the body (patent application No. CN201515331560.3. Zhou Q, et al Sci Rep.2017;7 (1): 5432.). Again we also provided other serotypes of AAV drug design besides AAV9, specifically AAV5 and AAVrh10, both of which can effectively deliver SMN1 expression cassettes carried by them to the nervous system. Finally, we also compared the effect of different modes of administration (e.g., intravenous, myelin, and intraventricular, etc.) on the safety and effectiveness of the designed drug.

Adeno-associated virus (AAV) has been found in adenovirus preparations under the name (Atchison RW,et al. Science.1965;149:754-756.Hoggan MD,et al.Proc Natl Sci USA.1966;55:1467-1474.).AAV to be a member of the family of the parvoviridae (Parvovirus), comprising multiple serotypes whose genomes are single stranded DNA (Rose JA, et al Proc NATL ACAD SCI USA 1969; 64:863-869), wherein AAV2 has a genome size of 4682 nucleotides. AAV is a dependent virus that requires other viruses such as adenovirus, herpes simplex virus, and human papilloma virus (Geoffroy MC, et al Curr Gene Ther.2005;5 (3): 265-271.) or cofactors to provide helper functions for replication. In the absence of helper virus, AAV will integrate into the cell chromosome after infection of the cell into its genome into a latent state (Chiorini JA, et al Curr Top Microbiol Immunol 1996; 218:25-33.) without the production of progeny virus.

The earliest isolated AAV virus was serotype 2 AAV (AAV 2) (Atchison RW, et al science 1965; 149:754-756.). AAV2 genomes are about 4.7kb long, and are flanked by "inverted terminal repeats" (INVERTED TERMINAL REPEAT, ITR) of 145bp in length, in a palindromic-hairpin structure (Lusby E, et al J Virol.1980; 34:402-409). There are two large Open Reading Frames (ORFs) in the genome that encode the rep and cap genes, respectively. The full length genome of AAV2 has been cloned into an E.coli plasmid (Samulski RJ, et al Proc NATL ACAD SCI USA 1982;79:2077-2081.Laughlin CA,et al.Gene.1983;23:65-73.).

ITR is a cis-acting element of the AAV vector genome and plays an important role in the integration, rescue, replication and genome packaging of AAV viruses (Xiao X, et al J Virol.1997;71 (2): 941-948.). ITR sequences contain a Rep Binding Site (RBS) and a terminal melting site trs (terminal resolution site), which are recognized by Rep protein binding and create a notch at trs (Linden RM, et al Proc NATL ACAD SCI USA 1996;93 (15): 7966-7972.). ITR sequences can also form unique "T" letter-like secondary structures that play an important role in the life cycle of AAV viruses (Ashktorab H, et al J Virol.1989;63 (7): 3034-3039.).

The remainder of the AAV2 genome can be divided into 2 functional regions, the rep gene region and the cap gene region (SRIVASTAVA A, et al J Virol.1983; 45 (2): 555-564.). The Rep gene region encodes four Rep proteins, rep78, rep68, rep52, and Rep40.Rep proteins play an important role in replication, integration, rescue and packaging of AAV viruses. Wherein Rep78 and Rep68 specifically bind to the terminal melting sites trs (terminal resolution site) and GAGY repeat motif in the ITR (Huser D, et al PLoS Pathog.2010;6 (7): e 1000985.), initiating replication of the AAV genome from single to double stranded. The trs and GAGC repeat motifs in the ITR are central to AAV genome replication, and thus, although the ITR sequences are not identical in AAV viruses of the various serotypes, both form a hairpin structure and exist at the Rep binding site. At AAV2 genomic map position 19 there is a p19 promoter, expressing Rep52 and Rep40, respectively. Rep52 and Rep40 have no DNA binding function, and have ATP-dependent DNA helicase activity. The cap gene encodes the capsid proteins VP1, VP2, and VP3 of AAV virus. Among them, VP3 has the smallest molecular weight but the largest number, and the ratio of VP1, VP2, VP3 in the mature AAV particles is approximately 1:1:10. VP1 is required for the formation of infectious AAV; VP2 assists VP3 in entering the nucleus; VP3 is the major protein that makes up AAV particles.

With the understanding of the life cycle of AAV viruses and their related molecular biological mechanisms, AAV viruses have been engineered into a highly efficient foreign gene transfer tool, AAV vectors. The modified AAV vector genome only comprises an ITR sequence of AAV virus and an exogenous gene expression frame carrying transport, and Rep and Cap proteins required by virus packaging are provided in a trans mode through exogenous plasmids, so that possible damage caused by the packaging of the Rep and Cap genes into the AAV vector is reduced. Furthermore, AAV viruses are not pathogenic themselves, making AAV vectors one of the most recognized viral vectors. Deletion of the D sequence and trs (terminal resolution site) sequence from one side ITR sequence of AAV also allows the packaged recombinant AAV vector to carry the genome to be self-complementary, forming a double strand, significantly increasing the in vitro and in vivo transduction efficiency of the AAV vector (Wang Z, et al Gene Ther.2003;10 (26): 2105-2111.McCarty DM,et al.Gene Ther.2003;10 (26): 2112-2118.). The packaged virus becomes a scAAV (self-complementary AAV) virus, a so-called double-stranded AAV virus. Unlike ssAAV (single-STRANDED AAV), which is a conventional AAV virus, neither of which has a double ITR mutation. The packaging capacity of scAAV virus is smaller, only half of ssAAV packaging capacity, approximately 2.2kb-2.5kb, but transduction efficiency is higher after infection of cells. AAV serotypes are numerous, with different serotypes having different tissue infectivity, and therefore the use of AAV vectors is capable of transporting foreign genes to specific organs and tissues (Wu Z, et al mol Ther. 2006;14 (3): 316-327.). Some serotypes of AAV vectors also cross the blood brain barrier, causing foreign genes in brain neurons, providing the potential for targeted Gene transduction into the brain (SAMARANCH L, et al hum Gene Ther.2012;23 (4): 382-389.). In addition, AAV vectors are stable in physicochemical properties, exhibit high resistance to acids and bases and high temperatures (Gruntman AM, et al, hum Gene Ther methods.2015; 26 (2): 71-76), and are easy to develop biological products with high stability.

AAV vectors also have relatively mature packaging systems, facilitating large-scale production. The AAV vector packaging system commonly used at home and abroad at present mainly comprises a three-plasmid cotransfection system, a packaging system with adenovirus as a helper virus system and herpes simplex virus (Herpes simplex virus type, HSV 1) as a helper virus, and a packaging system based on baculovirus. Among them, the three-plasmid transfection packaging system is a most widely used AAV vector packaging system because of no need of helper virus, and is also a currently international mainstream production system. The lack of efficient large-scale transfection methods has somewhat limited the use of three plasmid transfection systems in the large-scale preparation of AAV vectors. Yuan et al set up AAV large-scale packaging systems (Yuan Z, et al hum Gene Ther,2011,22 (5): 613-624.) using adenovirus as helper virus, which have high production efficiency, but trace amount of adenovirus in final AAV finished product in packaging system affects the safety of AAV finished product. HSV1 is another type of AAV vector packaging system that is more widely used as a helper virus packaging system. Wu Zhijian and Conway et al have proposed internationally, almost simultaneously, AAV2 vector packaging strategies using HSV1 as a helper virus (Wu Zhijian, wu Xiaobing et al). Scientific notification, 1999, 44 (5): 506-509.Conway JE, et al Gene Ther,1999, 6:986-993.). Subsequently Wustner et al propose AAV5 vector packaging strategies using HSV1 as a helper virus (Wustner JT, et al mol Ther,2002,6 (4): 510-518.). On this basis, booth et al utilized two HSV1 to carry the rep/cap gene of AAV and the reverse terminal sequence (INVERTED TERMINAL REPEAT, ITR)/foreign gene expression cassette of AAV, respectively, and then two recombinant HSV1 viruses co-infected the producer cells, and packaged to produce AAV virus (Booth MJ, et al Gene Ther,2004, 11:829-837.). Thomas et al further established a suspension cell system for double HSV1 virus AAV production (Thomas DL, et al Gene Ther,2009, 20:861-870.) enabling larger scale AAV production. In addition, the Urabe et al constructed a baculovirus packaging system for AAV vectors by using three baculoviruses to carry AAV structural, non-structural and ITR/exogenous gene expression cassettes, respectively. Considering the instability of baculoviruses carrying exogenous genes, the number of baculoviruses required in the production system is then reduced, gradually from the first three baculoviruses to two or one baculoviruses (Chen h.mol ther.2008; 16 924-930.Galibert L,et al.J Invertebr Pathol,2011,107Suppl:S80-93.) each packaging system of a baculovirus plus an induced cell strain strategy (Mietzsch M,et al.Hum Gene Ther.2014;25:212-222.Mietzsch M,et al.Hum Gene Ther.2015;26(10):688-697.). is characterized and can be selected appropriately as desired.

Because of the above characteristics, AAV vectors are becoming an exogenous gene delivery tool for use in gene therapy, particularly in genetic disease. By month 11 of 2017, there are 204 world-approved protocols for gene therapy clinical trials with AAV vectors (http:// www.abedia.com/wiley/vectors. Php). More importantly, AAV vector-based lipoprotein lipase gene therapy drug Glybera was approved by European drug administration for marketing in 2012, becoming the first gene therapy drug approved in the western worldS.mol ter.2012; 20 1831-1832.); the FDA approval of congenital black Meng Zheng (caused by mutation of RPE65 gene) gene therapy drug Luxturna was marketed in 12.19.2017 as the first rare disease gene therapy drug in the United states (https:// www.fda.gov/newsevents/newsroom/pressannouncements/ucm589467. Htm). AAV vector gene therapy drugs for hemophilia B (Kay MA, et al Nat Genet.2000;24 (3): 257-261.) all achieve good clinical trial results and are expected to be marketed in the near future, benefiting a wide range of patients.

In the present invention, we selected AAV vectors to carry the SMN1 gene expression cassette, principally based on the following features of AAV vectors. First, AAV vectors retain only two ITR sequences required for packaging in wild-type viruses, and do not contain the protein-encoding genes in the wild-type virus genome (SALGENIK M, et al Microbiol spectra.2015; 3 (4)), with low immunogenicity. Secondly, AAV normally achieves sustained stable expression of the carrying gene reading frame in the form of non-integrated extrachromosomal genetic material (Chen ZY, et al mol Ther.2001;3 (3): 403-410.) avoiding the safety problems associated with random integration of the introduced gene. Thirdly, AAV vector can efficiently transduce central nervous system (Foust KD,et al.Nat Biotechnol.2009;27:59-65.Yang B,et al.Mol Ther.2014;22(7): 1299-1309.Evers M,et al.Journal of Neurology Neurosurgery&Psychiatry.2016;87(Suppl 1):A91.2-A91.Gray SJ,et al.Gene Ther.2013;20:450-459.Gholizadeh S,et al.Hum Gene Ther Methods.2013;1:1-9.), through intravenous injection, intrathecal injection and intraventricular injection, so that SMN1 gene expression frame can efficiently express SMN protein in the central nervous system in vivo, compensate SMN protein and restore physiological functions of organism.

In order to reduce the safety risk possibly brought by the over-expression of SMN protein in the liver during intravenous administration, a human miR-122 target sequence is cloned in the 3' UTR region of an SMN1 gene expression frame by utilizing the characteristic that miR-122 is specifically and highly expressed in the normal liver (Jopling C.RNA biol.2012;9 (2): 137-142). By using the principle of miRNA inhibition gene expression (Kim VN. Nat Rev Mol Cell biol.2005;6 (5): 376-385.), miR-122 molecules in liver cells can inhibit SMN protein expression, and the SMN protein expression in liver is obviously reduced.

MiRNAs (microRNAs) is a single stranded non-coding RNA of 18 to 25 nucleotides (nt) in length that is widely found in humans and animals (Bartel DP.cell.2004;116:281-297.Kim VN.Nat Rev Mol Cell Biol.2005;6:376-385.). miRNAs were first found in caenorhabditis elegans (C.elegans) (Lee RC, et al cell 1993;75:843-854.Wightman B,et al. Cell 1993; 75:855-862.). The lin-4 gene in elegans can down regulate the expression of the lin-14 gene, but the encoded product of the lin-4 gene is not a protein, but a small RNA molecule, which indicates that the encoded small RNA molecule can regulate the expression of the gene. Subsequently, the sequential discovery (Lagos-Quintana M,et al.Science.2001;294:853-858.Lau NC,et al.Science.2001;294:858-862.Lee RC,et al.Science.2001;294:862-864.),miRNA of a variety of similar small RNA molecules in different species and cells began to be a generic term for such small RNAs. miRNAs regulate the expression of approximately 60% of human genes (Lewis BP, et al cell.2005;120:15-20.Friedman RC,et al. Genome Res.2009; 19:92-105.) playing an important role in a variety of physiological and pathological processes (Careton M,et al.Cell Cycle.2007;6: 2127-2132.Ambros V.Cell.2003;113:673-676.Schichel R,et al.Oncogene.2008;27:5959-5974.).

The miRNA genes are typically located in exons, introns and intergenic regions of the genome (Olena AF, et al J Cell Physiol.2010; 222:540-545.Kim VN,et al.Trends Genet.2006;22:165-173.). In cells, miRNAs were produced as follows (Winter J, et al Nat Cell biol.2009; 11:228-234.). First, in the nucleus, the miRNA gene initiates transcription by RNA polymerase II or III to produce the initial product pri-microRNA; the pri-microRNA self-folding partial sequence forms a stem-loop structure. Subsequently, the processing complex consisting of ribonuclease III Drosha and DGCR8 molecules acts on the pri-microRNA, cutting off the excess sequence, leaving behind a stem-loop structure of about 60nt, i.e.the precursor miRNA molecule pre-microRNA(Lee Y,et al.Nature.2003;425:415-419.Denli AM,et al.Nature.2004;432:231-235.Gregory RI,et al.Nature.2004;432:235-240.Han J,et al.Genes Dev.2004;18:3016-3027.Landthaler M,et al.Curr Biol.2004;14:2162-2167.). then, with the aid of the transporter Exportin-5, the pre-microRNA is processed from the nucleus into the cytoplasm (Lund E,et al.Science.2003;303:95-98.Yi R,et al.Genes Dev.2003;17:3011-3016.Bohnsack MT,et al.RNA.2004;10:185-191.), by Dicer enzyme to remove the loop part of its stem-loop structure, becoming a double stranded RNA molecule (Jiang F, et al. Genes Dev.2005;19:1674-1679.Saito K,et al.PLoS Biol.2005;3:e235.). Finally, the double-stranded RNA molecule is bound by a protein factor such as AGO2, where one strand is degraded and the other strand and the protein factor form an RNA-induced silencing complex (RNA induced silencing complex, RISC). RISC recognizes a target sequence in mRNA, reduces the expression level of mRNA by degrading the mRNA molecule, promoting the de-adenylation of the 3 '-end of the mRNA molecule and inhibiting translation, and regulates gene expression (Storz G,et al.Curr Opin Microbiol.2004;7:140-144.Fabian MR,et al.Annu Rev Biochem.2010;79:351-379.Valencia-Sanchez MA,et al.Genes Dev.2006;20:515-524.). at the post-transcriptional level, thus utilizing a miRNA highly expressed in cells, inserting the target sequence of the miRNA into the 3' -UTR (untranslated region) of the foreign gene, and being able to effectively inhibit the expression of the foreign gene in the introduced cells.

According to the design thought, a plurality of recombinant AAV viruses carrying SMN1 gene expression frames are prepared, and rAAV-Fluc control viruses carrying firefly luciferase gene (Fluc) coding frames are designed and prepared. The viruses are respectively injected into an SMA mouse model body in an equal dose through intravenous injection, intrathecal injection or intraventricular injection mode, and the effectiveness of the recombinant AAV carrying the SMN1 gene expression frame is evaluated. The results show that compared with rAAV-Fluc control virus, the recombinant AAV virus carrying the SMN1 gene expression frame can efficiently transduce the central nervous system after being injected by injection modes such as intravenous injection, intrathecal injection, intraventricular injection and the like, and the SMN protein is produced by expression in neurons, so that the physiological functions of the neurons are recovered, and the survival period of a mouse model is remarkably prolonged. Compared with the prior AAV vector-based SMA gene therapy strategy, particularly AVXS-101 which is already in clinical trial stage, the unique SMN1 expression frame design in the invention improves the expression level of the SMN1 expression frame in vivo and reduces the use dose of viruses. In combination with the mutant ITR structure invented before, the designed SMN1 gene expression frame is inserted into AAV vector containing the mutant ITR structure, so that the expression efficiency after preparing virus transduction is further improved. In the invention, besides AAV9, the possibility of AAV5 and AAVrh10 for SMA gene therapy is evaluated, and the results show that AAV5 and AAVrh10 are the same as AAV9, and can efficiently transduce the central nervous system after being injected into the body by intravenous, intrathecal or intracerebroventricular injection modes and the like, and the SMN protein is produced by expression, so that the AAV5 and AAVrh10 have the same application prospect as AAV 9. Although AAV5 transduction efficiency is slightly lower than AAV9 and AAVrh10, transduction efficiency equivalent to AAV9 and AAVrh10 can be achieved by increasing the administration dose. In the invention, a plurality of possible administration modes are explored, and injection modes such as intrathecal injection, intraventricular injection and the like can realize high-efficiency transduction of neurons under lower administration dosage, so that SMN protein is expressed and produced, the damage effect of a nervous system mainly caused by SMN1 gene mutation is effectively relieved, and a new administration mode selection is provided for SMA gene therapy. Intravenous injection of AAV viral vectors results in efficient expression of foreign genes in the liver, potentially presenting a safety risk. The SMN1 expression frame containing the human miR-122 target sequence is designed, the recombinant AAV vector containing the expression frame is prepared, the SMN protein expression level in the liver is obviously reduced after intravenous injection, the SMN protein expression level in the nervous system is unaffected, and a new choice is provided for reducing the safety risk possibly brought by the overexpression of the SMN protein in the liver.

In summary, in the present invention we designed a variety of recombinant AAV vectors comprising SMN1 expression cassettes, and in vivo evaluation showed that these structural designs achieved desirable therapeutic effects at lower doses than reported in the literature. The influence of different administration modes on the treatment effect is evaluated, and the injection modes such as intrathecal injection, intraventricular injection, intravenous injection and the like in an animal model can reach better treatment effect. We also enhanced the safety of the designed drug in intravenous injection by introducing a human miR-122 target sequence. We also obtained two new AAV vector serotypes, AAV5 and AAVrh10, which can be used for SMA gene therapy. These all provide new options for gene therapy of SMA.

Disclosure of Invention

In view of this, the present invention provides a series of recombinant AAV viral vectors carrying an engineered SMN1 gene expression cassette and uses thereof in SMA therapy. The artificially designed SMN1 gene expression frame enables the SMN1 gene expression frame to efficiently express and generate SMN1 protein after entering a human body, and reduces the required dose of AAV virus for achieving the therapeutic effectiveness of SMA. Through the selection of recombinant AAV virus vector serotypes and the mutation modification of the inverted terminal repeat sequence of the main cis-acting element, the efficient transfer of the artificial design SMN1 gene expression frame to target organs and tissues is realized by selecting a proper AAV virus vector. The recombinant AAV vector containing the artificially designed SMN1 gene expression frame is transduced into an SMA model mouse, so that the survival time of the SMA mouse can be remarkably prolonged, the weight of the SMA mouse is increased, and the great development potential of an SMA therapeutic drug is shown.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an artificially designed SMN1 gene expression frame, which is characterized by comprising artificially designed sequence elements such as a promoter, a codon optimized SMN1 coding region sequence, a human miR-122 target sequence and the like and related combination forms thereof. Specifically, in examples 1 and 3,5 promoters were artificially designed, the difference in transduction efficiency of the 5 promoters in vitro and in vivo was evaluated using firefly luciferase (Fluc) reporter gene, and 2 promoters useful for SMN1 gene expression design were selected based on in vitro and in vivo experimental results. In example 4, the effect of SMN1 coding region sequence codon optimization on the effectiveness of an SMN1 expression cassette on SMA model animals was compared and it was found that the optimized SMN1 coding region sequence exhibited better effectiveness. In example 4, the influence of the introduction of the human miR-122 target sequence into the SMN1 gene expression frame on the action effect of the SMN gene expression frame is also evaluated, and as a result, the fact that the insertion of the human miR-122 target sequence into the expression frame can obviously reduce the expression of SMN1 protein in the liver and reduce the possible hepatotoxicity caused by the overexpression of SMN1 is found.

The invention provides a recombinant AAV virus carrying an artificial design SMN1 gene expression frame, which is characterized in that mutations such as deletion of a B-B 'sequence, a C-C' sequence, a D sequence and the like are carried out on an inverted terminal repeated sequence in the recombinant AAV virus, so that the recombinant AAV virus prepared in a transduction body has higher transduction efficiency and expresses SMN1 protein more rapidly. Specifically, in example 1, we constructed a variety of AAV plasmid vectors containing mutated inverted terminal repeats. In example 3, we compared the in vivo expression levels of the AAV constructed in example 1 and evaluated whether the mutant helped to increase the therapeutic effect of the AAV containing the SMN1 gene expression cassette on SMA model mice. As a result, the deletion of the B-B 'sequence, the C-C' sequence and the D sequence in the AAV inverted terminal repeated sequence is helpful for improving the in-vivo transduction efficiency of the recombinant AAV prepared by packaging and enhancing the effectiveness of designing SMA gene medicaments.

The recombinant AAV virus carrying the SMN1 gene expression frame is characterized by comprising multiple serotypes, such as AAV5, AAV9, AAVrh10 and the like, and AAV viruses of different serotypes can penetrate through a blood brain barrier to convey the SMN1 gene expression frame into neurons and express to generate SMN1 protein, so that the effect of treating SMA diseases is achieved. Specifically, in example 6, the effect of carrying SMN1 gene expression cassettes on SMA model mice was compared, and it was found that although there was a difference between serotypes, the survival of the model could be prolonged, the body weight of the model increased, and the potential for treating SMA disease was shown.

The SMA gene therapy medicine provided by the invention is characterized in that the medicine is a recombinant AAV virus carrying an artificial design SMN1 frame. The virus can be continuously expressed in SMA model mice for a long time to generate human SMN1 protein after once administration, and the physiological functions of the model mice are recovered, so that the survival period is prolonged.

The SMA gene therapy medicine provided by the invention is also characterized in that the administration mode of the medicine can be intravenous injection, intrathecal injection or intraventricular injection. Different injection modes can affect the dosage of the drug, but can prolong the survival time of the SMA model animal.

The important original experimental materials used in the invention are as follows:

pHelper plasmid, derived from AAV HELPER FREE SYSTEM (Agilent Technologies, USA), was purchased from the company AgilentTechnologies and stored. The plasmid contains adenovirus source auxiliary function genes E2A, E4, VA RNA and the like which are required by three-plasmid cotransfection HEK293 cells for preparing recombinant AAV.

The pAAV-RC plasmid, derived from AAV HELPER FREE SYSTEM (Agilent Technologies, USA), was purchased from the company AgilentTechnologies and stored. The pAAV-RC plasmid contains the Rep and cap genes of intact AAV2, providing the 4 Rep proteins (Rep 78, rep68, rep52, and Rep 40) and AAV2 coat proteins necessary for packaging in the preparation of recombinant AAV2 viruses by three plasmid co-transfection packaging.

PAAV-R2C5 plasmid was constructed and maintained by the company. The 2013 th to 4220 th sequences in the pAAV-RC plasmid are replaced by the Cap5 (2207 th to 4381 th sequences in genome) of the coat protein coding sequence in AAV genome (GenBank ID: NC_ 006152.1) by taking the pAAV-RC plasmid in AAV HELPER FREE SYSTEM (Agilent Technologies, U.S.) as a basic skeleton, so as to obtain the pAAV-R2C5 plasmid sequence. The simple construction process is that pAAV-R2C5 plasmid sequence information is obtained according to the thought, sequences between HindIII and PmeI cleavage sites in pAAV-R2C5 plasmid are artificially synthesized, and the sequences between HindIII and PmeI of pAAV-RC plasmid are replaced by the synthesized sequences by adopting a standard molecular cloning method, so that pAAV-R2C5 plasmid is obtained. The pAAV-R2C5 plasmid contains the complete cap gene of AAV5 and the Rep gene of AAV2, providing the 4 Rep proteins (Rep 78, rep68, rep52, and Rep 40) and AAV5 coat proteins necessary for viral packaging in the preparation of recombinant AAV5 virus by three plasmid co-transfection packaging.

PAAV-R2C9 plasmid was constructed and maintained by the company. The 2013 th to 4220 th bit sequence in the pAAV-RC plasmid is replaced by AAV9 coat protein coding sequence (GenBank ID: AY 530579) by taking the pAAV-RC plasmid in AAV HELPER FREE SYSTEM (Agilent Technologies, U.S.) as a basic skeleton, thus obtaining the pAAV-R2C9 plasmid. The simple construction process is that pAAV-R2C9 plasmid sequence information is obtained according to the thought, sequences between HindIII and PmeI cleavage sites in pAAV-R2C9 plasmids are artificially synthesized, and the pAAV-R2C9 plasmid is obtained by replacing sequences between the HindIII and PmeI cleavage sites of the pAAV-RC plasmids by a standard molecular cloning method. The pAAV-R2C9 plasmid contains the complete cap gene of AAV9 and the Rep gene of AAV2, providing the 4 Rep proteins (Rep 78, rep68, rep52, and Rep 40) and AAV9 coat proteins necessary for packaging in the preparation of recombinant AAV9 virus by three plasmid co-transfection packaging.

PAAV-R2C10 plasmid was constructed and maintained by the company. The 2013 th to 4220 th bit sequence in the pAAV-RC plasmid is replaced by an AAVrh10 coat protein coding sequence (GenBank ID: AY 243015.1) by taking the pAAV-RC plasmid in AAV HELPER FREE SYSTEM (Agilent Technologies, U.S.) as a basic skeleton, so as to obtain the pAAV-R2C10 plasmid. The simple construction process is that pAAV-R2C10 plasmid sequence information is obtained according to the thought, hindIII-PmeI restriction enzyme sites in pAAV-R2C10 plasmid are artificially synthesized, and pAAV-R2C10 plasmid is obtained by replacing the sequence between the HindIII-PmeI restriction enzyme sites of pAAV-RC plasmid with the synthesized sequence by adopting a standard molecular cloning method. The pAAV-R2C10 plasmid contains the complete cap gene of AAVrh10 and the Rep gene of AAV2, providing the 4 Rep proteins (Rep 78, rep68, rep52, and Rep 40) and AAVrh10 coat proteins necessary for packaging in the preparation of recombinant AAVrh10 virus by three plasmid cotransfection packaging.

The pAAV-DJ plasmid, comprising the complete AAVDJ cap gene and the Rep gene of AAV2, provides the 4 Rep proteins (Rep 78, rep68, rep52 and Rep 40) and AAVDJ coat proteins necessary for packaging in the preparation of recombinant AAVDJ virus by three plasmid cotransfection packaging. Purchased from Cell Biolabs, usa, and stored.

Control mice, C57BL/6J mice, purchased from Fukan biotechnology Co., ltd., beijing, were used as wild type controls for animal experiments.

GM03813 cell line, from Coriell Cell Repository, from a cell line derived from a patient of type SMA I (Coovert DD, et al hum Mol Genet.1997; 6:1205-1214.). The cell lines of the present invention used as promoter screens for in vitro experiments.

SMN2 ^+/+,SMNΔ7^+/+,smn^+/- mice, available from the us Jackson laboratory laboratory under the mouse number 005025, were bred into 5 mice each, SMN2 ^+/+,SMNΔ7^+/+,smn^-/- mice, and used as animal evaluation models for designing SMA gene drugs. Model propagation and genotyping were described in the Jackson laboratory laboratory. The SMN2 ^+/+,SMNΔ7^+/+,smn^-/- mice are referred to in the examples as "SMA model mice" or "SMA mice".

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1pAAV2neo vector structure schematic. AAV vector pAAV2neo (Dong X, et al PLoS ONE.2010;5 (10): e 13479.) with both ITRs of 145bp wild-type ITRs maintained by this company. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. CMV promoter, human cytomegalovirus early promoter. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame. XhoI, kpnI, ecoRI, salI, bglII, bamHI and ApaI are both restriction sites.

FIG. 2pAAV2neo-Fluc vector structure schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. CMV promoter, human cytomegalovirus early promoter. Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 3 shows a schematic diagram of pAAV2neo-CAS-Fluc vector structure. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. CAS promoter, synthetic promoter designed artificially, with sequence information detailed in SEQ ID No.1.Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 4 shows the structure of pAAV2neo-CAT-Fluc vector. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. CAT promoter, a synthetic promoter designed artificially, has sequence information shown in SEQ ID No.2.Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 5pAAV2neo-CAR-Fluc vector structure schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. CAR promoter, artificially designed and synthesized promoter, and sequence information is shown in SEQ ID No.3.Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 6 shows the structure of pAAV2neo-CAP-Fluc vector. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. CAP promoter, a synthetic promoter, was designed artificially and the sequence information was shown in SEQ ID No.4.Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 7 shows the structure of pAAV2neo-CA-Fluc vector. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. CA promoter, human giant cell enhancer and chicken beta-actin promoter, and the sequence information is shown in SEQ ID No.5. Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 8pscAAV-CA-Fluc vector structure schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. Delta ITR, deletion of the inverted terminal repeat of the D sequence, sequence information detailed in SEQ ID No.6.CA promoter, human cytomegalovirus gene enhancer and chicken beta-actin promoter, and the sequence information is shown in SEQ ID No.5.Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 9pscAAV-CAR-Fluc vector structural schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. Delta ITR, deletion of the inverted terminal repeat of the D sequence, sequence information detailed in SEQ ID No.6.CAR promoter, artificially designed promoter, with sequence information shown in SEQ ID No.3.Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 10pscAAV-U-CAR-Fluc vector structural schematic. U-ITR, deletion of the inverted terminal repeats of the B-B 'and C-C' sequences, sequence information detailed in SEQ ID No.8. DeltaU-ITR, the U-ITR sequence of the D sequence is deleted, and the sequence information is shown in SEQ ID No.10.CAR promoter, artificially designed promoter, with sequence information shown in SEQ ID No.3.Fluc, firefly luciferase gene coding sequence. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 11pscAAV-CA-SMN1 vector structure schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. Delta ITR, deletion of the inverted terminal repeat of the D sequence, sequence information detailed in SEQ ID No.6.CA promoter, human cytomegalovirus gene enhancer and chicken beta-actin promoter, and the sequence information is shown in SEQ ID No.5.SMN1, human motor neuron survival gene 1 coding sequence, and sequence information is shown in SEQ ID No.12.BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 12pscAAV-CA-coSMN1 vector structure schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. Delta ITR, deletion of the inverted terminal repeat of the D sequence, sequence information detailed in SEQ ID No.6.CA promoter, human giant cell enhancer and chicken beta-actin promoter, and the sequence information is shown in SEQ ID No.5.coSMN 1A coding sequence of human motor neuron survival gene 1 with optimized human expression, and sequence information is shown in SEQ ID No.13.BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 13pscAAV-CAR-SMN1 vector structural schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. Delta ITR, deletion of the inverted terminal repeat of the D sequence, sequence information detailed in SEQ ID No.6.CAR promoter, artificially designed promoter sequence, with sequence information shown in SEQ ID No.3.SMN1, human motor neuron survival gene 1 coding sequence, and sequence information is shown in SEQ ID No.12.BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 14pscAAV-CAR-coSMN1 vector structural schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. Delta ITR, deletion of the inverted terminal repeat of the D sequence, sequence information detailed in SEQ ID No.6.CAR promoter, artificially designed promoter sequence, with sequence information shown in SEQ ID No.3.coSMN 1A coding sequence of human motor neuron survival gene 1 with optimized human expression, and sequence information is shown in SEQ ID No.13.BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 15pscAAV-U-CAR-coSMN vector structure schematic. U-ITR, deletion of the inverted terminal repeats of the B-B 'and C-C' sequences, sequence information detailed in SEQ ID No.8. DeltaU-ITR, the U-ITR sequence of the D sequence is deleted, and the sequence information is shown in SEQ ID No.10. CAR promoter, artificially designed promoter, with sequence information shown in SEQ ID No.3.coSMN 1A coding sequence of human motor neuron survival gene 1 with optimized human expression, and sequence information is shown in SEQ ID No.13.BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 16pscAAV-CAR-SMN1-122T vector structural schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. Delta ITR, deletion of the inverted terminal repeat of the D sequence, sequence information detailed in SEQ ID No.6.CAR promoter, artificially designed promoter sequence, with sequence information shown in SEQ ID No.3.SMN1, human motor neuron survival gene 1 coding sequence, and sequence information is shown in SEQ ID No.12.miR-122T, a target sequence completely complementary to human miR-122. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 17pscAAV-CAR-coSMN1-122T vector structural schematic. ITR, INVERTED TERMINAL REPEAT, an inverted terminal repeat of 145bp in length. Delta ITR, deletion of the inverted terminal repeat of the D sequence, sequence information detailed in SEQ ID No.6.CAR promoter, artificially designed promoter sequence, with sequence information shown in SEQ ID No.3.coSMN 1A coding sequence of human motor neuron survival gene 1 with optimized human expression, and sequence information is shown in SEQ ID No.13.miR-122T, a target sequence completely complementary to human miR-122. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 18 pscAAV-U-CAR-coSMN-122T vector structural schematic. U-ITR, deletion of the inverted terminal repeats of the B-B 'and C-C' sequences, sequence information detailed in SEQ ID No.8. DeltaU-ITR, the U-ITR sequence of the D sequence is deleted, and the sequence information is shown in SEQ ID No.10. CAR promoter, artificially designed promoter, with sequence information shown in SEQ ID No.3.coSMN 1A coding sequence of human motor neuron survival gene 1 with optimized human expression, and sequence information is shown in SEQ ID No.13.miR-122T, a target sequence completely complementary to human miR-122. BGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

FIG. 19 shows comparison of expression efficiencies of different promoters in HEK293 cells. The expression efficiency of different promoters was compared using firefly luciferase Fluc as a reporter gene. Packaging to obtain AAVDJ virus carrying Fluc expression frames regulated by different promoters. HEK293 cells were infected at a multiplicity of infection (muhiplieity of infection, MOI) of 1000 doses of infection, 3 replicates per virus. 48h after infection of the cells with the virus, the level of Fluc expression in the cells was measured using the Bright-Glo luciferase assay system (Promega, USA) and the results were expressed in relative light intensity units (RELATIVE LIGHT units, RLU). CA, transduced rAAVDJ-CA-Fluc virus cells; CAS, transducing rAAVDJ-CAS-Fluc virus cells; CAR, transducing rAAVDJ-CAR-Fluc virus cells; CAT, transducing rAAVDJ-CAT-Fluc virus cells; CAP, transduced rAAVDJ-CAP-Fluc virus cells.

FIG. 20 shows comparison of expression efficiencies of different promoters in GM03813 cells. The expression efficiency of different promoters was compared using firefly luciferase Fluc as a reporter gene. Packaging to obtain AAVDJ virus carrying Fluc expression frames regulated by different promoters. GM03813 cells were infected at a multiplicity of infection (muhiplieity of infection, MOI) of 1000 doses, 3 duplicate wells per virus. 48h after infection of the cells with the virus, the level of Fluc expression in the cells was measured using the Bright-Glo luciferase assay system (Promega, USA) and the results were expressed in relative light intensity units (RELATIVE LIGHT units, RLU). CA, transduced rAAVDJ-CA-Fluc virus cells; CAS, transducing rAAVDJ-CAS-Fluc virus cells; CAR, transducing rAAVDJ-CAR-Fluc virus cells; CAT, transducing rAAVDJ-CAT-Fluc virus cells; CAP, transduced rAAVDJ-CAP-Fluc virus cells.

FIG. 21 shows comparison of expression efficiencies of different promoters in livers of C57BL/6J mice. The expression efficiency of different promoters was compared using firefly luciferase Fluc as a reporter gene. AAV9 viruses carrying Fluc expression frames regulated by different promoters are prepared by packaging. The mice were injected into C57BL/6J mice via tail vein at a dose of 1X 10 ¹² vg (viral genome)/each virus, 5 mice per virus. After 4 weeks from virus injection, mice were sacrificed, livers were isolated, total tissue proteins were extracted using a tissue cell total protein extraction kit (Beijing plali Gene technologies Co., ltd.), and the protein concentration of the extracted total proteins was measured using a protein quantification kit (BCA method) (Beijing plali Gene technologies Co., ltd.). Based on the measured concentration, total protein was diluted to 0.5. Mu.g/. Mu.L, 20. Mu.L of protein solution was taken, and the level of Fluc expression in the cells was measured using the Bright-Glo luciferase assay system (Promega, USA), and the measurement result was expressed in relative light intensity units (RELATIVE LIGHT units, RLU). CA, transduced rAAV9-CA-Fluc virus mice; CAS, transduction rAAV9-CAS-Fluc virus mice; CAR, transduction rAAV9-CAR-Fluc virus mice; CAT, transduced rAAV9-CAT-Fluc virus mice; CAP, transduced rAAV9-CAP-Fluc virus mice.

FIG. 22 shows comparison of the expression efficiency of different promoters in the brain of C57BL/6J mice. The expression efficiency of different promoters was compared using firefly luciferase Fluc as a reporter gene. AAV9 viruses carrying Fluc expression frames regulated by different promoters are prepared by packaging. The mice were injected into C57BL/6J mice via tail vein at a dose of 1X 10 ¹² vg (viral genome)/each virus, 5 mice per virus. After 4 weeks from virus injection, mice were sacrificed, brain tissues were isolated, total tissue proteins were extracted using a tissue cell total protein extraction kit (Beijing plali Gene technologies Co., ltd.), and the protein concentration of the extracted total proteins was measured using a protein quantification kit (BCA method) (Beijing plali Gene technologies Co., ltd.). Based on the measured concentration, total protein was diluted to 0.5. Mu.g/. Mu.L, 20. Mu.L of protein solution was taken, and the level of Fluc expression in the cells was measured using the Bright-Glo luciferase assay system (Promega, USA), and the measurement result was expressed in relative light intensity units (RELATIVE LIGHT units, RLU). CA, transduced rAAV9-CA-Fluc virus mice; CAS, transduction rAAV9-CAS-Fluc virus mice; CAR, transduction rAAV9-CAR-Fluc virus mice; CAT, transduced rAAV9-CAT-Fluc virus mice; CAP, transduced rAAV9-CAP-Fluc virus mice.

FIG. 23 injection of recombinant AAV carrying SMN1 or coSMN gene expression cassettes extended the survival of SMA model mice. 6 different recombinant AAV viruses (AAV 9-CA-Fluc, AAV9-CAR-Fluc, scaV 9-CA-SMN1, scaV 9-CA-coSMN1, scaV 9-CAR-SMN1, scaV 9-CAR-coSMN 1) were injected tail intravenously into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5X 10 ¹³ vg (viral genome, vg), wherein AAV9-CA-Fluc and AAV9-CAR-Fluc were control viruses, each injected with 5 SMA model mice, and the age of the SMA mice at the time of injection was 1 day old. After virus injection, the survival of mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice injected with KO-AAV9-CA-Fluc virus; KO-AAV9-CAR-Fluc, SMA model mice injected with AAV9-CAR-Fluc virus; SMA model mice injected with scAAV9-CA-SMN1 virus with KO-AAV9-CA-SMN 1; SMA model mice injected with scAAV9-CA-coSMN virus with KO-AAV9-CA-coSMN 1; SMA model mice injected with scAAV9-CAR-SMN1 virus with KO-AAV9-CAR-SMN 1; KO-AAV9-CAR-coSMN1, SMA model mice injected with scaV 9-CAR-coSMN virus.

FIG. 24 changes in body weight of mice injected with SMA model carrying recombinant AAV of SMN1 or coSMN gene expression cassettes. 6. Different recombinant AAV viruses (AAV 9-CA-Fluc, AAV9-CAR-Fluc, scaV 9-CA-SMN1, scaV 9-CA-coSMN1, scaV 9-CAR-SMN1, scaV 9-CAR-coSMN 1) were injected tail intravenously into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5X 10 ¹³ vg (viral genome, vg), wherein AAV9-CA-Fluc and AAV9-CAR-Fluc were control viruses, each virus was injected into 5 SMA model mice, and the age of the SMA mice at the time of injection was 1 day old. After virus injection, mice were recorded for changes in body weight. WT, C57BL/6J wild type control mice; SMA model mice injected with KO-AAV9-CA-Fluc virus; KO-AAV9-CAR-Fluc, SMA model mice injected with AAV9-CAR-Fluc virus; SMA model mice injected with scAAV9-CA-SMN1 virus with KO-AAV9-CA-SMN 1; SMA model mice injected with scAAV9-CA-coSMN virus with KO-AAV9-CA-coSMN 1; SMA model mice injected with scAAV9-CAR-SMN1 virus with KO-AAV9-CAR-SMN 1; KO-AAV9-CAR-coSMN1, SMA model mice injected with scaV 9-CAR-coSMN virus.

FIG. 25 effect of addition of miR-122 target sequences to SMN1 or coSMN1 gene expression cassettes on survival of SMA model mice. 4 different recombinant AAV viruses (scAAV 9-CAR-SMN1, scAAV9-CAR-coSMN1, scAAV9-CAR-SMN1-122T, scAAV-CAR-coSMN 1-122T) were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5 x 10 ¹³ vg/kg (viral genome, vg), wherein the SMN1 or coSMN gene expression cassette of the scAAV9-CAR-SMN1-122T, scAAV9-CAR-coSMN1-122T virus contained a single fully base complementary human miR-122 target sequence, each virus injected into 5 SMA model mice, at an SMA age of 1 day of age at the time of injection. After virus injection, the survival of mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice injected with scAAV9-CAR-SMN1 virus with KO-AAV9-CAR-SMN 1; SMA model mice injected with scAAV9-CAR-coSMN virus with KO-AAV9-CAR-coSMN 1; SMA model mice injected with scAAV9-CAR-SMN1-122T virus; SMA model mice injected with scaV 9-CAR-coSMN1-122T virus, KO-AAV 9-CAR-coSMN-122T.

FIG. 26 influence of the addition of miR-122 target sequences to SMN1 or coSMN1 gene expression cassettes on weight change in SMA model mice. 4 different recombinant AAV viruses (scAAV 9-CAR-SMN1, scAAV9-CAR-coSMN1, scAAV9-CAR-SMN1-122T, scAAV-CAR-coSMN 1-122T) were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5 x 10 ¹³ vg/kg (viral genome, vg), wherein the SMN1 or coSMN gene expression cassette of the scAAV9-CAR-SMN1-122T, scAAV9-CAR-coSMN1-122T virus contained a single fully base complementary human miR-122 target sequence, each virus injected into 5 SMA model mice, at an SMA age of 1 day of age at the time of injection. After virus injection, the change in body weight of mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice injected with scAAV9-CAR-SMN1 virus with KO-AAV9-CAR-SMN 1; SMA model mice injected with scAAV9-CAR-coSMN virus with KO-AAV9-CAR-coSMN 1; SMA model mice injected with scAAV9-CAR-SMN1-122T virus; SMA model mice injected with scaV 9-CAR-coSMN1-122T virus, KO-AAV 9-CAR-coSMN-122T.

FIG. 27 changes in coSMN1 expression levels in SMA mice following transduction with a miR-122 target sequence virus. scAAV9-CAR-coSMN1 and scAAV9-CAR-coSMN1-122T recombinant AAV viruses were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) containing a single fully base complementary human miR-122 target sequence in the coSMN gene expression cassette of scAAV9-CAR-coSMN1-122T virus at a dose of 5 x 10 ¹³ vg/kg (viral genome), each virus injected with 5 SMA model mice, the SMA mice being 1 day old at the time of injection. After 3 months of virus injection, heart, liver, skeletal muscle, lung, spleen, kidney, brain and other tissues were isolated. Extracting total RNA of tissues, quantitatively detecting coSMN RNA copy number and GAPDH RNA copy number in the total RNA by PCR, and calculating the ratio of coSMN RNA copy number to GAPDH RNA copy number to represent the expression level of coSMN1 genes. KO, uninjected virus SMN2 ^+/+,SMNΔ7^+/+,smn^-/- control mice; SMA model mice injected with scAAV9-CAR-coSMN virus with KO-AAV9-CAR-coSMN 1; SMA model mice injected with scaV 9-CAR-coSMN1-122T virus, KO-AAV 9-CAR-coSMN-122T.

FIG. 28 effect of different forms of ITR structure virus on survival of SMA model mice. 4 different recombinant AAV viruses (scaV 9-CAR-coSMN1, scaV 9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1, scaV 9-U-CAR-coSMN 1-122T) were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) by tail vein at a dose of 5X10 ¹³ vg/kg (viral genome, vg), each virus being injected into 5 SMA model mice, the SMA mice being 1 day old at the time of injection. Wherein the scAAV9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T virus contains the ITR of normal AAV2 and the ITR of normal AAV2 lacking the D sequence (Δitr); the scAAV9-U-CAR-coSMN1, scAAV9-U-CAR-coSMN1-122T viruses contain AAV2 ITRs (U-ITRs) deleted B-B 'and C-C' sequences and AAV2 ITRs (Δu-ITRs) deleted D, B-B 'and C-C' sequences simultaneously. After virus injection, the survival of mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice injected with scAAV9-CAR-coSMN virus with KO-AAV9-CAR-coSMN 1; SMA model mice injected with scAAV9-CAR-coSMN1-122T virus with KO-AAV 9-CAR-coSMN-122T; SMA model mice injected with scAAV9-U-CAR-SMN1-122T virus; KO-AAV 9-U-CAR-coSMN-122T, SMA model mice injected with scaV 9-U-CAR-coSMN1-122T virus.

FIG. 29 effect of different forms of ITR structure virus on weight change in SMA model mice. 4 different recombinant AAV viruses (scaV 9-CAR-coSMN1, scaV 9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1, scaV 9-U-CAR-coSMN 1-122T) were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) by tail vein at a dose of 5X10 ¹³ vg/kg (viral genome, vg), each virus being injected into 5 SMA model mice, the SMA mice being 1 day old at the time of injection. Wherein the scAAV9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T virus contains the ITR of normal AAV2 and the ITR of normal AAV2 lacking the D sequence (Δitr); the scAAV9-U-CAR-coSMN1, scAAV9-U-CAR-coSMN1-122T viruses contain AAV2 ITRs (U-ITRs) deleted B-B 'and C-C' sequences and AAV2 ITRs (Δu-ITRs) deleted D, B-B 'and C-C' sequences simultaneously. After virus injection, the change in body weight of mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice injected with scAAV9-CAR-coSMN virus with KO-AAV9-CAR-coSMN 1; SMA model mice injected with scAAV9-CAR-coSMN1-122T virus with KO-AAV 9-CAR-coSMN-122T; SMA model mice injected with scAAV9-U-CAR-SMN1-122T virus; KO-AAV 9-U-CAR-coSMN-122T, SMA model mice injected with scaV 9-U-CAR-coSMN1-122T virus.

FIG. 30 shows coSMN changes in expression levels of SMA mice transduced with different forms of ITR construct virus. 4 different recombinant AAV viruses (scaV 9-CAR-coSMN1, scaV 9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1, scaV 9-U-CAR-coSMN 1-122T) were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) by tail vein at a dose of 5X 10 ¹³ vg/kg (viral genome, vg), each virus being injected into 5 SMA model mice, the SMA mice being 1 day old at the time of injection. Wherein the scAAV9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T virus contains the ITR of normal AAV2 and the ITR of normal AAV2 lacking the D sequence (Δitr); the scAAV9-U-CAR-coSMN1, scAAV9-U-CAR-coSMN1-122T viruses contain AAV2 ITRs (U-ITRs) deleted B-B 'and C-C' sequences and AAV2 ITRs (Δu-ITRs) deleted D, B-B 'and C-C' sequences simultaneously. After 3 months of virus injection, heart, liver, skeletal muscle, lung, spleen, kidney, brain and other tissues were isolated. Extracting total RNA of tissues, quantitatively detecting coSMN RNA copy number and GAPDH RNA copy number in the total RNA by PCR, and calculating the ratio of coSMN RNA copy number to GAPDH RNA copy number to represent the expression level of coSMN1 genes. KO, uninjected virus SMN2 ^+/+,SMNΔ7^+/+,smn^-/- control mice; SMA model mice injected with scAAV9-CAR-coSMN virus with KO-AAV9-CAR-coSMN 1; SMA model mice injected with scAAV9-CAR-coSMN1-122T virus with KO-AAV 9-CAR-coSMN-122T; SMA model mice injected with scAAV9-U-CAR-SMN1-122T virus; KO-AAV 9-U-CAR-coSMN-122T, SMA model mice injected with scaV 9-U-CAR-coSMN1-122T virus.

Figure 31 effect of different injection patterns on survival of SMA model mice. 2 different recombinant AAV viruses (scaV 9-CAR-coSMN1, scaV 9-CAR-coSMN 1-122T) were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) via 3 different injection modes, each virus injecting 5 SMA model mice each, the SMA mice being 1 day old at the time of injection. Wherein, the injection dose of the intravenous injection mode (IV) is 5×10 ¹³ vg/kg (viral genome, vg), the injection dose of the intrathecal injection mode (IT) is 1×10 ¹³ vg/kg (viral genome, vg), and the injection dose of the intraventricular injection mode (ICV) is 1×10 ¹³ vg/kg (viral genome, vg). After virus injection, the survival of mice was recorded. WT, C57BL/6J wild type control mice; KO-AAV9-CAR-coSMN (IV), SMA model mice injected intravenously with scaV 9-CAR-coSMN virus; KO-AAV9-CAR-coSMN1-122T (IV), SMA model mice injected intravenously with scaV 9-CAR-coSMN1-122T virus; KO-AAV9-CAR-coSMN (IT), SMA model mice injected intrathecally with scaV 9-CAR-coSMN virus; an SMA model mouse injected intrathecally with scAAV 9-CAR-coSMN-122T virus with KO-AAV 9-CAR-coSMN-122T (IT); KO-AAV9-CAR-coSMN1 (ICV), SMA model mice injected intraventricularly with scaV 9-CAR-coSMN virus; KO-AAV9-CAR-coSMN1-122T (ICV), SMA model mice injected intraventricularly with scaV 9-CAR-coSMN1-122T virus.

Figure 32 effect of different injection modes on weight change in SMA model mice. 2 different recombinant AAV viruses (scaV 9-CAR-coSMN1, scaV 9-CAR-coSMN 1-122T) were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) via 3 different injection modes, each virus injecting 5 SMA model mice each, the SMA mice being 1 day old at the time of injection. Wherein, the injection dose of the intravenous injection mode (IV) is 5×10 ¹³ vg/kg (viral genome, vg), the injection dose of the intrathecal injection mode (IT) is 1×10 ¹³ vg/kg (viral genome, vg), and the injection dose of the intraventricular injection mode (ICV) is 1×10 ¹³ vg/kg (viral genome, vg). After virus injection, the body weight of the mice was recorded. WT, C57BL/6J wild type control mice; KO-AAV9-CAR-coSMN (IV), SMA model mice injected intravenously with scaV 9-CAR-coSMN virus; KO-AAV9-CAR-coSMN1-122T (IV), SMA model mice injected intravenously with scaV 9-CAR-coSMN1-122T virus; KO-AAV9-CAR-coSMN (IT), SMA model mice injected intrathecally with scaV 9-CAR-coSMN virus; an SMA model mouse injected intrathecally with scAAV 9-CAR-coSMN-122T virus with KO-AAV 9-CAR-coSMN-122T (IT); KO-AAV9-CAR-coSMN1 (ICV), SMA model mice injected intraventricularly with scaV 9-CAR-coSMN virus; KO-AAV9-CAR-coSMN1-122T (ICV), SMA model mice injected intraventricularly with scaV 9-CAR-coSMN1-122T virus.

FIG. 33 results of comparison of coSMN expression levels in SMA mice by different injection modes. 2 different recombinant AAV viruses (scaV 9-CAR-coSMN1, scaV 9-CAR-coSMN 1-122T) were injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) via 3 different injection modes, each virus injecting 5 SMA model mice each, the SMA mice being 1 day old at the time of injection. Wherein the intravenous Injection (IV) has an injection dose of 5X 10 ¹³ vg/kg (viral genome, vg), the intrathecal Injection (IT) has an injection dose of 1X 10 ¹³ vg/kg (viral genome, vg), the intraventricular Injection (ICV) has an injection dose of 1X 10 ¹³ vg/kg (viral genome, vg). After 3 months of virus injection, heart, liver, skeletal muscle, lung, spleen, kidney, brain and other tissues were isolated. Extracting total RNA of tissues, quantitatively detecting coSMN RNA copy number and GAPDH RNA copy number in the total RNA by PCR, and calculating the ratio of coSMN RNA copy number to GAPDH RNA copy number to represent the expression level of coSMN1 genes. KO, uninjected virus SMN2 ^+/+,SMN Δ7^+/+,smn^-/- control mice; KO-AAV9-CAR-coSMN (IV), SMA model mice injected intravenously with scaV 9-CAR-coSMN virus; KO-AAV9-CAR-coSMN1-122T (IV), SMA model mice injected intravenously with scaV 9-CAR-coSMN1-122T virus; KO-AAV9-CAR-coSMN (IT), SMA model mice injected intrathecally with scaV 9-CAR-coSMN virus; an SMA model mouse injected intrathecally with scAAV 9-CAR-coSMN-122T virus with KO-AAV 9-CAR-coSMN-122T (IT); KO-AAV9-CAR-coSMN1 (ICV), SMA model mice injected intraventricularly with scaV 9-CAR-coSMN virus; KO-AAV9-CAR-coSMN1-122T (ICV), SMA model mice injected intraventricularly with scaV 9-CAR-coSMN1-122T virus.

Figure 34 effect of different AAV vector serotypes on SMA model mice survival following intravenous injection. 3 different recombinant AAV viruses (scaV 5-CAR-coSMN1, scaV 9-CAR-coSMN1, scAAVrh10-CAR-coSMN 1) were intravenously injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5X 10 ¹³ vg/kg (viral genome, vg), each virus injected into 5 SMA model mice, and the SMA mice were 1 day old at the time of injection. After virus injection, the survival of mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice of KO-AAV5-CAR-coSMN, injected intravenously with scAAV5-CAR-coSMN virus; SMA model mice of KO-AAV9-CAR-coSMN1, injected intravenously with scAAV9-CAR-coSMN virus; KO-AAVrh10-CAR-coSMN1, SMA model mice injected intravenously with scaV 9-CAR-coSMN virus.

Figure 35 effects of different AAV vector serotypes on SMA model mice body weight change following intravenous injection. 3 different recombinant AAV viruses (scaV 5-CAR-coSMN1, scaV 9-CAR-coSMN1, scAAVrh10-CAR-coSMN 1) were intravenously injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5X 10 ¹³ vg/kg (viral genome, vg), each virus injected into 5 SMA model mice, and the SMA mice were 1 day old at the time of injection. After virus injection, the body weight of the mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice of KO-AAV5-CAR-coSMN, injected intravenously with scAAV5-CAR-coSMN virus; SMA model mice of KO-AAV9-CAR-coSMN1, injected intravenously with scAAV9-CAR-coSMN virus; KO-AAVrh10-CAR-coSMN1, SMA model mice injected intravenously with scaV 9-CAR-coSMN virus.

Figure 36 effect of different AAV vector serotypes on SMA model mice survival following intrathecal injection. 3 different recombinant AAV viruses (scaV 5-CAR-coSMN1, scaV 9-CAR-coSMN1, scAAVrh10-CAR-coSMN 1) were intrathecally injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 1X 10 ¹³ vg/kg (viral genome), each virus injected into 5 SMA model mice, the SMA mice being 1 day old at the time of injection. After virus injection, the survival of mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice injected intrathecally with scAAV5-CAR-coSMN virus with KO-AAV5-CAR-coSMN 1; SMA model mice injected intrathecally with scAAV9-CAR-coSMN virus with KO-AAV9-CAR-coSMN 1; KO-AAVrh10-CAR-coSMN1, SMA model mice injected intrathecally with scaV 9-CAR-coSMN virus.

Figure 37 effect of different AAV vector serotypes on SMA model mice body weight change following intrathecal injection. 3 different recombinant AAV viruses (scaV 5-CAR-coSMN1, scaV 9-CAR-coSMN1, scAAVrh10-CAR-coSMN 1) were intrathecally injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 1X 10 ¹³ vg/kg (viral genome), each virus injected into 5 SMA model mice, the SMA mice being 1 day old at the time of injection. After virus injection, the body weight of the mice was recorded. WT, C57BL/6J wild type control mice; SMA model mice injected intrathecally with scAAV5-CAR-coSMN virus with KO-AAV5-CAR-coSMN 1; SMA model mice injected intrathecally with scAAV9-CAR-coSMN virus with KO-AAV9-CAR-coSMN 1; KO-AAVrh10-CAR-coSMN1, SMA model mice injected intrathecally with scaV 9-CAR-coSMN virus.

Figure 38 effect of different AAV vector serotypes on SMA model mice survival following intraventricular injection. 3 different recombinant AAV viruses (scaV 5-CAR-coSMN1, scaV 9-CAR-coSMN1, scAAVrh10-CAR-coSMN 1) were intraventrically injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 1X 10 ¹³ vg/kg (viral genome), each virus injected into 5 SMA model mice, and the SMA mice were 1 day old at the time of injection. After virus injection, the survival of mice was recorded. WT, C57BL/6J wild type control mice; KO-AAV5-CAR-coSMN1, SMA model mice injected intraventricularly with scaV 5-CAR-coSMN virus; KO-AAV9-CAR-coSMN1, SMA model mice injected intraventricularly with scaV 9-CAR-coSMN virus; KO-AAVrh10-CAR-coSMN1, SMA model mice injected intraventricularly with scaV 9-CAR-coSMN virus.

Figure 39 effect of different AAV vector serotypes on SMA model mice body weight change following intraventricular injection. 3 different recombinant AAV viruses (scaV 5-CAR-coSMN1, scaV 9-CAR-coSMN1, scAAVrh10-CAR-coSMN 1) were intraventrically injected into SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 1X 10 ¹³ vg/kg (viral genome), each virus injected into 5 SMA model mice, and the SMA mice were 1 day old at the time of injection. After virus injection, the body weight of the mice was recorded. WT, C57BL/6J wild type control mice; KO-AAV5-CAR-coSMN1, SMA model mice injected intraventricularly with scaV 5-CAR-coSMN virus; KO-AAV9-CAR-coSMN1, SMA model mice injected intraventricularly with scaV 9-CAR-coSMN virus; KO-AAVrh10-CAR-coSMN1, SMA model mice injected intraventricularly with scaV 9-CAR-coSMN virus.

Detailed Description

The invention discloses a series of recombinant adeno-associated viruses carrying an artificial design SMN1 gene expression frame, including virus design, miniprep and function verification, and the technical parameters can be properly improved by those skilled in the art by referring to the content of the text. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that variations and modifications can be made in the methods and applications described herein, and in the practice and application of the techniques of this invention, without departing from the spirit or scope of the invention. Wherein, unless otherwise specified, the various reagents involved in the examples are all commercially available.

The invention is further illustrated by the following examples:

EXAMPLE 1 plasmid vector construction

(1) Promoter design synthesis

Reference (Niwa H, et al Gene 1991; 108:193-200.) the truncated CAG promoter, designated CA promoter, was obtained by deleting a part of the chicken beta-actin promoter sequence from the CAG promoter based on the CAG promoter (consisting of CMV enhancer and chicken beta-actin promoter) in the mammalian expression vector pCAGGS vector (GenBank: LT 727518.1), taking into account the length of the sequence. Next, a partial sequence of the 5 '-untranslated region of the human SMN1 gene mRNA (GenBank: NM-001297715.1) was introduced at the 3' -end of the CA promoter sequence, resulting in a promoter named CAS. An intron sequence from 449 to 532 of the human RNA polymerase II 14.5kDa subunit gene (GenBank: Z23102.1) was introduced at the 3' end of the CA promoter sequence to give the designation CAT promoter. An intron sequence from 62804 to 62890 of the human TATA box binding protein-associated factor 1 gene (GenBank: NG_ 012771.2) was introduced 3' to the CA promoter sequence to give a promoter designated CAR. A partial sequence of the 5 '-untranslated region of the human phosphoglycerate kinase gene mRNA (GenBank: M34017.1) was introduced at the 3' -end of the CA promoter sequence, giving the name CAP promoter. The CAS promoter, CAT promoter, CAR promoter, CAP promoter and CA promoter were synthesized by Nanjing Jinsri Biotech company, the sequence information being CAS promoter (SEQ ID No. 1), CAT promoter (SEQ ID No. 2), CAR promoter (SEQ ID No. 3), CAP promoter (SEQ ID No. 4), CA promoter (SEQ ID No. 5). For convenience of subsequent cloning, the 5 'end of the promoter is designed to introduce XhoI (5' CTCGAG3 ') restriction enzyme site during sequence synthesis, and the 3' end of the promoter introduces KpnI (5 'GGTACC3') restriction enzyme site. The synthetic promoter sequences were cloned into pUC57 simple vectors (Nanjin Style Biotech, inc.), designated pUC57-CAS (containing CAS promoter), pUC57-CAT (containing CAT promoter), pUC57-CAR (containing CAR promoter), pUC57-CAP (containing CAP promoter) and pUC57-CA (containing CA promoter), respectively.

(2) Construction of Fluc reporter vector based on pAAV2neo (FIG. 1) maintained by Co., ltd.), the firefly luciferase gene Fluc was inserted between KpnI and BglII cleavage sites of pAAV2neo vector to obtain pAAV2neo-Fluc vector (FIG. 2). Specifically, two primers (Fluc-F and Fluc-R) were designed for PCR amplification using pGL4.14[ luc2/Hygro ] vector (purchased from Promega, USA) as a template to obtain a sequence fragment containing the Fluc coding region. The KpnI and BglII are digested by double enzyme digestion and PCR amplification to obtain fragments, and the fragments are recovered for standby. The pAAV2neo vector was digested with KpnI and BglII, linearized and recovered for use. After the two recovered fragments were ligated, E.coli JM109 competent cells (purchased from Dalianbao organism) were transformed, colonies were picked, plasmids were extracted, and the plasmid was identified by cleavage, to obtain pAAV2neo-Fluc vector.

Fluc-F 5’ataggtaccgccaccatggaagatgcc3’(SEQ ID No.16)

Fluc-R 5’attagatctttacacggcgatcttgcc3’(SEQ ID No.17)

The pAAV2neo-Fluc vector was digested with XhoI and KpnI to generate 7808bp and 778bp fragments, and the 7808bp vector fragment was recovered for use. The XhoI and KpnI double-enzyme fragments digested pUC57-CAS (containing CAS promoter), pUC57-CAT (containing CAT promoter), pUC57-CAR (containing CAR promoter), pUC57-CAP (containing CAP promoter) and pUC57-CA (containing CA promoter) vectors, resulting in two fragments of about 600bp and 2.7kb in size, and the promoter fragment of about 600bp in length was recovered. After the recovered 7808bp vector fragment and the recovered promoter fragment were ligated, E.coli JM109 competent cells (purchased from Dalianbao organism) were transformed, colonies were picked up, plasmids were extracted, and digested and identified, to obtain pAAV2neo-CAS-Fluc vector (FIG. 3), pAAV2neo-CAT-Fluc vector (FIG. 4), pAAV2neo-CAR-Fluc vector (FIG. 5), pAAV2neo-CAP-Fluc vector (FIG. 6) and pAAV2neo-CA-Fluc vector (FIG. 7), respectively.

Based on the 3' -terminal ITR sequence in AAV2 genome (GenBank No. AF043303), deletion of trs and D sequences in ITR sequences was reported in the literature (Wang Z, et al Gene Ther.2003; 10:2105-2111.) to give a ΔITR sequence (SEQ ID No. 6). To facilitate cloning, the sequence between 1392-2127bp (the sequence between ITR and SwaI cleavage site near BGH polyA) in pAAV2neo vector was fused to the ΔITR sequence to give the fused sequence ΔITR-BS (SEQ ID No. 7). BamHI and SwaI cleavage sites are added at both ends of the delta ITR-BS fusion sequence, and the mixture is synthesized by Nanjing Jinsri biotechnology Co., ltd, and cloned into pUC57 simple vector to obtain pUC 57-delta ITR-BS. BamHI and SwaI digested pUC57- ΔITR-BS vector, pAAV2neo-CAR-Fluc vector, pAAV2neo-CA-Fluc vector, and ΔITR-BS fragment, ITR sequence-cut pAAV2neo-CAR-Fluc vector fragment, ITR sequence-cut pAAV2neo-CA-Fluc vector fragment were recovered, respectively. E.coli JM109 competent cells (Takara Shuzo, dalian) were transformed by ligating the recovered ΔITR-BS fragment with the ITR sequence-deleted pAAV2neo-CAR-Fluc vector fragment or the ITR sequence-deleted pAAV2neo-CA-Fluc vector fragment, and pscAAV-CA-Fluc vectors (FIG. 8) and pscAAV-CAR-Fluc vectors (FIG. 9) were obtained by screening and identification, respectively.

U-ITR sequences (SEQ ID No. 8) were obtained by deleting B-B 'and C-C' sequences from the ITR sequences of AAV2 genome (GenBank No. AF043303) according to the patent (patent application No. CN 201510931560.3.) and literature (Zhou Q, et al Sci Rep.2017;7 (1): 5432.). To facilitate cloning, the sequence between 1392-2127bp (the sequence between ITR and SwaI cleavage site near BGH polyA) in the pAAV2neo vector was fused to the U-ITR sequence to give the fusion sequence U-ITR-BS (SEQ ID No. 9). BamHI and SwaI cleavage sites are added at two ends of the U-ITR-BS fusion sequence respectively, and then the fusion sequence is synthesized by Nanjing Jinsri biotechnology Co., ltd, and cloned into pUC57 simple vector to obtain pUC57-U-ITR-BS. Further deletion of the trs and D sequences in the U-ITR sequence gives a ΔU-ITR sequence (SEQ ID No. 10). To maintain the identity of the vector backbone sequence and the convenience of cloning, the sequence "5'-gctagaacaacaa-3'" was introduced at the 3' end of the DeltaU-ITR sequence to give the DeltaU-ITR-MX sequence (SEQ ID No. 11). XhoI and MfeI restriction sites are added at two ends of the delta U-ITR-MX sequence respectively, and then the sequence is synthesized by Nanjing Jinsri biotechnology Co., ltd, and cloned into pUC57 simple vector to obtain pUC 57-delta U-ITR-MX.

BamHI and SwaI digested pUC57-U-ITR-BS vector, pAAV2neo-CAR-Fluc vector, and the U-ITR-BS fragment and ITR sequence-cut pAAV2neo-CAR-Fluc vector fragment were recovered. The recovered U-ITR-BS fragment was ligated with the ITR sequence-deleted pAAV2neo-CAR-Fluc vector fragment to transform E.coli JM109 competent cells (Taobian, dalian), and pscAAV-U-CAR-Fluc-pre vector was obtained by screening and identification.

The pUC 57-DeltaU-ITR-MX vector, pscAAV-U-CAR-Fluc-pre vector, and the DeltaU-ITR-MX fragment and the pscAAV-U-CAR-Fluc-pre vector fragment with ITR sequence cut off were digested by MfeI and XhoI double digestion. The recovered DeltaU-ITR-MX fragment was ligated with the pscAAV-U-CAR-Fluc-pre vector fragment with the ITR sequence cut off to transform E.coli JM109 competent cells (Takara Shuzo, dalian), and the pscAAV-U-CAR-Fluc vector was obtained by screening and identification (FIG. 10).

(3) SMN1 and coSMN1 Gene vectors

The NCBI GenBank database (https:// www.ncbi.nlm.nih.gov/gene /) was searched to obtain the SMN1 gene mRNA sequence (GenBank: NM-000344.3). The coding region sequence of the SMN1 protein is obtained by analysis from the mRNA sequence, and a 5' -GCCACC-3' "sequence is added to the 5' end of the coding sequence to obtain the SMN1 sequence (SEQ ID No. 12). Codon optimization is carried out on the SMN1 protein coding region sequence, and a 5' -GCCACC-3' "sequence is added at the 5' end of the optimized sequence to obtain a coSMN sequence (SEQ ID No. 13). The SMN1 sequence and coSMN sequence were synthesized by Nanjing Jinsri Biotechnology Co. For convenience of subsequent cloning, a KpnI (5 'GGTACC3') restriction site is introduced into the 5 'end of the promoter during sequence synthesis, and a BglII (5' AGATCT3 ') restriction site is introduced into the 3' end. The synthetic promoter sequences were cloned into pUC57 simple vector (Nanjin Style Biotechnology, inc.), designated pUC57-SMN1 (containing the SMN1 sequence) and pUC57-coSMN1 (containing the coSMN1 sequence), respectively.

PUC57-SMN1 vector was digested by double cleavage with KpnI and BglII to generate two fragments of about 900bp and 2.7kb in length, and an SMN1 sequence fragment of about 900bp in length was recovered. The pscAAV-CA-Fluc vector (FIG. 8) and pscAAV-CAR-Fluc vector (FIG. 9) were digested with KpnI and BglII double enzyme fragments, each yielding two fragments of about 6.7kb and 1.7kb in length, and the fragment of 6.7kb was recovered. The recovered SMN1 sequence fragments were ligated with the 6.7kb fragments recovered by digestion of pscAAV neo-CA-Fluc vector or pscAAV neo-CAR-Fluc vector, respectively, to identify pscAAV-CA-SMN1 vector (FIG. 11) and pscAAV-CAR-SMN1 vector (FIG. 13).

PUC57-coSMN1 vector was digested by KpnI and BglII double digestion to generate two fragments of about 900bp and 2.7kb in length, and coSMN sequence fragment of about 900bp in length was recovered. The KpnI and BglII double-digested pscAAV-CA-Fluc vector (FIG. 8), pscAAV-CAR-Fluc vector (FIG. 9), pscAAV-U-CAR-Fluc vector (FIG. 10) produced two fragments of about 6.7kb and 1.7kb each, and the fragment of 6.7kb was recovered. The recovered SMN1 sequence fragment was ligated with the 6.7kb fragment recovered by digestion of pscAAV neo-CA-Fluc vector or pscAAV neo-CAR-Fluc vector or pscAAV-U-CAR-Fluc vector, respectively, and pscAAV-CA-coSMN1 vector (FIG. 12), pscAAV-CAR-coSMN1 vector (FIG. 14) and pscAAV-U-CAR-coSMN vector (FIG. 15) were identified.

(4) Construction of miR-122 target sequence-containing vector

And adding a single target sequence which is completely complementary to the human miR-122 at the 3' end of the SMN1 sequence (SEQ ID No. 12) to obtain an SMN1-122T sequence (SEQ ID No. 14). A single human miR-122 fully-complementary target sequence is added to the 3' -end of coSMN sequence (SEQ ID No. 13) to obtain a coSMN1-122T sequence (SEQ ID No. 15). SMN1-122T sequence and coSMN-122T sequence were synthesized by Nanjing Jinsri Biotechnology Co. For convenience of subsequent cloning, a KpnI (5 'GGTACC3') restriction site is introduced into the 5 'end of the promoter during sequence synthesis, and a BglII (5' AGATCT3 ') restriction site is introduced into the 3' end. The synthetic promoter sequence was cloned into pUC57 simple vector (Nanjing Style Biotechnology Co.) and designated pUC57-SMN1-122T (containing SMN1-122T sequences) and pUC57-coSMN1-122T (containing coSMN1-122T sequences), respectively.

The pUC57-SMN1-122T vector was digested with KpnI and BglII by double digestion to generate two fragments of about 900bp and 2.7kb in length, and the SMN1-122T sequence fragment of about 900bp in length was recovered. The pscAAV-CAR-Fluc vector was digested by double enzyme digestion with KpnI and BglII (FIG. 9), yielding two fragments of about 6.7kb and 1.7kb each, and the fragment of 6.7kb was recovered. The recovered SMN1-122T sequence fragment was ligated with the 3835.7 kb fragment recovered by digestion with the pscAAV neo-CAR-Fluc vector, and identified to yield a pscAAV-CAR-SMN1-122T vector (FIG. 16).

PUC57-coSMN1-122T vector was digested by KpnI and BglII double digestion to generate two fragments of about 900bp and 2.7kb in length, and coSMN-122T sequence fragment of about 900bp in length was recovered. The pscAAV-CAR-Fluc vector (FIG. 9) and pscAAV-U-CAR-Fluc vector (FIG. 10) were digested with double enzyme fragments KpnI and BglII, producing two fragments of about 6.7kb and 1.7kb each, and the fragment of 6.7kb was recovered. The coSMN-122T sequence fragment obtained by recovery was ligated with the 6.7kb fragment recovered by digestion of pscAAV neo-CAR-Fluc vector or digestion of pscAAV-U-CAR-Fluc vector, and pscAAV-CAR-coSMN1-122T vector (FIG. 17) and pscAAV-U-CAR-coSMN1-122T vector (FIG. 18) were identified.

Example 2 recombinant AAV Virus preparation and assay

Reference (Xiao X, et al J Virol.1998;72 (3): 2224-2232.) uses a three-plasmid packaging system to package recombinant AAV virus, and uses cesium chloride density gradient centrifugation to isolate and purify the packaged AAV virus. Briefly, AAV vector plasmids (pAAV2neo-CA-Fluc、 pAAV2neo-CAT-Fluc、pAAV2neo-CAP-Fluc、pAAV2neo-CAS-Fluc、pAAV2neo-CAR-Fluc、pscAAV-CA-SMN1、pscAAV-CA-coSMN1、pscAAV-CAR-SMN1、pscAAV-CAR-coSMN1、 pscAAV-U-CAR-coSMN1、pscAAV-CAR-SMN1-122T、pscAAV-CAR-coSMN1-122T or pscAAV-U-CAR-coSMN 1-122T), helper plasmids (pHelper) and the Rep and Cap protein expression plasmids of AAV (pAAV-DJ, pAAV-R2C5, pAAV-R2C9 or pAAV-R2C 10) were mixed in a molar ratio of 1:1:1, HEK293 cells were transfected by the calcium phosphate method, and after 48h of transfection, the cells and culture supernatants were harvested and purified by cesium chloride density gradient centrifugation. And packaging and purifying to obtain AAVDJ-CA-Fluc、AAVDJ-CAS-Fluc、AAVDJ-CAT-Fluc、AAVDJ-CAR-Fluc、AAVDJ-CAP-Fluc、 AAV9-CA-Fluc、AAV9-CAS-Fluc、AAV9-CAT-Fluc、AAV9-CAR-Fluc、AAV9-CAP-Fluc、scAAV9-CA-SMN1、scAAV9-CAR-SMN1、scAAV9-CA-coSMN1、scAAV9-CAR-coSMN1、scAAV9-U-CAR-coSMN1、scAAV9-CAR-SMN1-122T、scAAV9-CA-coSMN1-122T、 scAAV9-U-CAR-coSMN1-122T、scAAV5-CAR-coSMN1 recombinant viruses, scAAVrh10-CAR-coSMN1 and the like.

And determining and preparing the genome titer of the AAV by adopting a quantitative PCR method. The specific process is as follows:

primers and probes for quantitative PCR detection were designed for identical sequences of 5 promoters (CA promoter, CAT promoter, CAS promoter, CAR promoter and CAP promoter):

CA-Q-F：5’-TGGGACTTTCCTACTTGGCA-3’(SEQ ID NO.18)

CA-Q-R：5’-GGAGAGTGAAGCAGAACGTG-3’(SEQ ID NO.19)

CA-Q-P：5’-ACCCATGGTCGAGGTGAGCCC-3’(SEQ ID NO.20)

CA-Q-F and CA-Q-R are primers and CA-Q-P is a probe. The 5 'end of the probe is marked by FAM fluorescent protein, and the 3' end is connected with BlackBerry quencher. Primers and probes were synthesized from Thermofisher Scientific. Specifically amplifying a fragment with the length of 89bp in the same sequence of a CA promoter and a CAR promoter by taking CA-Q-F and CA-Q-R as primers, adopting a TaqMan Probe binding method, taking a pAAV2neo-CA-Fluc plasmid with the copy number of 10 ⁸ per milliliter and a sample diluted by a gradient of 10 times as many as the pAAV2neo-CA-Fluc plasmid as a standard substance, adopting a Premix Ex Taq (Probe qPCR) reagent (Takara, dalian, china), and detecting the virus genome titer by using a fluorescent quantitative PCR instrument (model: ABI 7500fast, ABI). The procedure is described in the Premix Ex Taq (ProbeqPCR) reagent instructions. Methods for the treatment of viruses are described in the literature (Aurnhammer C, et al hum Gene Ther methods.2012;23 (1): 18-28.).

Example 3 internal and external evaluation experiments of Starter

(1) In vitro evaluation experiment

Since AAVDJ vectors have high transduction activity on various cells in vitro (Grimm D, et al J Virol.2008; 82:5887-5911.) we packaged the Fluc gene expression cassettes (pAAV 2neo-CA-Fluc, pAAV2neo-CAT-Fluc, pAAV2neo-CAP-Fluc, pAAV2neo-CAS-Fluc, pAAV2 neo-CAR-Fluc) containing different promoters into AAVDJ viruses. HEK293 cells and GM03813 cell lines were selected for in vitro evaluation of the designed promoters. Wherein the HEK293 cells are derived from human embryonic kidney cells. GM03813 cell line was purchased from U.S. Coriell Cell Repository, a fibroblast line derived from SMA type I patients (Coovert DD, et al hum Mol Genet.1997; 6:1205-1214.). Both cells were evaluated for expression activity of the designed promoters in SMA patient and non-SMA patient derived cells, respectively.

HEK293 cells were seeded into 96-well cell culture plates. AAVDJ-CA-Fluc, AAVDJ-CAS-Fluc, AAVDJ-CAT-Fluc, AAVDJ-CAR-Fluc, AAVDJ-CAP-Fluc viruses are prepared to infect HEK293 cells at an infection dose of 1000 infection complex (muhiplieity of infection, MOI) respectively, and 3 multiple wells are infected with each virus. 48h after infection of the cells with the virus, the level of Fluc expression in the cells was measured using the Bright-Glo luciferase assay system (Promega, USA), the measurement results being expressed in relative light intensity units (RELATIVE LIGHT units, RLU), see Bright-Glo luciferase assay system instructions. The detection results are shown in FIG. 19. From the results in FIG. 19, it was found that Fluc was expressed at a significantly higher level after the rAAVDJ-CAR-Fluc virus transduced HEK293 cells than the remaining 4 viruses (AAVDJ-CA-Fluc, AAVDJ-CAS-Fluc, AAVDJ-CAT-Fluc and AAVDJ-CAP-Fluc). The expression level of Fluc after transduction of HEK293 cells by the remaining 4 viruses was AAVDJ-CA-Fluc > AAVDJ-CAP-Fluc > AAVDJ-CAT-Fluc > AAVDJ-CAs-Fluc in order from high to low.

Next, we infected the AAVDJ-CA-Fluc, AAVDJ-CAs-Fluc, AAVDJ-CAT-Fluc, AAVDJ-CAR-Fluc, AAVDJ-CAP-Fluc viruses prepared to GM03813 cells from SMA1 patient at an infectious dose of 1000 infectious complex (muhiplieity of infection, MOI), each virus infected 3 multiple wells. 48h after infection of the cells with the virus, the level of Fluc expression in the cells was measured using the Bright-Glo luciferase assay system (Promega, USA) and the results were expressed in relative light intensity units (RELATIVE LIGHT units, RLU). The detection results are shown in FIG. 20. From the results of FIG. 20, it was found that the Fluc expression levels after transduction of GM03813 cells by 5 viruses were lower than that of HEK293 cells transduced individually. Of the 5 viruses, rAAVDJ-CAR-Fluc virus transduced GM03813 cells had the highest level of Fluc expression, with the remaining 4 viruses being AAVDJ-CAT-Fluc > AAVDJ-CAS-Fluc > AAVDJ-CA-Fluc > AAVDJ-CAP-Fluc in order from high to low, different from their high and low order in HEK293 cells.

In summary, the highest expression efficiency of the CAR promoter was found in both HEK293 cells and GM03813 cells, suggesting that this promoter could be a candidate promoter for SMA gene therapy drug design.

(2) In vivo evaluation experiment

Based on in vitro evaluation experiments, we further packaged the Fluc gene expression cassettes regulated by the 5 promoters into AAV9 viruses, thus obtaining 5 viruses such as AAV9-CA-Fluc, AAV9-CAS-Fluc, AAV9-CAT-Fluc, AAV9-CAR-Fluc, AAV9-CAP-Fluc and the like. The virus preparation was as described in example 2. After virus preparation was completed, 5 viruses were injected into C57BL/6J mice (available from Fukan Biotechnology Co., beijing) by tail vein at a dose of 1X 10 ¹² vg (viral genome)/each of 5 mice. After 4 weeks from virus injection, mice were sacrificed, liver and brain tissues were isolated, total tissue proteins were extracted using a tissue cell total protein extraction kit (Beijing plali Gene technologies Co., ltd.), and the protein concentration of the extracted total proteins was measured using a protein quantification kit (BCA method) (Beijing plali Gene technologies Co., ltd.). Based on the measured concentration, total protein was diluted to 0.5. Mu.g/. Mu.L, 20. Mu.L of protein solution was taken, and the level of Fluc expression in the cells was measured using the Bright-Glo luciferase assay system (Promega, USA), and the measurement result was expressed in relative light intensity units (RELATIVE LIGHT units, RLU). The detection procedure is shown in the Bright-Glo luciferase detection System instructions. The levels of Fluc expression of the 5 viruses in liver and brain tissues are shown in fig. 21 (liver) and fig. 22 (brain), respectively. From the results of FIG. 21, it can be seen that the level of Fluc expression of the rAAV9-CAR-Fluc virus was highest after transduction of mouse livers by 5 viruses, significantly higher than that of the remaining 4 viruses. The level of Fluc expression of the remaining 4 viruses in the liver of the mice is AAV9-CAT-Fluc > AAV9-CA-Fluc > AAV9-CAS-Fluc > AAV9-CAP-Fluc in sequence from high to low. From the results of fig. 22, it is seen that similar to that in the liver, the level of Fluc expression in brain tissue, which is still the rAAV9-CAR-Fluc virus, is highest and significantly higher than the other 4 viruses. However, the expression level of the other 4 viruses is different from the expression level of the other 4 viruses in the liver, and the expression level of the Fluc of the other 4 viruses in brain tissues is specifically AAV9-CA-Fluc > AAV9-CAT-Fluc > AAV9-CAS-Fluc > AAV9-CAP-Fluc.

The in vivo evaluation experiment result shows that the expression level of the CAR promoter in the liver and brain tissues of the mice is obviously higher than that of other 4 promoters, and the CAR promoter can be used as a candidate promoter for SMA gene drug design.

And the CAR promoter shows higher expression activity than the other 4 promoters in the in-vitro and in-vivo evaluation experiment by integrating the in-vivo and in-vitro evaluation experiment results, and provides a new promoter selection for SMA gene drug design. Because the promoter in AVXS-101 drug structure is similar to CA promoter, the SMN1 gene expression cassette regulated by CA promoter is used as a useful positive control in subsequent SMA drug effectiveness evaluation experiments.

EXAMPLE 4 in vivo efficacy evaluation experiment of SMA Gene drug

In the design process of the SMA gene medicine, the influence of 3 factors such as whether the SMN1 gene coding sequence is optimized, whether a human miR-122 target sequence is added in a gene expression frame, whether an AAV vector Inverted Terminal Repeat (ITR) is mutated and the like on the in vivo effectiveness and safety of the SMA gene medicine is mainly considered. SMN2 ^+/+,SMNΔ7^+/+,smn^-/- mice were selected for in vivo efficacy evaluation of SMA gene drugs. SMN2 ^+/+, SMNΔ7^+/+,smn^-/- mice were bred from mating SMN2 ^+/+,SMNΔ7^+/+,smn^+/- mice. SMN2 ^+/+,SMNΔ7^+/+,smn^+/- mice were purchased from the american Jackson laboratory laboratory under the mouse number 005025. Model propagation and genotyping were described in the Jackson laboratory laboratory.

Optimization of SMN1 Gene coding sequence effects on SMA Gene drug effectiveness

First we evaluated the effect of SMN1 gene coding sequence optimization on SMA gene drug effectiveness. 6 viruses such as AAV9-CA-Fluc, AAV9-CAR-Fluc, scaV 9-CA-SMN1, scaV 9-CAR-SMN1, scaV 9-CA-coSMN1, scaV 9-CAR-coSMN and the like are prepared. Wherein AAV9-CA-Fluc and AAV9-CAR-Fluc are single-stranded AAV viruses, and are Fluc gene expression cassettes regulated by CA promoter and CAR promoter respectively, which are used as negative controls for effectiveness evaluation. 4 viruses such as scAAV9-CA-SMN1, scAAV9-CAR-SMN1, scAAV9-CA-coSMN1, scAAV9-CAR-coSMN1 and the like are double-stranded AAV viruses, and are SMN1 gene expression frames or optimized coSMN gene expression frames regulated and controlled by a CA promoter and a CAR promoter respectively, and are used for comparing the influence of sequence optimization on the effectiveness of SMA gene medicaments.

6 Different recombinant AAV viruses (AAV 9-CA-Fluc, AAV9-CAR-Fluc, scaV 9-CA-SMN1, scaV 9-CA-coSMN1, scaV 9-CAR-SMN1, scaV 9-CAR-coSMN 1) were tail-injected into 1 day old SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5X 10 ¹³ vg (viral genome), with AAV9-CA-Fluc and AAV9-CAR-Fluc as control viruses, each injected with 5 SMA model mice. After virus injection, the survival of mice was recorded. The results are shown in FIG. 23. As can be seen from the results of FIG. 23, the survival of mice injected with AAV9-CA-Fluc and AAV9-CAR-Fluc did not exceed 15 days, in agreement with the literature report (Le TT, et al hum Mol Genet.2005;14 (6): 845-857.). Whereas SMA model mice injected with scAAV9-CA-SMN1, scAAV9-CA-coSMN1, scAAV9-CAR-SMN1, scAAV9-CAR-coSMN1 virus all had an extended survival, mice injected with CAR promoter virus (scAAV 9-CAR-SMN1, scAAV9-CAR-coSMN 1) had longer survival than mice injected with CA promoter virus (scAAV 9-CA-SMN1, scAAV9-CA-coSMN 1) and mice injected with model mice containing optimized coSMN gene virus (scAAV 9-CA-coSMN1 or scAAV9-CAR-coSMN 1) had longer survival than the respective non-optimized carrying SMN1 gene virus (scAAV 9-CA-SMN1 or scAAV9-CAR-SMN 1). The results show that both the CAR promoter element and the SMN1 gene sequence optimization help to improve the therapeutic effect of the SMA gene therapy drug on the SMA animal model. Furthermore, as can be seen from the results of fig. 23, SMA model mice injected with scAAV9-CA-SMN1, scAAV9-CA-coSMN1, scAAV9-CAR-SMN1, scAAV9-CAR-coSMN virus had survival times shorter than wild-type C57BL/6J mice, but were not greatly different, indicating that the gene drug could significantly extend survival times of SMA model mice.

Meanwhile, we recorded the changes in body weight of mice injected with SMA model carrying SMN1 or coSMN gene expression cassette recombinant AAV virus (AAV 9-CA-Fluc, AAV9-CAR-Fluc, scAAV9-CA-SMN1, scAAV9-CA-coSMN1, scAAV9-CAR-SMN1, scAAV9-CAR-coSMN 1) at different time points. During the weight recording, we recorded the weight of only surviving mice, considering that it may appear that the existing experimental mice had died at the time point of recording, so the average of the weights of the experimental mice at each time point shown in the figure was actually the average of the weights of the surviving mice. The results are shown in FIG. 24. From the results of fig. 24, the weight gain rate of AAV9-CA-Fluc and AAV9-CAR-Fluc injected mice was significantly lower than that of SMA model mice and wild type mice injected with recombinant AAV viruses carrying SMN1 or coSMN1 gene expression cassettes (AAV 9-CA-Fluc, AAV9-CAR-Fluc, scAAV9-CA-SMN1, scAAV9-CA-coSMN1, scAAV9-CAR-SMN1, scAAV9-CAR-coSMN 1), and then dead without weight recordings, indicating that SMA model mice in vivo expressed Fluc genes failed to restore their physiological function. The weight gain speed of the SMA model mice injected with the scadAAV 9-CA-SMN1, the scadAAV 9-CA-coSMN1, the scadAAV 9-CAR-SMN1 and the scadAAV 9-CAR-coSMN1 viruses is consistent with that of wild mice, and no obvious difference is found among 4 viruses, so that the growth and development and weight gain of the SMA model mice can be effectively recovered after the viruses expressing the SMN1 proteins are injected.

(II) influence of miR-122 target sequence on SMA gene medicine effectiveness

Next, we compared the effect of miR-122 target sequence on SMA gene drug effectiveness. 4 viruses such as scAAV9-CAR-SMN1, scAAV9-CAR-coSMN1, scAAV9-CAR-SMN1-122T, scAAV 9-CAR-coSMN-122T and the like are prepared. Wherein scAAV9-CAR-SMN1 and scAAV9-CAR-coSMN1 respectively carry an SMN1 gene expression cassette and a coSMN gene expression cassette regulated by a CAR promoter, and do not contain a human miR-122 target sequence. scAAV9-CAR-SMN1-122T, scAAV-CAR-coSMN 1-122T carries the SMN1 gene expression cassette and coSMN gene expression cassette containing the human miR-122 target sequence, respectively, regulated by the CAR promoter, and contains the human miR-122 target sequence.

4 Different recombinant AAV viruses (scaV 9-CAR-SMN1, scaV 9-CAR-coSMN1, scaV 9-CAR-SMN1-122T and scaV 9-CAR-coSMN 1-122T) were injected tail intravenously with 1 day old SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5X 10 ¹³ vg/kg (viral genome, vg), each virus injected with 5 SMA model mice. After virus injection, the survival of mice was recorded. The results are shown in FIG. 25. From the results of fig. 25, it can be seen that the survival time of SMA model mice injected with scAAV9-CAR-SMN1-122T and scAAV9-CAR-coSMN1-122T viruses was longer than that of SMA model mice injected with scAAV9-CAR-SMN1 and scAAV9-CAR-coSMN1 viruses without human miR-122 target sequences, indicating that the addition of human miR-122 target sequences helped to increase the effectiveness of SMA gene therapy drugs in SMA model mice. Furthermore, from the results of fig. 25 we also know that SMA model mice injected with scAAV9-CAR-SMN1, scAAV9-CAR-coSMN1, scAAV9-CAR-SMN1-122T and scAAV9-CAR-coSMN1-122T viruses had survival times shorter than wild type C57BL/6J mice, but were not significantly different, indicating that 4 gene drugs could significantly extend survival times of SMA model mice.

Meanwhile, we recorded the changes in body weight of SMA model mice injected with 4 SMA gene therapy drugs (scAAV 9-CAR-SMN1, scAAV9-CAR-coSMN1, scAAV9-CAR-SMN1-122T and scAAV9-CAR-coSMN 1-122T) at different time points. During the weight recording, we recorded the weight of only surviving mice, considering that it may appear that the existing experimental mice had died at the time point of recording, so the average of the weights of the experimental mice at each time point shown in the figure was actually the average of the weights of the surviving mice. The results are shown in FIG. 26. From the results of fig. 26, it can be seen that the weight gain rate of SMA model mice injected with scAAV9-CAR-SMN1, scAAV9-CAR-coSMN1, scAAV9-CAR-SMN1-122T and scAAV 9-CAR-coSMN-122T virus was identical to that of wild type mice, and no significant difference was seen between the 4 viruses, indicating that the growth and weight gain of SMA model mice could be effectively recovered after injection of SMN1 protein-expressing viruses.

We further examined the effect of adding miR-122 target sequences to coSMN gene expression cassettes on coSMN1 gene expression. After 3 months of virus injection, 1 mouse was sacrificed from each of scAAV9-CAR-coSMN1 and scAAV 9-CAR-coSMN-122T virus injection groups, organs such as heart, liver, skeletal muscle, spleen, lung, brain and kidney were isolated, total RNAs of the various organs were extracted, coSMN RNA copy number and mouse GAPDH RNA (glyceraldehyde-3-phosphate dehydrogenase RNA) copy number in the total RNAs were quantitatively PCR-determined, copy numbers were expressed as Ct values, differences between Ct values of coSMN RNA and mouse GAPDH RNA were calculated, and powers of Ct value differences for 2 represent relative expression levels of coSMN RNA. For detection, SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/-) without virus injection were used as controls. No change in SMN1 gene expression was detected in the present invention, and the main consideration was that the SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/-) contained human smN2 gene (Monani UR, et al, hum Mol Genet.2000;9 (3): 333-339.) and human smN1 gene lacking exon 7 (Le TT, et al, hum Mol Genet.2005;14 (6): 845-857.) capable of expressing human SMN1 mRNA and SMN2 mRNA were identical to the SMN1 mRNA sequence produced by expression in the viral transgene carrying the SMN1 gene, and the quantitative PCR detection method was not effective. Therefore, the SMN1 gene expression levels before and after viral transduction were not examined in the present invention.

The quantitative PCR method determines Ct values of SMN1 RNA or coSMN RNA and mouse GAPDH RNA in total RNA. The specific process is as follows:

primers and probes for quantitative PCR detection were designed for coSMN RNA sequences:

coSMN1-Q-F：5’-CACCACCTCCAATCTGTCCT-3’(SEQ ID NO.21)

coSMN1-Q-R：5’-TAGTAGCCGGTGTGATAGCC-3’(SEQ ID NO.22)

coSMN1-Q-P：5’-ACGATGCCGATGCCCTGGGC-3’(SEQ ID NO.23)。

primers and probes for quantitative PCR detection were designed for mouse GAPDH RNA sequences:

GAPDH-Q-F：5’-AACGGATTTGGCCGTATTGG-3’(SEQ ID NO.24)

GAPDH-Q-R：5’-AATCTCCACTTTGCCACTGC-3’(SEQ ID NO.25)

GAPDH-Q-P：5’-CGCCTGGTCACCAGGGCTGC-3’(SEQ ID NO.26)

coSMN1-Q-F/coSMN1-Q-R and GAPDH-Q-F/GAPDH-Q-R as primers and coSMN-Q-P and GAPDH-Q-P as probes. The 5 'end of the probe is marked by FAM fluorescent protein, and the 3' end is connected with BlackBerry quencher. Primers and probes were synthesized from Thermofisher Scientific. Specifically amplifying fragments with the length of 97bp in the SMN1 sequence by using coSMN-Q-F and coSMN-Q-R as primers, specifically amplifying fragments with the length of 66bp in the GAPDH sequence by using GAPDH-Q-F and GAPDH-Q-R as primers, measuring the amplification Ct value (expressed as copy number) of SMN1 RNA, cosmN1 RNA and GAPDH RNA in a detection sample by adopting a One-step reaction TaqMan probe binding method, and detecting by using One STEP PRIMERSCRIPT RT-PCR Kit (PERFECT REAL TIME) reagent (Takara, dalian, china) by using a fluorescence quantitative PCR instrument (model: ABI 7500fast, ABI). The operation process is described in the specification of One STEP PRIMERSCRIPT RT-PCR Kit (PERFECT REAL TIME).

The quantitative PCR detection results are shown in FIG. 27. From the results of fig. 27, it can be seen that the injection of scAAV9-CAR-coSMN1 and scAAV9-CAR-coSMN1-122T virome mice had elevated levels of coSMN1 expression in organs such as myocardium, skeletal muscle, spleen, kidney, brain and lung, compared to non-injected viral SMA model mice (SMN 2 ^+/+, SMNΔ7^+/+,smn^-/-), demonstrating that 2 viruses were able to efficiently transduce systemic tissue organ expression to produce coSMN RNA molecules following intravenous injection. Further, AAV vectors are highly efficient in liver transduction when injected by intravenous drug delivery systems. The experimental result shows that the 3' UTR of coSMN gene expression frame is added into the target sequence of miR-122 highly expressed in liver to effectively inhibit coSMN gene expression (figure 27), reduce possible side effects caused by over-expression of SMN1 protein in liver and increase the effectiveness of gene medicine. The results of fig. 27 also show that no expression of coSMN gene was detected in SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/-), because coSMN gene is a codon-optimized human SMN1 gene coding sequence, and its DNA sequence is different from the human SMN1 RNA sequence produced by SMA model mice expression, so that probes and primers for quantitative PCR detection of the virus-carried human-optimized coSMN gene cannot recognize and bind to the human SMN1 RNA sequence produced by SMA model mice expression, and no detection signal, and also demonstrate that the quantitative PCR probes and primers employed in the present invention can specifically recognize and bind to the human SMN1 RNA sequence-optimized coSMN1 sequence, and the reliability of the detection results is high.

(III) Effect of AAV vector Inverted Terminal Repeat (ITR) mutation on the drug availability of SMA Gene finally, we compared the effect of AAV vector Inverted Terminal Repeat (ITR) mutation on the drug availability of SMA gene. 4 viruses such as scAAV9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1, scAAV9-U-CAR-coSMN1-122T and the like are prepared. Wherein scAAV9-CAR-coSMN1 and scAAV9-CAR-coSMN1-122T respectively carry a coSMN gene expression frame regulated by a CAR promoter and a coSMN gene expression frame containing a miR-122 target sequence, and the ITR sequences in AAV viruses are respectively a normal ITR sequence and a delta ITR sequence lacking a D sequence. While scAAV9-U-CAR-coSMN and scAAV 9-U-CAR-coSMN-122T carry the coSMN gene expression cassette regulated by the CAR promoter and coSMN gene expression cassette containing the miR-122 target sequence, respectively, AAV viral ITR sequences are U-ITR sequences deleted of B-B 'sequences and C-C' sequences and Δu-ITR sequences deleted of B-B 'sequences, C-C' sequences and D sequences, respectively.

4 Different recombinant AAV viruses (scaV 9-CAR-coSMN1, scaV 9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1 and scaV 9-U-CAR-coSMN 1-122T) were injected tail intravenously with 1 day old SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5X 10 ¹³ vg/kg (viral genome, vg), each virus injected with 5 SMA model mice. After virus injection, the survival of mice was recorded. The results are shown in FIG. 28. From the results of fig. 28, it can be seen that the survival time of SMA model mice injected with scAAV9-U-CAR-coSMN1 and scAAV 9-U-CAR-coSMN-122T virus was longer than that of SMA model mice injected with scAAV9-CAR-coSMN1 and scAAV 9-CAR-coSMN-122T virus, indicating that deletion of the B-B 'sequence and the C-C' sequence in the ITR sequence of AAV virus resulted in a U-ITR sequence that helps to increase the effectiveness of SMA gene therapy drugs in SMA model mice. Furthermore, from the results of fig. 28 we also know that SMA model mice injected with scAAV9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1 and scAAV9-U-CAR-coSMN1-122T virus had survival times shorter than wild type C57BL/6J mice, but were not significantly different, indicating that 4 gene drugs could significantly extend survival times of SMA model mice.

Meanwhile, we recorded the changes in body weight of SMA model mice injected with 4 SMA gene therapy drugs (scAAV 9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T, scAAV9-U-CAR-coSMN1, and scAAV9-U-CAR-coSMN 1-122T) at different time points. During the weight recording, we recorded the weight of only surviving mice, considering that it may appear that the existing experimental mice had died at the time point of recording, so the average of the weights of the experimental mice at each time point shown in the figure was actually the average of the weights of the surviving mice. The results are shown in FIG. 29. From the results in fig. 29, it was found that the weight gain rate of SMA model mice injected with scAAV9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1 and scAAV9-U-CAR-coSMN1-122T virus was identical to that of wild type mice, and that no significant difference was observed between the 4 viruses, indicating that the growth and weight gain of SMA model mice could be effectively recovered after injection of SMN1 protein-expressing viruses.

We further examined coSMN gene expression in different tissues of SMA model mice after injection of 4 SMA gene therapy drugs (scAAV 9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1 and scAAV9-U-CAR-coSMN 1-122T). After 3 months of virus injection, 1 mouse was sacrificed from each group, organs such as heart, liver, skeletal muscle, spleen, lung, brain and kidney were isolated, total RNAs of the various organs were extracted, coSMN RNA copy number and mouse GAPDH RNA copy number in the total RNAs were determined by quantitative PCR, copy numbers were expressed as Ct values, differences between Ct values of coSMN RNA and Ct values of mouse GAPDH RNA were calculated, and power of the Ct value differences for 2 was expressed as relative expression levels of coSMN RNA. For detection, SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/-) without virus injection were used as controls.

The Ct values of coSMN RNA and mouse GAPDH RNA in total RNA were determined by quantitative PCR method. The specific process is as follows:

coSMN1-Q-F：5’-CACCACCTCCAATCTGTCCT-3’(SEQ ID NO.21)

coSMN1-Q-R：5’-TAGTAGCCGGTGTGATAGCC-3’(SEQ ID NO.22)

coSMN1-Q-P：5’-ACGATGCCGATGCCCTGGGC-3’(SEQ ID NO.23)。

GAPDH-Q-F：5’-AACGGATTTGGCCGTATTGG-3’(SEQ ID NO.24)

GAPDH-Q-R：5’-AATCTCCACTTTGCCACTGC-3’(SEQ ID NO.25)

GAPDH-Q-P：5’-CGCCTGGTCACCAGGGCTGC-3’(SEQ ID NO.26)

The quantitative PCR detection results are shown in FIG. 30. From the results of fig. 30, it can be seen that the injection of scAAV9-CAR-coSMN1, scAAV9-CAR-coSMN1-122T, scAAV-U-CAR-coSMN 1 and scAAV9-U-CAR-coSMN1-122T virome mice had elevated coSMN1 expression levels in organs such as myocardium, skeletal muscle, spleen, kidney, brain and lung compared to non-injected viral SMA model mice (SMN 2 ^+/+, SMNΔ7^+/+,smn^-/-), demonstrating that 4 viruses were able to efficiently transduce systemic tissue organ expression to produce SMN1 RNA or coSMN RNA molecules following intravenous injection. In the brain, coSMN expression levels of mice injected with scAAV9-U-CAR-coSMN1 and scAAV9-U-CAR-coSMN1-122T virus groups are obviously higher than those of mice injected with scAAV9-CAR-coSMN1 and scAAV9-CAR-coSMN1-122T virus groups, which indicates that U-ITR can improve gene expression levels after AAV virus transduction, and is beneficial to improving the effectiveness of designing SMA gene drugs. Further, our experimental results also show that the expression level of coSMN1 gene in liver of mice injected with viruses containing miR-122 target sequences (scaAAV 9-CAR-coSMN1-122T and scaAAV 9-U-CAR-coSMN 1-122T) is significantly lower than that of mice injected with viruses not containing miR-122 target sequences (scaAAV 9-CAR-coSMN1 and scaAAV 9-U-CAR-coSMN 1), indicating that the addition of 3' UTR of coSMN1 gene expression cassette to the target sequence of miR-122 highly expressed in liver effectively inhibits coSMN1 gene expression in liver, reduces possible side effects caused by over-expression of SMN1 protein in liver, and increases the effectiveness of gene medicine.

In summary, in this example, we have analyzed the influence of 3 factors such as whether the SMN1 gene coding sequence is optimized, whether the human miR-122 target sequence is added to the gene expression cassette, whether the AAV vector Inverted Terminal Repeat (ITR) is mutated, etc. on the in vivo effectiveness and safety of SMA gene drugs by experimental comparison, and found that the optimization of the SMN1 gene coding sequence, the addition of the human miR-122 target sequence to the expression cassette, and the AAV vector Inverted Terminal Repeat (ITR) all contribute to improving the in vivo effectiveness of SMA gene drugs. The SMA drug structure thus designed may take into account 3 factors or 1 factor of 3 factors and 2 factor combinations of 3 factors simultaneously.

EXAMPLE 5 in vivo efficacy Effect of different modes of administration on SMA Gene drug

On the basis of verifying the effectiveness of the designed drug, we further compared the effect of different modes of administration on the in vivo effectiveness of the designed SMA gene drug. Two viruses, namely scAAV9-CAR-coSMN1 and scAAV9-CAR-coSMN1-122T, were prepared and injected into an SMA model mouse (SMN 2 ^+/+, SMNΔ7^+/+,smn^-/- mouse) in 3 different modes of administration, i.e., intravenous Injection (IV), intrathecal Injection (IT), and intraventricular Injection (ICV), respectively, and the survival time, weight change and coSMN1 expression level of the SMA model mouse between the different modes of injection were compared.

ScAAV9-CAR-coSMN1 or scAAV9-CAR-coSMN1-122T was injected into 1 day old SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) with 3 different modes of administration, i.e. Intravenous (IV), intrathecal (IT) and Intraventricular (ICV), each virus was injected into 5 mice by one injection. Intravenous (IV) was administered at a dose of 5X 10 ¹³ vg/kg, and Intrathecal (IT) and Intraventricular (ICV) injections were each administered at a dose of 1X 10 ¹³ vg/kg. After injection was completed, the survival of the mice was recorded. The results are shown in FIG. 31. From the results of fig. 31, although the injection dose of intrathecal injection and intraventricular injection was 5 times lower than that of intravenous injection, no significant difference was seen in the life span extension between the 3 injection mode mice. In addition, in 3 injection modes, the survival time of mice injected with the miR-122 target sequence virus is longer than that of mice injected with mice not containing the miR-122 target sequence virus, and the mice are consistent with the previous findings.

At the same time, we also recorded the body weight of mice injected with virus at different time points, and the results are shown in fig. 32. From the results shown in FIG. 32, after virus injection, the weights of the mice in the 3 injection modes all gradually increased along with the extension of time until the mice are not changed, and the weight change rule of the mice is consistent with that of the wild-type C57BL/6J mice, which indicates that the mice in the 3 injection modes can effectively recover the growth and development of the SMA model mice.

We further examined coSMN1 gene expression in different tissues of SMA model mice after injection of SMA gene drug (scAAV 9-CAR-coSMN1 or scAAV9-CAR-coSMN 1-122T) by 3 different injection modes (intravenous injection, intrathecal injection and intraventricular injection). After 3 months of virus injection, 1 mouse was sacrificed from each group, organs such as heart, liver, skeletal muscle, spleen, lung, brain and kidney were isolated, total RNAs of the various organs were extracted, coSMN RNA copy number and mouse GAPDH RNA copy number in the total RNAs were determined by quantitative PCR, copy numbers were expressed as Ct values, differences between Ct values of coSMN RNA and Ct values of mouse GAPDH RNA were calculated, and power of the Ct value differences for 2 was expressed as relative expression levels of coSMN RNA. For detection, SMA model mice (SMN 2 ^+/+,SMN Δ7^+/+,smn^-/-) without virus injection were used as controls. Specific detection procedures are detailed in example 5. The detection results are shown in FIG. 33. From the results of fig. 33, it can be seen that the expression level of coSMN1 in the brain of SMA model mice was significantly elevated by intrathecal and intraventricular injections compared to SMA model mice by intravenous injection, indicating that intrathecal and intraventricular injections are easier to transduce neurons than by intravenous injection. Furthermore, it was found that coSMN1 expression was also detected in tissues such as liver, skeletal muscle, and cardiac muscle of mice to which intrathecal injection and intraventricular injection were administered. Although the levels of tissue coSMN gene expression in the liver, skeletal muscle, cardiac muscle, etc., of mice were lower than those of intravenous administration, the differences were not great, consistent with the literature report (Armbruser N, et al mol Ther Methods Clin Dev.2016; 3:16060.) suggesting that AAV vector penetration of the blood brain barrier may be bi-directional. Our experimental results also show that the expression level of coSMN1 gene in the liver of mice injected with miR-122 target sequence virus (scaAAV 9-CAR-coSMN 1-122T) under 3 injection modes is obviously lower than that of mice injected with mice not containing miR-122 target sequence virus (scaAAV 9-CAR-coSMN1 and scaAAV 9-U-CAR-coSMN 1), which shows that the addition of 3' UTR of coSMN1 gene expression cassette into the target sequence of miR-122 highly expressed in the liver effectively inhibits coSMN1 gene expression in the liver, reduces possible side effects caused by over-expression of SMN1 protein in the liver, and increases the effectiveness of the gene medicine.

In summary, in this example, we compared the in vivo effectiveness impact of 3 different modes of administration (intravenous, intrathecal, and intraventricular) on the design of SMA gene drugs. The results show that the 3 administration modes can effectively prolong the survival time of the SMA model mice, increase the weight of the mice, and the effective dosages required by intrathecal injection and intraventricular injection are lower, thereby providing a new choice for the administration mode of the SMA gene medicine.

Example 6 in vivo efficacy Effect of different AAV vector serotypes on SMA Gene drugs

In this example, we compared the effect of different AAV vector serotypes on the in vivo effectiveness of designing SMA gene drugs. 3 kinds of viruses such as scAAV5-CAR-coSMN1, scAAV9-CAR-coSMN1, scAAVrh-CAR-coSMN and the like are prepared, and the 3 kinds of viruses are respectively injected into an SMA model mouse (SMN 2 ^+/+, SMNΔ7^+/+,smn^-/- mouse) in 3 different modes of administration such as intravenous Injection (IV), intrathecal Injection (IT), intraventricular Injection (ICV) and the like, and the survival time and the weight change of the SMA model mouse injected with different AAV serotypes under the same injection mode condition are compared.

Effect of AAV vector serotypes on in vivo SMA Gene drug administration by intravenous injection (one) scAAV5-CAR-coSMN1, scAAV9-CAR-coSMN1 or scAAVrh-CAR-coSMN 1 viruses were intravenously injected into 1 day old SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 5X 10 ¹³ vg/kg, with 5 mice per virus injection. After injection was completed, the survival of the mice was recorded. The results are shown in FIG. 34. From the results of FIG. 34, it was found that all of the 3 viruses were able to prolong their survival after injecting the SMA model mice, but the extent of survival was different for the SMA model mice with different AAV vector serotypes, AAV9 (scaV 9-CAR-coSMN 1) being the best, AAVrh10 (scAAVrh-CAR-coSMN 1) being the weakest, and AAV5 (scaV 5-CAR-coSMN) being the weakest. Nevertheless, the average survival of SMA model mice injected with scAAV5-CAR-coSMN virus was 285.5 days, significantly longer than the expected survival of SMA model mice (no more than 15 days), so both AAVrh10 and AAV9, including AAV5, could be candidates for SMA gene drug design.

At the same time, we also recorded the body weight of mice injected with virus at different time points, and the results are shown in fig. 35. From the results of fig. 35, it can be seen that the weight of mice was gradually increased with time after the injection of different serotypes of AAV viruses until the mice were not changed, consistent with the weight change rule of wild-type C57BL/6J mice, indicating that all 3 serotypes of AAV viruses (scAAV 5-CAR-coSMN1, scAAV9-CAR-coSMN1, and scAAVrh-CAR-coSMN 1) were able to effectively restore the growth of SMA model mice.

(II) in vivo Effect of AAV vector serotypes on SMA Gene drugs upon intrathecal administration scAAV5-CAR-coSMN1, scAAV9-CAR-coSMN1 or scAAVrh-CAR-coSMN 1 viruses were injected intrathecally into 1 day old SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 1X 10 ¹³ vg/kg, with 5 mice per virus injection. After injection was completed, the survival of the mice was recorded. The results are shown in FIG. 36. From the results in FIG. 36, it was found that the survival of the SMA model mice was prolonged by injecting the scAAV5-CAR-coSMN1, scAAV9-CAR-coSMN1 or scAAVrh-CAR-coSMN 1 virus, but the extent of prolongation of the survival of the SMA model mice was different from each other by the different AAV vector serotypes, AAV9 (scAAV 9-CAR-coSMN 1) had the best effect, AAVrh10 (scAAVrh 10-CAR-coSMN 1) times, and AAV5 (scAAV 5-CAR-coSMN) was the weakest. The average survival time of the SMA model mice injected with the scaV 5-CAR-coSMN1 virus is 299 days, which is significantly longer than the expected survival time of the SMA model mice (not more than 15 days), so that AAVrh10 and AAV9 including AAV5 can be used as candidate serotypes of SMA gene drug design.

At the same time, we also recorded the body weight of mice injected with virus at different time points, and the results are shown in fig. 37. From the results of fig. 37, it can be seen that the weight of mice gradually increases with time after the injection of different serotypes of AAV viruses until the mice are not changed, which is consistent with the weight change rule of wild type C57BL/6J mice, indicating that the growth and development of SMA model mice can be effectively restored after intrathecal injection of 3 serotypes of AAV viruses (scAAV 5-CAR-coSMN1, scAAV9-CAR-coSMN1, and scAAVrh-CAR-coSMN 1).

(III) in vivo Effect of AAV vector serotypes on SMA Gene drugs upon intraventricular administration scaV 5-CAR-coSMN1, scaV 9-CAR-coSMN1 or scAAVrh-CAR-coSMN 1 viruses were injected intraventricular into 1 day old SMA model mice (SMN 2 ^+/+,SMNΔ7^+/+,smn^-/- mice) at a dose of 1X 10 ¹³ vg/kg, with 5 mice per virus injection. After injection was completed, the survival of the mice was recorded. The results are shown in FIG. 38. From the results of fig. 38, it can be seen that all of the 3 viruses were able to prolong their survival after injecting SMA model mice, but there was a difference in the extent of prolongation of survival of SMA model mice by different AAV vector serotypes, AAV9 (scAAV 9-CAR-coSMN 1) and AAVrh10 (scAAVrh-CAR-coSMN 1) were equivalent in effect, with AAV5 (scAAV 5-CAR-coSMN 1) being the weakest. Nevertheless, the average survival of SMA model mice injected with scAAV5-CAR-coSMN virus was 304 days, significantly longer than the expected survival of SMA model mice (no more than 15 days), so both AAVrh10 and AAV9, including AAV5, could be candidates for SMA gene drug design.

At the same time, we also recorded the body weight of mice injected with virus at different time points, and the results are shown in fig. 39. From the results of FIG. 39, it can be seen that the weight of mice was gradually increased with time after the injection of AAV of different serotypes until the mice were not changed, consistent with the weight change rule of wild-type C57BL/6J mice, indicating that 3 AAV serotypes (scaAAV 5-CAR-coSMN1, scaAAV 9-CAR-coSMN1 and scAAVrh-CAR-coSMN 1) were able to effectively restore the growth of SMA model mice.

In summary, in this example, we compared the effect of 3 serotypes of AAV5, AAV9, and AAVrh10 on SMA gene therapy drug effectiveness. Although there is a certain difference in effectiveness between different serotypes, SMA gene drugs based on 3 serotypes of AAV can significantly prolong the survival of SMA animal models and restore the physiological function of the models. Furthermore, the 3 serotypes exhibit a similar law under 3 different modes of administration (intravenous injection, intrathecal injection and intraventricular injection), indicating that both serotypes AAV5 and AAVrh10, in addition to AAV9, can also be used in the design of SMA gene therapy drugs.

Claims

1. An optimized gene for encoding human SMN1 protein, wherein the SMN1 gene is a human motor neuron survival gene, and the gene is a nucleotide sequence shown as SEQ ID NO. 13.

2. A human motor neuron survival gene (SMN 1) expression cassette is characterized by comprising a promoter and a gene which is shown in SEQ ID NO. 13 and codes for human SMN1 protein; the SMN1 gene is a human motor neuron survival gene.

3. The SMN1 gene expression cassette of claim 2, wherein the expression cassette further carries a human miRNA target sequence.

4. The SMN1 gene expression cassette of claim 3, wherein the number of miRNA target sequences is 1, or wherein the number of miRNA target sequences is greater than 1 and greater than 1 target sequences are connected in series by a spacer sequence.

5. The SMN1 gene expression cassette of claim 3, wherein the human miRNA target sequence is a target sequence fully complementary to human miR-122.

6. The SMN1 gene expression cassette of claim 2, wherein said promoter is selected from the group consisting of SEQ ID No. 1,SEQ ID NO:2,SEQ ID NO:4 and SEQ ID No. 5.

7. The SMN1 gene expression cassette of claim 2, wherein the SMN1 gene expression cassette comprises an SMN1 coding sequence of SEQ ID No. 15 carrying a miR-122 target sequence.

8. The SMN1 gene expression cassette of claim 2, wherein the expression cassette comprises:

A promoter selected from the group consisting of the promoters shown in SEQ ID NO. 1,2,4 or 5; and

(II) the coding sequence of the human SMN1 gene shown in SEQ ID NO. 13; and

(III) human miR-122 target sequence.

9. A recombinant adeno-associated viral vector carrying the SMN1 gene expression cassette according to any one of claims 2-8.

10. The recombinant adeno-associated viral vector of claim 9, wherein the recombinant adeno-associated viral vector is a scAAV virus.

11. The recombinant adeno-associated virus vector of claim 10, wherein the recombinant adeno-associated virus comprises a 5'ITR sequence and a 3' delta ITR sequence; or the recombinant adeno-associated virus comprises a 5'U-ITR sequence and a 3'. DELTA.U-ITR sequence.

12. The recombinant adeno-associated viral vector of claim 9, wherein the recombinant adeno-associated viral vector serotype is selected from the group consisting of: AAV1, AAV2, AAV3B, AAV, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10.

13. The recombinant adeno-associated viral vector of claim 9, wherein the serotype is AAV5, AAV9, or AAVrh10.

14. The recombinant adeno-associated virus vector of any one of claims 9-13, wherein the recombinant adeno-associated virus vector comprises a single inverted terminal repeat mutant or 2 identical inverted terminal repeat mutants or 2 different inverted terminal repeat mutants.

15. The recombinant adeno-associated viral vector of claim 14, wherein said inverted terminal repeat mutant is selected from the group consisting of SEQ ID No.6, SEQ ID No.8, and SEQ ID No.10.

16. A genetic medicament comprising the gene expression cassette of any one of claims 2-8 or the recombinant adeno-associated viral vector of any one of claims 9-15.

17. The genetic drug of claim 16, wherein the drug is an intravenous drug, an intrathecal drug or an intraventricular drug.

18. Use of the recombinant adeno-associated viral vector of any one of claims 9-15 in the manufacture of a medicament for effectively alleviating or curing an adverse condition caused by mutation in the human motor neuron survival gene SMN 1.

19. The use of claim 18, wherein the medicament is an intravenous, intrathecal or intraventricular medicament.

20. The use of claim 18, wherein the medicament is a combination of intravenous administration and intrathecal or intraventricular administration.