CN114908045A - Application of nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and preparation thereof - Google Patents
Application of nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and preparation thereof Download PDFInfo
- Publication number
- CN114908045A CN114908045A CN202210527643.6A CN202210527643A CN114908045A CN 114908045 A CN114908045 A CN 114908045A CN 202210527643 A CN202210527643 A CN 202210527643A CN 114908045 A CN114908045 A CN 114908045A
- Authority
- CN
- China
- Prior art keywords
- layered double
- double hydroxide
- graphene quantum
- nano
- composite material
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0654—Osteocytes, Osteoblasts, Odontocytes; Bones, Teeth
-
- C—CHEMISTRY; METALLURGY
- C01—INORGANIC CHEMISTRY
- C01B—NON-METALLIC ELEMENTS; COMPOUNDS THEREOF; METALLOIDS OR COMPOUNDS THEREOF NOT COVERED BY SUBCLASS C01C
- C01B32/00—Carbon; Compounds thereof
- C01B32/15—Nano-sized carbon materials
- C01B32/182—Graphene
- C01B32/194—After-treatment
-
- C—CHEMISTRY; METALLURGY
- C01—INORGANIC CHEMISTRY
- C01G—COMPOUNDS CONTAINING METALS NOT COVERED BY SUBCLASSES C01D OR C01F
- C01G49/00—Compounds of iron
- C01G49/009—Compounds containing, besides iron, two or more other elements, with the exception of oxygen or hydrogen
-
- C—CHEMISTRY; METALLURGY
- C01—INORGANIC CHEMISTRY
- C01P—INDEXING SCHEME RELATING TO STRUCTURAL AND PHYSICAL ASPECTS OF SOLID INORGANIC COMPOUNDS
- C01P2004/00—Particle morphology
- C01P2004/01—Particle morphology depicted by an image
- C01P2004/03—Particle morphology depicted by an image obtained by SEM
-
- C—CHEMISTRY; METALLURGY
- C01—INORGANIC CHEMISTRY
- C01P—INDEXING SCHEME RELATING TO STRUCTURAL AND PHYSICAL ASPECTS OF SOLID INORGANIC COMPOUNDS
- C01P2004/00—Particle morphology
- C01P2004/01—Particle morphology depicted by an image
- C01P2004/04—Particle morphology depicted by an image obtained by TEM, STEM, STM or AFM
-
- C—CHEMISTRY; METALLURGY
- C01—INORGANIC CHEMISTRY
- C01P—INDEXING SCHEME RELATING TO STRUCTURAL AND PHYSICAL ASPECTS OF SOLID INORGANIC COMPOUNDS
- C01P2004/00—Particle morphology
- C01P2004/60—Particles characterised by their size
- C01P2004/64—Nanometer sized, i.e. from 1-100 nanometer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
- C12N2506/1346—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
Abstract
The invention discloses application of a nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and preparation thereof, and particularly discloses application of the nano layered double hydroxide/graphene quantum dot composite material in promoting mesenchymal stem cell osteogenic differentiation and application of the nano layered double hydroxide/graphene quantum dot composite material in preparing a medicament for repairing and regenerating bone defects. Compared with independent GQD and LDH, the nano layered double hydroxide/graphene quantum dot composite material LDH-GQD can effectively promote osteogenic differentiation of mesenchymal stem cells, and has a wide application prospect.
Description
Technical Field
The invention relates to preparation of a nano composite material, in particular to application of a nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and preparation thereof.
Background
In China, tens of millions of people suffer from diseases related to tissue and organ defects every year, and how to realize the repair and functional reconstruction of damaged tissue organs is one of the major scientific and technical problems to be urgently solved in clinical medicine. The repair and regeneration of bone defects are always a great problem to be solved clinically at present, and an ideal bone repair material needs to have excellent biocompatibility, mechanical property, biodegradability and osteogenesis inducing activity. The mesenchymal stem cells have good proliferation and multidirectional differentiation capacity, and simultaneously have strong self-renewal capacity, and can provide a good cell transplantation source for repairing and regenerating bone defects, but the osteogenic differentiation effect of the mesenchymal stem cells needs to be further enhanced.
Disclosure of Invention
In order to solve the above problems, the present invention aims to provide an application of a nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and a preparation method thereof.
The invention provides an application of a nano layered double hydroxide/graphene quantum dot composite material in promoting osteogenic differentiation of mesenchymal stem cells.
Further, the mesenchymal stem cell is a bone marrow, umbilical cord or adipose-derived mesenchymal stem cell.
The second aspect of the invention provides application of a nano layered double hydroxide/graphene quantum dot composite material in preparation of a bone defect repair and regeneration medicine.
In the application, the nano layered double hydroxide/graphene quantum dot composite material is obtained by adsorbing graphene quantum dots by nano layered double hydroxide;
the general formula of the nano layered double hydroxide is [ M ] 2+ (1-x) M 3+ x (OH) 2 ] x +[A n- ] x/n ·zH 2 O, wherein M 2+ Is a divalent metal cation, M 3+ Is a trivalent metal cation, A n- Is an anion with an interlayer valence of n, x is the molar ratio of trivalent cations to all cations, z is the number of crystal water among molecules of each nano-layered double hydroxide, and M is 2+ And M 3+ The salts formed are all soluble.
Further, said M 2+ Is Mg 2+ 、Zn 2+ Or Ca 2+ ；
The M is 3+ Is Al 3+ Or Fe 3+ ；
A is described n- Is Cl - Or NO 3 - ；
Preferably, x ═ 1:1 to 3: 1;
preferably, the mass ratio of the graphene quantum dots to the nano layered double hydroxide is 1:1-8: 1.
The third aspect of the invention provides a liquid preparation for promoting osteogenic differentiation of mesenchymal stem cells or bone defect repair and regeneration, which is characterized in that the liquid preparation comprises mesenchymal stem cells and a nano layered double hydroxide/graphene quantum dot composite material;
preferably, the concentration of the nano-layered double hydroxide/graphene quantum dot composite material in the liquid preparation is 1-50 μ g/mL;
preferably, the mesenchymal stem cell is a bone marrow, umbilical cord or adipose-derived mesenchymal stem cell.
The fourth aspect of the invention provides a preparation method of a nano-layered double hydroxide/graphene quantum dot composite material, which comprises the following steps:
(1) dissolving soluble divalent metal ion salt and soluble trivalent metal ion salt in water to prepare metal ion salt solution;
(2) use CO 2 The double distilled water is used as a solvent to prepare a NaOH solution;
(3)N 2 adding a metal ion salt solution into a vigorously stirred NaOH solution to obtain a first suspension;
(4) transferring the first suspension to a hydrothermal synthesis kettle, and heating for 14-18h at 80-120 ℃ to obtain a second suspension;
(5) drying the second suspension to obtain nano layered double hydroxide;
(6) and (3) incubating the nano layered double hydroxide and the graphene quantum dots at 4 ℃ overnight, and centrifuging and washing to remove unbound materials to obtain the nano layered double hydroxide/graphene quantum dot composite material.
Further, in the step (1), the divalent metal ion is Mg 2+ 、Zn 2+ And Ca 2+ Any one of (a);
in the step (1), the trivalent metal ion is Al 3+ Or Fe 3+ ；
Preferably, the soluble divalent metal ion salt is selected from any one of magnesium nitrate, zinc nitrate, calcium nitrate, magnesium chloride, zinc chloride and calcium chloride;
preferably, the soluble trivalent metal ion salt is selected from any one of aluminum nitrate, ferric chloride and aluminum chloride.
Further, the molar ratio of the divalent metal ions to the trivalent metal ions in the step (1) is 1:1 to 3: 1.
Further, the mass ratio of the graphene quantum dots to the nano layered double hydroxide in the step (6) is 1:1-8: 1;
preferably, the particle size of the graphene quantum dot is 3-5 nm.
Further, the concentration of the NaOH solution in the step (2) is 0.015-0.05M;
the rotation speed of the vigorous stirring in the step (3) is 400-1000 rpm.
The drying in the step (5) is vacuum drying;
the rotation speed of the incubation at 4 ℃ in the step (6) is 50-150 rpm.
The invention has the beneficial effects that:
the invention provides a nano layered double hydroxide/graphene quantum dot composite material LDH-GQD for promoting osteogenic differentiation of mesenchymal stem cells, and as shown in a cell survival rate detection experiment, alkaline phosphatase staining and alizarin red staining after cell osteogenic differentiation and real-time quantitative PCR detection of the expression of osteogenic differentiation genes, compared with the single GQD and LDH, the alkaline phosphatase and alizarin red staining are deeper, and the expression of genes ALP, OPG and COL1 related to osteogenic differentiation is adjusted upwards, so that the nano composite material LDH-GQD can more effectively promote osteogenic differentiation of mesenchymal stem cells, and has a wide application prospect.
Drawings
FIG. 1(A-C) is the scanning electron microscope morphology of the nanomaterials of example 1 of the invention, GQD, LDH and LDH-GQD;
FIG. 1(a) is an ultra-high transmission electron microscope profile of GQDs in example 1 of the present invention;
FIG. 1(D-F) is the surface potential distribution of the nanomaterials GQD, LDH and LDH-GQD in example 1 of the invention;
FIG. 2 is the cytotoxicity results (CCK8) at 24h, 48h and 72h after BMSC treatment with different concentrations of nanomaterials GQD, LDH and LDH-GQD in example 1 of the present invention; wherein the abscissa represents the concentration of the drug in each group, the ordinate represents the cell survival rate of BMSC, and the survival rate of the blank control group is set as 100%;
FIG. 3 shows the results of alkaline phosphatase staining and alizarin red staining after 7 days and 14 days of differentiation of BMSC treated with the nanomaterials GQD, LDH and LDH-GQD in example 1 of the present invention;
fig. 4 is a gene expression level histogram of osteogenesis-related genes OPG, ALP, COL1 after 7 days of differentiation of the nanomaterial GQD, LDH, and LDH-GQD-treated BMSC in example 1 of the present invention, in which the abscissa represents different material treatments, the ordinate represents relative expression levels, and the relative expression level of the control group is set to 1.
Detailed Description
In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the present invention easy to understand, the following embodiment and the accompanying drawings are used to specifically describe the preparation method of the nanocomposite material with the effect of promoting the osteogenic differentiation of the mesenchymal stem cells.
The Mesenchymal Stem Cell (MSC) is a stem cell, can be used for differentiating adult cells such as bone, cartilage, fat and the like in different culture systems, has the advantages of short experimental period, sensitive index, contribution to the standardization of experiments and the like when being used for experimental research, and mainly adopts the mesenchymal stem cell (BMSC) from rat bone marrow for experiments.
In the following examples, Graphene Quantum Dots (GQDs) used were purchased from tokyo jufeng nano corporation; BMSCs used were purchased from cantonese seikagaku bio; the high-sugar DMEM, fetal calf serum and penicillin/streptomycin (double antibody) are used as essential components of a cell culture medium, are used for maintaining normal growth of cells, are commercially available products and are purchased from Gibco company of America; dexamethasone, sodium ascorbate, beta-glycerophosphate and 1, 25-dihydroxyvitamin D3 used in the medium for osteogenic differentiation of BMSC were purchased from Merck Sigma-Aldrich, Germany. Other non-self-made reagents and raw materials are all general commercial products.
In the following examples, the preparation method of metal ion composition change is performed based on nano-Layered Double Hydroxide (LDH), and the BMSCs treated with a plurality of LDH materials are subjected to osteogenic differentiation, and experimental results show that the plurality of LDH materials have different degrees of effects of promoting osteogenic differentiation of the BMSCs, wherein one material synthesis method with the best effect is shown in example 1, and other types of materials are shown in examples 2-3. In addition, the composite proportion of LDH and GQD also adopts various modes, and experiments show that various composite proportions can effectively promote the productive differentiation function of BMSC, wherein two materials 1 are shown in example 1:1, other compounding ratios are shown in examples 4-5.
Example 1
The preparation method of the nano layered double hydroxide LDH and the nano composite material LDH-GQD comprises the following specific steps:
(1) preparing 60mL of metal ion salt solution by using 6mmol of magnesium nitrate and 2mmol of ferric nitrate, wherein Mg 2+ With Fe 3+ The molar ratio of (A) to (B) is 3: 1.
(2) Use CO 2 ddH of 2 A0.016M NaOH solution (40 mL) was prepared using O (double distilled water) as a solvent.
(3)N 2 60mL of the metal ion salt solution prepared in step (1) was added to 40mL of a 0.016M NaOH solution prepared in step (2) under vigorous stirring (1000 rpm) under an atmosphere to obtain a first suspension.
(4) And transferring the first suspension to a hydrothermal synthesis kettle, and heating for 16h at 100 ℃ to obtain a second suspension.
(5) And drying the second suspension in a vacuum drying oven to obtain the nano layered double hydroxide LDH.
(6) And (3) mixing the purchased graphene quantum dots GQD with the LDH obtained in the step (5) according to the mass ratio of 1:1, performing shaking table incubation at 4 ℃ overnight (the rotating speed is 100rpm), and centrifuging and washing the unbound material to obtain the nanocomposite LDH-GQD.
And (5) observing the surface morphology of the LDH obtained in the step (5) and the surface morphology of the LDH-GQD obtained in the step (6) by using a scanning electron microscope. The surface potentials of the individual materials GQD, LDH and nanocomposite LDH-GQD were measured with a nanometer particle sizer.
Fig. 1(a) and 1(a) are topographical views of individual GQDs purchased in the examples of the present invention, which show that the GQDs exhibit a uniform black dot-like distribution with a particle size of about 3 to 5 nm.
Fig. 1(B) is a scanning electron microscope morphology of nano-layered double hydroxide LDH in the example of the present invention. As shown in FIG. 1B, the nano-layered double hydroxide LDH has a better crystal structure, a hexagonal shape, a uniform material distribution, and a particle size of 100-120 nm.
Fig. 1(C) is a scanning electron microscope profile of the nanocomposite LDH-GQD in the examples of the present invention. As can be seen from the figure, LDH-GQD also has a hexagonal crystal structure, but the edges of the crystal structure are more dispersed due to the combination of the GQD, the material distribution is more uniform, and the particle size is 100-120 nm.
FIG. 1(D-E) is the surface potential distribution of the nanomaterials GQD, LDH and LDH-GQD in the examples of the present invention, from which it can be seen that the surface potential of the GQD is-21 mV, the surface potential of the LDH is +22.3mV and the surface potential of the LDH-GQD is-13.2 mV, indicating that LDH and GQD are effectively combined to form an LDH-GQD composite material.
Example 2
The difference from example 1 is that in step (1) magnesium nitrate is replaced by zinc nitrate, iron nitrate is replaced by aluminum nitrate, and Zn is added to the prepared metal ion salt solution 2+ With Al 3+ The molar ratio between them is 2: 1. The rest of the procedure was the same as in example 1. Finally, the LDH-GQD composite material is successfully obtained.
Example 3
The difference from example 1 is that in step (1), magnesium nitrate is replaced by calcium chloride, ferric nitrate is replaced by ferric chloride, and Ca in the prepared metal ion salt solution 2+ With Fe 3+ The molar ratio of (A) to (B) is 1: 1. The rest of the procedure was the same as in example 1. Finally, the LDH-GQD composite material is successfully obtained.
Example 4
The difference from example 1 is that GQD was mixed with LDH in a mass ratio of 8:1 in step (6). The rest of the procedure was the same as in example 1. Finally, the LDH-GQD composite material is successfully obtained.
Example 5
The difference from example 1 is that GQD was mixed with LDH in a mass ratio of 4:1 in step (6). The rest of the procedure was the same as in example 1. Finally, the LDH-GQD composite material is successfully obtained.
Example 6
First, cell survival rate detection (CCK method)
The operation steps of cell survival rate detection are as follows:
step one, rat bone marrow-derived mesenchymal stem cells (BMSCs) were cultured.
BMSC was plated on 96-well plates at 8000 plates/well in medium at 37 ℃ with 5% CO 2 Culturing for 18-24h under the condition for subsequent material treatment. The BMSC medium comprises the following raw materials: high-glucose DMEM; 10% fetal bovine serum. In this experiment, the incubation time was 24 h.
And step two, preparing three groups of solutions, wherein each group of solution is prepared into seven concentrations, namely a GQD solution, an LDH solution and an LDH-GQD solution. The concentration was 0.5. mu.g/mL, 1. mu.g/mL, 2.5. mu.g/mL, 5. mu.g/mL, 10. mu.g/mL, 20. mu.g/mL and 50. mu.g/mL in this order.
Step three, removing the supernatant of the BMSC cultured in the step one, adding GQD, LDH and LDH-GQD solutions with different concentrations prepared in the step two into each hole, respectively, culturing for 24h, 48h and 72h, adding 20 mu L of CCK8 solution into each hole, standing for 4h in a dark place, and measuring an OD (optical density) value at a wavelength of 450nm by using a microplate reader, wherein the detection result is shown in figure 2.
FIG. 2 shows the cytotoxicity results 24h, 48h and 72h after BMSC treatment with different concentrations of GQD, LDH and LDH-GQD nanomaterials in example 1 of the invention (CCK8 method). Wherein the abscissa represents the concentration of the drug in each group, the ordinate represents the cell survival rate of BMSC, and the survival rate of blank control group was set as 100%.
As can be seen from FIG. 2, when the concentrations were 0.5. mu.g/mL, 1. mu.g/mL, 2.5. mu.g/mL, 5. mu.g/mL, 10. mu.g/mL, and 20. mu.g/mL, the cell viability rate was not greatly different from that of the blank control group at 24h, 48h, and 72h after the treatment with GQD, LDH, and LDH-GQD groups. Cell viability decreased after 24h, 48h and 72h treatment with GQD, LDH and LDH-GQD groups as the concentration increased to 50 μ g/mL. Treatment concentrations below 50. mu.g/mL were shown to have no effect on cell proliferation of BMSCs, so subsequent experiments used a safe use concentration of 10. mu.g/mL.
Secondly, alkaline phosphatase for osteogenic differentiation and alizarin red staining
1. Alkaline phosphatase staining
BMSCs were seeded on 12-well plates at a plating density of 1X 10 5 /mL, with medium at 37 ℃ with 5% CO 2 Culturing for 18-24h under the condition, and enabling the cell fusion density to reach 70% for subsequent material treatment. The BMSC osteogenic differentiation medium comprises the following raw materials: high-glucose DMEM; 10% fetal bovine serum; 0.1 μmol/L dexamethasone; sodium ascorbate at 20. mu.g/mL; 10Mm beta-glycerophosphoric acid. GQD, LDH and LDH-GQD solutions were prepared in BMSC osteogenic differentiation medium so that the concentration of the material in each group was 10. mu.g/mL, and after 7 and 14 days of differentiation, the osteogenic differentiation effect was examined using alkaline phosphatase (ALP) activity after fixation with 4% paraformaldehyde.
FIGS. 3(A) and (B) upper row ALP staining after 7 days and 14 days of treatment of BMSC with GQD, LDH and LDH-GQD in example 1 of the present invention. From the figure, it can be seen that, morphologically, treatment with the addition of GQD and LDH can promote osteogenic differentiation of BMSC, the staining by alkaline phosphatase is deeper than that of the control group, and the staining by alkaline phosphatase of BMSC treated by LDH-GQD in the nano-complex group is strongly positive and most deeply colored, indicating that the BMSC has the strongest effect of promoting osteogenic differentiation.
2. Alizarin red staining
BMSCs were seeded on 12-well plates at a plating density of 1X 10 5 /mL, with medium at 37 ℃ with 5% CO 2 Culturing for 18-24h under the condition, and enabling the cell fusion density to reach 70% for subsequent material treatment. The BMSC osteogenic differentiation culture medium comprises the following raw materials: high-glucose DMEM; 10% fetal bovine serum; 0.1 μmol/L dexamethasone; sodium ascorbate at 20. mu.g/mL; 10Mm beta-glycerophosphoric acid. Preparing GQD, LDH and LDH-GQD solutions by using a BMSC osteogenic differentiation culture medium to ensure that the concentration of materials of each group is 10 mu g/mL, and detecting the osteogenic differentiation effect by using alizarin red staining after fixing with 4% paraformaldehyde after 7 days and 14 days of differentiation.
FIGS. 3(A) and (B) the bottom row is alizarin red staining after 7 days and 14 days of treatment of BMSC with GQD, LDH and LDH-GQD in example 1 of the present invention. Results show that after being treated by the single materials GQD and LDH, the positive staining of calcium nodules in alizarin red can be deepened compared with a control group, and the LDH-GQD treatment of the nano composite material can more effectively promote the alizarin red staining of osteogenic differentiation.
Third, real-time quantitative PCR detection of osteogenic differentiation gene expression
BMSCs were seeded on 12-well plates at a plating density of 1X 10 5 mL, in medium at 37 ℃ with 5% CO 2 Culturing for 18-24h under the condition, and enabling the cell fusion density to reach 70% for subsequent material treatment. The BMSC osteogenic differentiation medium comprises the following raw materials: high-glucose DMEM; 10% fetal bovine serum; 0.1 μmol/L dexamethasone; sodium ascorbate at 20. mu.g/mL; 10Mm beta-glycerophosphoric acid. Preparing GQD, LDH and LDH-GQD solutions by using BMSC osteogenic differentiation medium to enable the material concentration of each group to be 10 mu g/mL, detecting the gene expression level changes of osteogenic differentiation genes ALP, OPG and COL1 in BMSC treated by each group by using real-time quantitative PCR after 7 days and 14 days of differentiation, and taking Gapdh as an internal reference gene. The specific primer sequences are as follows: gapdh, top primer: GGTCGGTGTGAACGGATTTGG (SEQ ID NO.1), downstream primer: GCCGTGGGTAGAGTCATACTGGAAC (SEQ ID NO. 2); OPG, forward primer: CCGAATTGGCTGAGTGTTCTGGT (SEQ ID NO.3), downstream primer: CTTGCGAGCTGTGTCTCCGTTT (SEQ ID NO. 4); ALP, upstream primer: TCGATGGCTTTGGTACGGAG (SEQ ID NO.5), downstream primer: TGCGGGACATAAGCGAGTTT (SEQ ID NO. 6); COL1, upstream primer: AACTTTGCTTCCCAGATGTCC (SEQ ID NO.7), downstream primer: AGCCTCGGTGTCCCTTCA (SEQ ID NO. 8).
FIG. 4 is a bar graph of gene expression levels of osteogenic differentiation genes ALP, OPG, COL1 after 7 days of treatment of BMSC cells with GQD, LDH and LDH-GQD by real-time quantitative PCR detection in example 1 of the present invention. Where the abscissa represents different material treatments, the ordinate represents relative expression levels, and the relative expression level of the control group is set to 1.
As can be seen from fig. 4, compared with the control group, the gene expression levels of osteogenic differentiation genes ALP, OPG and COL1 can be promoted by adding GQD, LDH and LDH-GQD, wherein the effect of promoting the addition of nanocomposite LDH-GQD is most significant, which indicates that the nano-loading method has the best effect of promoting osteogenic differentiation of BMSC.
Fourth, the action and Effect of LDH-GQD in example 1
As can be seen from the experimental results of cell survival rate detection experiments, alkaline phosphatase and alizarin red staining, real-time quantitative PCR detection on expression of a pluripotent gene and the like, compared with the single GQD which is not carried by the nano-carrier LDH, the LDH-GQD prepared in example 1 can better promote differentiation of BMSC to osteogenesis, effectively increase staining of the alkaline phosphatase and alizarin, and up-regulate expression of bone-related genes ALP, OPG and COL1, so that the LDH-GQD prepared in example 1 has the advantage of promoting bone differentiation and has a wide application prospect.
The above embodiments are preferred examples of the present invention, and are not intended to limit the scope of the present invention.
SEQUENCE LISTING
<110> university of Tongji
<120> application of nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and application thereof
Preparation of
<130> CP122010282C
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence
<400> 1
ggtcggtgtg aacggatttg g 21
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence
<400> 2
gccgtgggta gagtcatact ggaac 25
<210> 3
<211> 23
<212> DNA
<213> Artificial sequence
<400> 3
ccgaattggc tgagtgttct ggt 23
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence
<400> 4
cttgcgagct gtgtctccgt tt 22
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence
<400> 6
<210> 7
<211> 21
<212> DNA
<213> Artificial sequence
<400> 7
aactttgctt cccagatgtc c 21
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence
<400> 8
agcctcggtg tcccttca 18
Claims (10)
1. An application of a nano layered double hydroxide/graphene quantum dot composite material in promoting mesenchymal stem cell osteogenic differentiation.
2. The use of claim 1, wherein the mesenchymal stem cells are bone marrow, umbilical cord or adipose-derived mesenchymal stem cells.
3. An application of a nano layered double hydroxide/graphene quantum dot composite material in preparing a bone defect repairing and regenerating medicine.
4. The use according to claim 1 or 3, wherein the nano-layered double hydroxide/graphene quantum dot composite material is obtained by adsorbing graphene quantum dots by nano-layered double hydroxide;
the nano layered double hydroxide has the general formula of [ M 2+ (1-x) M 3+ x (OH) 2 ] x +[A n- ] x/n ·zH 2 O, wherein M 2+ Is a divalent metal cation, M 3+ Is a trivalent metal cation, A n- Is an anion with the valence of n between layers, x is the molar ratio of trivalent cation to all cations, z is the number of crystal water between each nano-layered double hydroxide molecule, and M is 2+ And M 3+ The salts formed were all soluble.
5. Use according to claim 4, characterized in that said M is 2+ Is Mg 2+ 、Zn 2+ Or Ca 2+ ；
The M is 3+ Is Al 3+ Or Fe 3+ ；
A is described n- Is Cl - Or NO 3 - ；
Preferably, x ═ 1:1 to 3: 1;
preferably, the mass ratio of the graphene quantum dots to the nano layered double hydroxide is 1:1-8: 1.
6. A liquid preparation for promoting osteogenic differentiation of mesenchymal stem cells or promoting repair and regeneration of bone defects, which is characterized by comprising the mesenchymal stem cells and a nano layered double hydroxide/graphene quantum dot composite material;
preferably, the concentration of the nano-layered double hydroxide/graphene quantum dot composite material in the liquid preparation is 1-50 μ g/mL;
preferably, the mesenchymal stem cell is a bone marrow, umbilical cord or adipose-derived mesenchymal stem cell.
7. A preparation method of a nano layered double hydroxide/graphene quantum dot composite material is characterized by comprising the following steps:
(1) dissolving soluble divalent metal ion salt and soluble trivalent metal ion salt in water to prepare metal ion salt solution;
(2) use CO 2 The double distilled water is used as a solvent to prepare a NaOH solution;
(3)N 2 adding a metal ion salt solution into a vigorously stirred NaOH solution to obtain a first suspension;
(4) transferring the first suspension to a hydrothermal synthesis kettle, and heating for 14-18h at 80-120 ℃ to obtain a second suspension;
(5) drying the second suspension to obtain nano layered double hydroxide;
(6) and (3) incubating the nano layered double hydroxide and the graphene quantum dots at 4 ℃ overnight, and centrifuging and washing to remove unbound materials to obtain the nano layered double hydroxide/graphene quantum dot composite material.
8. The method according to claim 7, wherein the divalent metal ion in the step (1) is Mg 2+ 、Zn 2+ And Ca 2+ Any one of (a) to (b);
in the step (1), the trivalent metal ion is Al 3+ Or Fe 3+ ；
Preferably, the soluble divalent metal ion salt is selected from any one of magnesium nitrate, zinc nitrate, calcium nitrate, magnesium chloride, zinc chloride and calcium chloride;
preferably, the soluble trivalent metal ion salt is selected from any one of aluminum nitrate, ferric chloride and aluminum chloride;
preferably, the molar ratio of divalent metal ions to trivalent metal ions in step (1) is from 1:1 to 3: 1.
9. The preparation method according to claim 7, wherein the mass ratio of the graphene quantum dots to the nano-layered double hydroxide in the step (6) is 1:1-8: 1;
preferably, the particle size of the graphene quantum dot is 3-5 nm.
10. The production method according to claim 4, wherein the concentration of the NaOH solution in the step (2) is 0.015 to 0.05M;
the rotating speed of the violent stirring in the step (3) is 400-1000 rpm;
the drying in the step (5) is vacuum drying;
the rotation speed of the incubation at 4 ℃ in the step (6) is 50-150 rpm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210527643.6A CN114908045A (en) | 2022-05-16 | 2022-05-16 | Application of nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and preparation thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210527643.6A CN114908045A (en) | 2022-05-16 | 2022-05-16 | Application of nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and preparation thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114908045A true CN114908045A (en) | 2022-08-16 |
Family
ID=82767242
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210527643.6A Pending CN114908045A (en) | 2022-05-16 | 2022-05-16 | Application of nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and preparation thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114908045A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023221988A1 (en) * | 2022-05-16 | 2023-11-23 | 同济大学 | Use of nano layered double hydroxides in cartilage regeneration and method for preparing same |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100179659A1 (en) * | 2006-09-27 | 2010-07-15 | Wan-Ju Li | Cell-nanofiber composite and cell-nanofiber-hydrogel composite amalgam based engineered intervertebral disc |
| US20130064795A1 (en) * | 2010-04-09 | 2013-03-14 | Universiteit Gent | Immune modulation |
| CN103966160A (en) * | 2014-04-11 | 2014-08-06 | 同济大学 | Application of inorganic nano-material layered double hydroxides (LDHs) in mouse embryonic stem cell culture |
| CN104099295A (en) * | 2014-07-07 | 2014-10-15 | 暨南大学 | Application of magnetic nano materials in promotion of mesenchymal stem cell osteogenic differentiation |
| WO2015076754A1 (en) * | 2013-11-22 | 2015-05-28 | Nanyang Technological University | Method of synthesizing a layered double hydroxide |
| CN113846060A (en) * | 2021-10-29 | 2021-12-28 | 上海市同济医院 | Application of nano material in promoting differentiation of embryonic stem cells to neural precursor cells |
-
2022
- 2022-05-16 CN CN202210527643.6A patent/CN114908045A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100179659A1 (en) * | 2006-09-27 | 2010-07-15 | Wan-Ju Li | Cell-nanofiber composite and cell-nanofiber-hydrogel composite amalgam based engineered intervertebral disc |
| US20130064795A1 (en) * | 2010-04-09 | 2013-03-14 | Universiteit Gent | Immune modulation |
| WO2015076754A1 (en) * | 2013-11-22 | 2015-05-28 | Nanyang Technological University | Method of synthesizing a layered double hydroxide |
| CN103966160A (en) * | 2014-04-11 | 2014-08-06 | 同济大学 | Application of inorganic nano-material layered double hydroxides (LDHs) in mouse embryonic stem cell culture |
| CN104099295A (en) * | 2014-07-07 | 2014-10-15 | 暨南大学 | Application of magnetic nano materials in promotion of mesenchymal stem cell osteogenic differentiation |
| CN113846060A (en) * | 2021-10-29 | 2021-12-28 | 上海市同济医院 | Application of nano material in promoting differentiation of embryonic stem cells to neural precursor cells |
Non-Patent Citations (4)
| Title |
|---|
| LI YANG等: "Layered Double Hydroxide Nanoparticles with Osteogenic Effects as miRNA Carriers to Synergistically Promote Osteogenesis of MSCs", 《ACS APPL. MATER. INTERFACES》 * |
| YINGJIE WANG等: "Layered Double Hydroxide Modified Bone Cement Promoting Osseointegration via Multiple Osteogenic Signal Pathways", 《ACS NANO》 * |
| ZHAOJIE WANG等: "Ion elemental-optimized layered double hydroxide nanoparticles promote chondrogenic differentiation and intervertebral disc regeneration of mesenchymal stem cells through focal adhesion signaling pathway", 《BIOACTIVE MATERIALS》 * |
| ZHAOJIE WANG等: "rBMSC osteogenic differentiation enhanced by graphene quantum dots loaded with immunomodulatory layered double hydroxide nanoparticles", 《BIOMEDICAL MATERIALS） * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023221988A1 (en) * | 2022-05-16 | 2023-11-23 | 同济大学 | Use of nano layered double hydroxides in cartilage regeneration and method for preparing same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fu et al. | 2D titanium carbide (MXene) nanosheets and 1D hydroxyapatite nanowires into free standing nanocomposite membrane: In vitro and in vivo evaluations for bone regeneration | |
| Nie et al. | Three-dimensional porous scaffold by self-assembly of reduced graphene oxide and nano-hydroxyapatite composites for bone tissue engineering | |
| Kim et al. | Mineralisation of reconstituted collagen using polyvinylphosphonic acid/polyacrylic acid templating matrix protein analogues in the presence of calcium, phosphate and hydroxyl ions | |
| Wu et al. | A review on the biocompatibility and potential applications of graphene in inducing cell differentiation and tissue regeneration | |
| Müller et al. | Transformation of amorphous polyphosphate nanoparticles into coacervate complexes: an approach for the encapsulation of mesenchymal stem cells | |
| CN113307240B (en) | Nano-hydroxyapatite particles with anti-tumor activity and preparation method thereof | |
| Ji et al. | Sphere-shaped nano-hydroxyapatite/chitosan/gelatin 3D porous scaffolds increase proliferation and osteogenic differentiation of human induced pluripotent stem cells from gingival fibroblasts | |
| Tomoaia et al. | Scaffolds made of nanostructured phosphates, collagen and chitosan for cell culture | |
| Shen et al. | In vitro osteogenetic activity of pearl | |
| CN114908045A (en) | Application of nano layered double hydroxide/graphene quantum dot composite material in osteogenic differentiation and preparation thereof | |
| Valiani et al. | Study of carbon nano-tubes effects on the chondrogenesis of human adipose derived stem cells in alginate scaffold | |
| Lv et al. | Evaluation of the antibacterial properties and in-vitro cell compatibilities of doped copper oxide/hydroxyapatite composites | |
| Hou et al. | Mg2+-doped carbon dots synthesized based on Lycium ruthenicum in cell imaging and promoting osteogenic differentiation in vitro | |
| WO2023221988A1 (en) | Use of nano layered double hydroxides in cartilage regeneration and method for preparing same | |
| Yuan et al. | Synthesis, characterization and biological performance study of Sr-doped hydroxyapatite/chitosan composite coatings | |
| Liu et al. | Three-dimensional porous reduced graphene oxide/hydroxyapatite membrane for guided bone regeneration | |
| CN113827767B (en) | Preparation method of novel microgel bone powder for repairing postoperative tissue of osteoma | |
| Prasad et al. | Surfactant-assisted synthesis of hydroxyapatite particles: A comprehensive review | |
| Wang et al. | A study on in vitro and in vivo bioactivity of silk fibroin/nano-hydroxyapatite/graphene oxide composite scaffolds with directional channels | |
| Zhang et al. | Fabrication, in vitro and in vivo properties of β-TCP/Zn composites | |
| Huang et al. | 3D-printed tri-element-doped hydroxyapatite/polycaprolactone composite scaffolds with antibacterial potential for osteosarcoma therapy and bone regeneration | |
| Chen et al. | Effect of Tb/Mg doping on composition and physical properties of hydroxyapatite nanoparticles for gene vector application | |
| CN115154651B (en) | Biomineralization bovine serum albumin @ calcium selenium nanosphere, preparation method and application | |
| CN109758616B (en) | Novel material for promoting bone regeneration and preparation method thereof | |
| Song et al. | Synthesis of Ce/Gd@ HA/PLGA scaffolds contributing to bone repair and MRI enhancement |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |