CN114891858B - Chromatin three-dimensional conformation capturing method and application thereof - Google Patents
Chromatin three-dimensional conformation capturing method and application thereof Download PDFInfo
- Publication number
- CN114891858B CN114891858B CN202210819357.7A CN202210819357A CN114891858B CN 114891858 B CN114891858 B CN 114891858B CN 202210819357 A CN202210819357 A CN 202210819357A CN 114891858 B CN114891858 B CN 114891858B
- Authority
- CN
- China
- Prior art keywords
- chromatin
- sequence
- reaction
- barcode
- linker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
- G16B30/20—Sequence assembly
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B50/00—ICT programming tools or database systems specially adapted for bioinformatics
Abstract
The invention provides a method for capturing three-dimensional conformation of chromatin, which comprises the steps of carrying out in situ chromatin proximity ligation reaction and carrying out space position information specific marking on proximity ligation products, thereby realizing the three-dimensional conformation capture of chromatin under the condition of retaining space resolution.
Description
Technical Field
The invention belongs to the field of genomics, and particularly relates to a chromatin three-dimensional conformation capturing technology and application thereof.
Background
In eukaryotic nuclei, chromatin consisting of DNA and proteins 2 meters long is highly compressed to accommodate a limited space with diameters varying only between 5-10 μm. In recent years, hi-C technical studies based on "proximity ligation" revealed that the genome is a highly hierarchical tissue in eukaryotic nuclei, called a chromatin three-dimensional conformation. The importance of chromatin three-dimensional conformation in genomic functional studies has been of great interest. Dynamic changes in the three-dimensional conformation of chromatin play an important role in mouse acrodevelopment, muscle progenitor cell specification and myogenic differentiation, cerebral cortex development, dendritic cell development and differentiation, and various organ developmental deformities and cancers have also been reported to be associated with abnormalities in the three-dimensional conformation of chromatin.
In vivo, cells do not function in isolation, but are affected by the microenvironment surrounding the tissue (e.g., morphogens, interactions between cells, etc.), and the tissue dissociation process in existing single cell techniques can lead to loss of in situ spatial information. The space histology can reserve or mark the in-situ information of the cells in the tissue, can make up the defect that single cells cannot provide space positions, and opens up a road for researching important problems such as cell functions, disease occurrence mechanisms and the like from space dimension.
The current high-throughput capture method of chromatin three-dimensional conformation at space histology level is still blank, due to various technical limitations: (1) The existing Hi-C technology (in situ Hi-C, tag Hi-C, etc.) at the cell population level needs to perform the operation of extracting the cell nucleus first and cannot be realized on tissue sections; (2) Because the chromatin connection product generated in the Hi-C experiment process is a protein-containing compound, the cell population level Hi-C (in situ Hi-C, tag Hi-C and the like) needs to carry out a crosslinking reaction on the nucleus during the chromatin disruption so as to expose DNA, and the subsequent disruption can realize whole genome coverage; on a tissue slice, before space positioning marking is carried out, a cell structure is broken by directly carrying out a crosslinking reaction, so that DNA is released into a solution, and the position information of cells in the tissue is lost; (3) In situ genome sequencing (IGS) uses imaging to infer chromatin structure, which not only requires high resolution imaging microscope support, but also can only realize DNA in situ sequencing of several cells (mouse embryo 2 cells, 4 cell period) of early embryo at present, with small coverage area, and cannot realize high throughput spatial chromatin three-dimensional conformation capture at tissue level. (4) The existing technology for realizing the space apparent genome by using the Tn5 multiple disruption technology requires two Tn5 disruption reactions to add two-dimensional position information, but the second disruption reaction can lead to more chaotic insertion positions of the added tag information, and the fragments of the correctly added position information obtained in the final library are fewer. Therefore, the development of a space chromatin three-dimensional conformation capturing method with high space resolution, low cost and easy operation is very important, and provides a new visual angle for researching the apparent regulation mechanism of key pathological genes of human diseases in time and space, and brings new breakthrough for diagnosing and treating diseases such as development, cancers and the like.
Disclosure of Invention
The invention carries out chromatin adjacent connection reaction in situ, and carries out Barcode combined marking with specific spatial position information on adjacent connection products, thereby realizing the capture of chromatin three-dimensional conformation under the condition of retaining spatial resolution.
In a first aspect, the present invention provides a method for analysis of spatial chromatin, a method for capture of spatial chromatin or a method for high throughput sequencing and pooling of spatial chromatin, the method comprising the steps of:
(1) Fragmenting chromatin in the cells;
(2) Performing a chromatin proximity ligation reaction;
(3) Performing enzyme-slicing segmentation treatment on the circular chromatin adjacent connection product obtained in the step (2) by using a Tn5 transposase complex to obtain a chromatin adjacent connection product fragment, and adding a linker to the chromatin adjacent connection product fragment to obtain a chromatin adjacent connection product fragment with the linker;
(4) And (3) connecting the Barcode sequence marker combination with specific spatial position information at the 5 'end or the 3' end of the chromatin adjacent to the connection product fragment with the connector obtained in the step (3) through a connection reaction.
In some embodiments, in step (2), the site where the chromatin proximity ligation reaction occurs is labeled with a label.
In some embodiments, the marker is biotin.
In some embodiments, the chromatin within the cell is fragmented using a restriction enzyme.
In some embodiments, the intracellular chromatin is fragmented using a restriction enzyme to yield a cohesive end.
The restriction enzyme may be any restriction enzyme including, but not limited to MboI, DNase, MNase, tn5 transposase and other restriction enzymes.
In some embodiments, after fragmenting the chromatin in the cells to obtain sticky ends in step (1), the sticky ends of the chromatin are filled in and biotin-labeled bases are introduced to obtain blunt-ended fragments containing the biotin labels.
In some embodiments, the cells and nuclei within the cells of step (1) are permeabilized.
The invention adopts cell permeabilization liquid different from the traditional Hi-C experiment, and realizes permeabilization of cells and cell nuclei in the in-situ state of tissue sections, so that macromolecular reagents such as enzymes in subsequent experimental reactions can enter the cell nuclei to realize in-situ reactions. Therefore, the reagent capable of permeabilizing the nucleus can be selected as needed.
In some embodiments, the cells in step (1) are cells in a tissue section.
Thus, the method of analysis of spatial chromatin can be performed in situ on a tissue section.
In some embodiments, in step (4), the spatial position-specific lateral and longitudinal markers are ligated by ligation reactions at the 5 'or 3' end of the ligated chromatin proximal to the ligation product fragment obtained in step (3).
In some embodiments, in step (4), the spatially position-specific transverse-and longitudinal-marker Barcode H, V are ligated by ligation reactions at the 5 'or 3' end of the ligated-product fragment of the ligated chromatin obtained in step (3).
In some embodiments, in step (4), the Barcode H-ligation complex and the Barcode V-ligation complex are added to the adaptor-ligated chromatin obtained in step (3) adjacent to the 5 'end or the 3' end of the ligation product fragment by a ligation reaction.
The Barcode H-linked complex comprises Linker H and a Barcode H domain.
The Linker H has the following structure:
[linker1-R]-[linker2]，
wherein the linker1-R comprises a part or all of the complementary sequences of the linker 1;
the Barocde H domain has the following structure:
[5Phos/linker3]-[Barcode Hi]-[linker2-R]，
Wherein the Linker2-R comprises a part or all of the complementary sequence of the Linker2,
the Barcode Hi is a DNA sequence with the length of 3-50bp and is used for positioning the position of a transverse channel where the Reads are located, and i represents the number of channels and can be 4-40000.
The Barcode V-linked complex comprises Linker V and a Barcode V domain.
The Linker V has the following structure:
[linker3-R]-[linker4]，
wherein the linker3-R comprises a part or all of the complementary sequences of the linker 3;
the Barcode V domain has the following structure:
[Primer]-[BarcodeVj]-[linker4-R]，
wherein the linker4-R comprises a part or all of the complementary sequences of the linker4, the Barcode Vj is a DNA sequence with the length of 3-50bp and is used for positioning the position of a longitudinal channel where the Reads are located, i represents the number of channels and can be 4-40000,
the Primer may be a sequencing Primer for on-machine sequencing of the library, or a Linker5 sequence for the next round of ligation reactions.
In some embodiments, in step (3), adding a linker to the chromatin-adjacent ligation product fragment is compatible with the subsequently required spatial position marker sequences Barcode H and Barcode V ligation. In contrast, although tagHi-C method also uses Tn5 transposase for fragmentation to avoid DNA ultrasound disruption, tagHi-C directly uses Tn5 transposase for DNA sequencing library adaptor ligation, which is not compatible with the subsequently required spatial position marker sequences Barcode H and Barcode V ligation, and thus tagHi-C cannot meet the requirement of capturing chromatin three-dimensional conformation under the condition of retaining spatial resolution.
More preferably, the Barcode H domain has the following sequence:
5Phos/CATCGGCGTACGACT[BarcodeHi]ATCCACGTGCTTGAG。
more preferably, the Barcode V domain has the following sequence:
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[BarcodeVj]GTGGCCGATGTTTCG。
preferably, the Linker H has the following sequence:
CAAGTATGCAGCGCGCTCAAGCACGTGGAT。
preferably, the Linker V has the following sequence:
AGTCGTACGCCGATGCGAAACATCGGCCAC。
in some embodiments, the method further comprises the step of enriching the labeled fragments with magnetic beads after step (4), the label being a label with a label at the location where the chromatin proximity ligation reaction occurs in step (2).
In some embodiments, the method further comprises the step of enriching the biotin-labeled fragments with magnetic beads.
In some embodiments, the method further comprises the step of removing chromatin histones by treating the chromatin with HCl after the chromatin proximity ligation reaction of step (2).
In some embodiments, the spatial location information specific Barcode sequence tags are linked in step (4) using microfluidic chip tag technology.
In some embodiments, the microfluidic channels in the microfluidic chip have a width of 5-500 μm, for example 10 μm,20 μm,25 μm,30 μm,40 μm or 50 μm.
In some embodiments, the number of microfluidic channels in the microfluidic chip is 4-40000 channels, which may be, for example, 12 channels, 24 channels, 36 channels, 48 channels, 60 channels, 72 channels, 84 channels, or 96 channels.
The number of microfluidic channels can be selected as desired to achieve coverage of tissue slices of different area sizes.
In some embodiments, the Tn5 transposase complex comprises a Tn5 transposase and a linker sequence that allows for subsequent efficient ligation of a spatial position information specific Barcode sequence tag at the 5 'or 3' end by a ligation reaction. In some embodiments, the linker sequence comprises an adapter 1 and an adapter 2, which adapter 1 and adapter 2 can enable subsequent efficient ligation of spatial position-specific lateral and longitudinal tags at the 5 'or 3' end by ligation reactions. Preferably, the transverse label is Barcode H. Preferably, the longitudinal marker is Barcode V. The Tn5 transposase complex further comprises an ME sequence.
In some embodiments, the Tn5 transposase complex comprises a Tn transposase and a linker sequence comprising a sequence that matches the Barcode sequence linked in step (4).
In some embodiments, the linker sequence comprises an Adaptor1 and an Adaptor2.
In some embodiments, the Tn5 transposase complex further comprises an ME sequence.
The adapter 1 has the following structure:
[5Phos/linker1]-[ME-R]，
Wherein the ME-R is complementary to the ME sequence, forms a complementary structure when annealed to the ME sequence, and linker1 is used for linking with the Barcode H linking complex.
The adapter 2 has the following structure:
[ sequencing primer ] - [ ME-R ],
the ME-R is complementary to the ME sequence and forms a complementary structure when annealed to the ME sequence.
Preferably, the Adaptor1 domain has the following sequence:
5Phos/CGCGCTGCATACTTGAGATGTGTATAAGAGACAG。
preferably, the Adaptor2 domain has the following sequence:
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG。
preferably, the ME sequence has the following sequence:
5Phos/CTGTCTCTTATACACATCT/3ddC。
in the invention, only the 5 'or 3' end is efficiently connected with the transverse marker and the longitudinal marker with specific space positions, so that a serial structure generated in the subsequent PCR reaction can be avoided, and the efficient amplification of the library is realized.
In some embodiments, the method comprises the steps of:
(a) Crosslinking reaction is carried out on the tissue slice;
(b) Permeabilizing cells and nuclei;
(c) Fragmenting intracellular chromatin by using an enzyme digestion reaction to obtain a sticky end;
(d) Filling the viscous terminal of the chromatin, and introducing biotin-labeled bases to obtain a blunt-end fragment containing biotin labels;
(e) Ligating the spatially adjacent DNA blunt end fragments into the same fragment using a ligase, wherein the biotin marks the site where the adjacent ligation occurred;
(f) Treating the product obtained in step (e) with HCl to remove histone on chromatin, and then cutting off chromatin DNA fragments in the nuclei of the sectioned cells with Tn5 transposition complex while adding different linkers (sequencing linker Adaptor2 at one end and Adaptor1 for connecting Barcode at the other end) at both ends;
(g) Superposing the tissue slice treated by Tn5 transposase in the step (f) with a transverse microfluidic chip, forming a transverse channel on the combined surface of the tissue slice and the microfluidic chip, and adding a connecting mixture mixed with different types of Barcode H into a sample adding hole for connection reaction;
(h) Superposing the tissue slice processed in the step (g) and a longitudinal micro-fluidic chip together, forming longitudinal channels on the combined surface of the tissue slice and the micro-fluidic chip, adding a connecting mixture mixed with different types of Barcode V into a sample adding hole, and carrying out a connecting reaction, wherein the cross point of the transverse channels and the cross point of the longitudinal channels are pixels, and the total Pixel number is the number of the transverse channels multiplied by the number of the longitudinal channels;
(i) Performing a decrosslinking reaction on the tissue slice treated in the step (h) by using a decrosslinking buffer solution; and
(j) After recovery of the DNA, the biotin-labeled fragments were enriched using magnetic beads.
In some embodiments, in step (h), the primer of the Barcode V domain is a linker5 sequence and the tissue sections are subjected to further rounds of ligation reactions that label multiple sections of the same sample with the Barcode S ligation complex,
the Barcode S ligation complex comprises the following sequence:
LinkerS：[linker5R]-[linker6],
the Linker5R comprises a part or all of the complementary sequence of Linker5,
barcode S domain: [ sequencing primer ] - [ Barcode Sk ] - [ Linker6R ],
the sequencing primer is an on-machine sequencing primer of the library; the Barcode Sk is a DNA sequence with the length of 3-50bp and is used for determining the serial number of the slice.
In a second aspect, the present invention provides a method of high throughput sequencing of space chromatin, the method comprising the steps of the method of high throughput sequencing of space chromatin of the first aspect, and the step of performing sequencing.
In some embodiments, the method further comprises the step of HE staining the adjacent sections, thereby exhibiting morphological results.
In a third aspect, the present invention provides a method for preparing a three-dimensional conformational map of a multi-dimensional tissue space chromatin, where the method includes the steps in the method for capturing a space chromatin according to the first aspect, and after the Barcode sequence markers specific to the connection space position information in the step (4) are adjusted, each slice is subjected to multiple rounds of connection reaction to mark different slices of the same sample, different samples, etc., for example, a Primer sequence of Barcode V is a Linker5 sequence, and the tissue slice can be subjected to multiple rounds of connection reaction, for example, multiple slices of the same sample are marked by multiple rounds of Barcode S, so as to capture a three-dimensional tissue space chromatin three-dimensional conformation.
The method can realize the preparation of the space chromatin three-dimensional conformational map of the whole tissue three-dimensional 3D layer.
The subsequent library establishment experiment can be performed by a plurality of slices in the same tube, so that the reagent and time cost in the experiment are saved; and combining and splicing the obtained sequencing result by using an image splicing technology according to the picture of the position information of each pixel and the sequence of each slice, so as to obtain the space chromatin three-dimensional conformation of the tissue three-dimensional 3D layer.
In a fourth aspect, the present invention provides a method for preparing a spatial multiunit chemical map, the method comprising the steps of capturing the spatial chromatin in the first aspect, performing reverse transcription by using a ploy T primer with a linker, and performing a multi-round ligation reaction on each slice after ligation of the Barcode sequence markers with specific spatial position information in the step (4), thereby realizing the marking of different slices, different samples, and the like.
Then, a subsequent library establishment experiment is carried out, and a plurality of slices can be carried out in the same tube, so that the reagent and time cost in the experiment are saved; and combining and splicing the obtained sequencing result by utilizing an image splicing technology according to the picture of the position information of each pixel and the sequence of each slice, thereby obtaining a space chromatin three-dimensional conformation or a space transcriptome map of a tissue three-dimensional 3D layer, realizing annotation of the three-dimensional conformation and transcriptome information of the cell chromatin of different areas of the tissue, and finding out the relation between a regulation mechanism of the chromatin layer and the space position thereof in the processes of determining and differentiating the cell fate.
In a fifth aspect, the invention provides a method of analysis of a spatial chromatin high throughput sequencing library comprising the steps of the spatial chromatin high throughput sequencing library-building method of the first aspect.
The method further comprises the steps of:
(a) Extracting the Barcode sequence in the sequencing sequence 1 (reads 1), and filtering the paired sequencing sequences (Read heads) which are not connected correctly;
(b) Removing the adaptor of the sequencing data, and filtering the sequencing data with low quality (base correct recognition rate <99 percent);
(c) Aligning sequencing sequence 1 (reads 1) and sequencing sequence 2 (Read 2) to a reference genome, respectively;
(d) Converting the aligned bam file into a chromatin interaction matrix file of 1Mb bin;
(e) Splitting the Hi-C matrix file into chromatin interaction matrix files of each single transverse and longitudinal channel intersection region (pixel);
(f) Normalizing the interaction matrix of each single transverse-longitudinal channel intersection (pixel) to an element sum of 10000;
(g) Performing cluster analysis on data of a single transverse and longitudinal channel crossing region (pixel) to obtain a classification result;
(h) Mapping the clustering analysis result on a picture of the tissue slice according to the pixel position formed by the transverse and longitudinal channels, and analyzing the corresponding relation between each type of pixel and the position thereof by combining the morphological characteristics of the tissue slice and further analyzing the morphological characteristics. .
In a sixth aspect, the invention provides the use of the methods of the first to fifth aspects in space-chromatin high throughput sequencing.
The beneficial effects of the invention are shown in the following aspects:
according to the invention, in-situ chromatin adjacent connection reaction is realized on a tissue slice, and the adjacent connection products are subjected to Barcode combined marking with specific spatial position information, so that the three-dimensional conformation capture of the chromatin under the condition of retaining spatial resolution is realized, and the technical blank of lack of three-dimensional conformation information of captured chromatin on the level of space histology is filled.
The method adopts the microfluidic chip marking technology to mark the position information of the chromatin three-dimensional conformation, has low cost, simple operation and good expansibility, and can realize the spatial position information marking with different resolutions (5-500 mu m, etc.) by adjusting the width of the microfluidic channel; in addition, the number of microfluidic channels can be flexibly customized to achieve coverage of tissue slices of different area sizes.
In the invention, the number of the Barcode H can be selected according to the number of the microfluidic channels.
After the adjacent connection reaction is finished, the tissue slice can be further processed by HCl to remove histones on chromatin, so that DNA is exposed, the unbiased cutting of Tn5 transposition complex is ensured, and unbiased three-dimensional conformational information capture of the chromatin of the whole genome on the tissue slice is realized.
In the invention, the composition sequence of the Tn5 transposase complex is improved in the chromatin fragmentation process, and different joints are added at two ends of the DNA fragment, so that the space position information mark is efficiently connected at one end only through the connection reaction in the follow-up process, the serial structure formed in the follow-up PCR amplification reaction is avoided, and the correct library structure is ensured.
The invention can also combine with the space transcriptome to realize space multiunit data capture, firstly, the step of reverse transcription is carried out on the slice by utilizing ploy T primer containing part or all of the adapter sequence, so that the mRNA sequence is reverse transcribed into the adapter sequence with the function of connecting with the subsequent Barcode; the cDNA and chromatin DNA can be added to the Barcode simultaneously when a library construction step of the three-dimensional structure of the space chromatin is performed subsequently. Meanwhile, the realization of space multiunit can combine the gene expression and the regulation mechanism in the same cell for deep analysis, and the regulation mechanism of the gene expression can be more accurately researched.
The invention can realize the capture of different tissue substructures and even single-cell chromatin three-dimensional structures on one slice, and can be suitable for detecting chromatin conformation variation of clinical samples with very precious sample size.
Hi-C (High-throughput chromosome conformation capture) is a method widely used in laboratories to study the genome-wide chromatin higher structure in the nucleus, and specific experimental procedures are that cells are crosslinked with formaldehyde (crosslink), the nucleus is extracted and nuclear membrane permeabilized, and the chromatin DNA is digested with restriction enzymes in the nucleus to produce cohesive ends; the sticky end is marked by biotin and subjected to adjacent connection reaction, finally, the sticky end is subjected to uncrosslinking, DNA fragmentation, magnetic beads are enriched with connection fragments containing the biotin, and finally, library establishment and double-end sequencing are carried out. While the Hi-C technique can achieve unbiased three-dimensional conformational capture of chromatin at the whole genome level, traditional Hi-C techniques cannot achieve capture of spatially resolved unbiased three-dimensional conformational regulatory information of chromatin at the whole genome on tissue sections based on cell population levels. According to the invention, in-situ chromatin proximity connection reaction is realized on a tissue slice, and based on the reaction, the adjacent connection products are subjected to spatial position specific Barcode H and Barcode V marking, so that the spatial position information of the chromatin adjacent connection products in tissues can be traced back and analyzed, and the chromatin three-dimensional conformational information under the condition of retaining spatial resolution is obtained, and the key technical problems are specifically solved as follows:
(1) The traditional Hi-C experiment is based on cell population, and cell nuclei are firstly required to be extracted, but cells on tissue slices are adhered to a glass slide and cannot be extracted, so that different cell permeabilization liquids from the traditional Hi-C experiment are adopted in the invention, permeabilization of cells and cell nuclei is realized in situ of the tissue slices, and macromolecular reagents such as enzymes in subsequent experimental reactions can enter the cell nuclei to realize in situ reactions;
(2) After the adjacent connection reaction of chromatin is completed, the connection product is directly subjected to decrosslinking by the traditional Hi-C technology, protein is removed to obtain DNA fragments, and then the DNA fragments are fragmented by ultrasonic disruption or Tn5 enzyme digestion. However, in tissue sections, because the chromatin ligation products need to be spatially labeled, they still need to be performed on the sections, and the direct decrosslinking reaction can destroy the cell structure, releasing the DNA into solution, and losing positional information. However, the proteins in the chromatin junction complex affect the cleavage effect without a cross-linking reaction, and the DNA fragmentation reaction does not allow for unbiased cleavage of the whole genome. Therefore, HCl is added to treat the slice after the adjacent connection reaction, the histone on the chromatin is removed to expose the DNA, and the fragmentation of the adjacent connection product of the chromatin is practically realized by using Tn5 transposase enzyme;
(3) Although the tagHi-C method also utilizes Tn5 transposase to fragment so as to avoid ultrasonic breaking operation of DNA, the tagHi-C directly utilizes the Tn5 transposase to connect the joints of a DNA sequencing library, and the two ends of the obtained fragmented product are connected with sequencing joints of illumine, so that the method cannot be compatible with the subsequent connection reaction of a required spatial position marker sequence Barcode H and Barcode V, and therefore, the tagHi-C cannot meet the condition of retaining spatial resolution to capture a three-dimensional conformation of chromatin;
(4) Firstly, cell permeabilization and adjacent connection reaction are carried out on a slice, the three-dimensional conformational state of chromatin in a cell nucleus is fixed and preserved, then, after HCl treatment and Tn5 transposase cleavage, DNA of the chromatin adjacent connection product is fragmented, one end of the DNA adjacent to the connection product is provided with an adapter sequence capable of carrying out subsequent connection reaction, the other end is provided with a sequenced joint sequence, then, connection of a transverse marker Barcode H and a longitudinal marker Barcode V with specific space positions is realized at the 5 'or 3' end of the DNA adjacent to the connection product through connection reaction, finally, biotin marker fragments are enriched by utilizing magnetic beads, and PCR amplification is carried out for library construction. The space position mark is connected to one end of the DNA, so that a series structure generated in the subsequent PCR reaction can be avoided, and the efficient amplification of the library is realized;
(5) According to the invention, when a space chromatin three-dimensional conformation capturing experiment is carried out, after the Barcode sequence mark with specific connection space position information on a tissue slice is adjusted, a plurality of rounds of connection reaction are carried out on each slice to mark different slices of the same sample, different samples and the like, for example, a Primer sequence of Barcode V is a Linker5 sequence, the tissue slice can also carry out more rounds of connection reaction, for example, a plurality of slices of the same sample are marked by adding one round of Barcode S, and 3D tissue three-dimensional space chromatin three-dimensional conformation capturing is realized.
As used herein, "Spatial Hi-C" refers to the high-throughput capture of Spatial chromatin conformation, or the high-throughput capture of three-dimensional chromatin conformation, or the three-dimensional conformational capture of Spatial chromatin.
Bacterial transposase Tn5 utilizes the unique "tag" function of dimer Tn5 that can cleave double stranded DNA (dsDNA) and ligate the resulting DNA ends to specific adaptors. The genetically engineered Tn5 can be widely used in the preparation of sequencing libraries due to its rapid synthesis capability and lower sample input. For general library preparation, tn5 reacts directly with dsDNA, breaking double stranded DNA in one step and making the DNA adapter at both ends. The simple one-step labeling reaction greatly simplifies the experimental process, shortens the working time and reduces the cost, and is widely applied to the DNA sequencing library construction technology.
The whole Tn5 transposon sequence is not necessary for transposition, only the terminal core sequence of the transposon is needed, the transposase can insert the partial sequence into the genome, based on the principle, a sequencing adaptor sequence is added into the terminal core sequence, the transposase cleaves double-stranded DNA, and then the adaptor sequence is connected at two ends of the DNA fragment, so that library construction is completed. The traditional Illumina NEB library construction method needs the steps of DNA fragmentation, end repair, joint connection, library amplification, repeated purification and separation and the like, and has long time consumption, while the transposase is used for constructing an NGS library, so that the multi-step reactions of DNA fragmentation, end repair, joint connection and the like can be simplified into one-step reaction, the library construction time is greatly shortened, and the working efficiency is improved.
Single cell sequencing can define cell type and status unbiased, but does not obtain spatial distribution information of biomolecules and cells in tissues. The advent of spatial transcriptomics complements this shortcoming of single cell sequencing, enabling us to describe cell function and status in a natural tissue environment. Analysis of the spatial organization of different cell types and functions in tissues requires detection of gene expression and epigenetic information in a spatially resolved manner.
Drawings
FIGS. 1A, 1B, 1C and 1D show a high throughput capture experimental flow diagram of the spatial chromatin of the invention.
FIG. 2 shows a schematic of the spatial chromatin high throughput sequencing pooling of the invention.
FIG. 3 shows the library fragment distribution of the tissue sections of mice E13.5 days obtained by the Spatial Hi-C technique.
Fig. 4A and 4B show different types of reads distribution per pixel for a mouse E13.5 day tissue slice in an embodiment of the invention: (FIG. 4A) Violin plot of Raw reads distribution (FIG. 4B) Violin plot of cis_ long range contact (> 20 kb) distribution.
FIGS. 5A, 5B, 5C and 5D show the results of analysis of a mouse E13.5 day tissue section Spatial-Hi-C library in the examples of the present invention: (FIG. 5A) UMAP dimension-reduced clustering results (FIG. 5B) mapping of clustering analysis results (FIG. 5C) mapping of individual bin spA/B values on tissue sections example 1 (FIG. 5D) mapping of individual bin spA/B values on tissue sections example 2.
FIG. 6 shows the A/B values of pixels from liver regions in E13.5 day tissue sections of mice in the examples of the present invention in combination with single cell transcriptome analysis.
Detailed Description
The following are preferred embodiments of the present invention, and the present invention is not limited to the following preferred embodiments. It should be noted that modifications and improvements made on the basis of the inventive concept will be within the scope of the present invention for those skilled in the art. The reagents used were conventional products commercially available without the manufacturer's knowledge. Table 1 shows the sequences used.
Table 1:
example 1. Spatial chromatin three-dimensional conformational Capture of mouse E13.5 embryos using the Spatial Hi-C method of the invention, comprising the steps of:
1. preparation of tissue sections
And taking out the embryo after the pregnant mice on the E13.5 day are killed by neck removal, putting the embryo into PBS buffer solution precooled on ice, and removing tissues such as placenta and the like under a split microscope. Taking out the embryo of the mouse, washing once with PBS, placing into an OCT embedding box, sucking the residual liquid on the surface of the embryo, adding the OCT precooled on ice to fill the embedding box, and placing at-80 ℃ overnight. Taking out embedded mouse embryo at-80deg.C, balancing in a frozen microtome for 30min, slicing, sticking tissue slice onto adhesive glass slide, and storing in-80deg.C refrigerator.
2. Cross-linking of tissue sections
Sections were removed from-80 ℃, equilibrated at room temperature for 10min, and the OCT on the slide was washed off with PBS. The tissue sections were first crosslinked (400. Mu.L of 1% formaldehyde solution, crosslinked at room temperature for 10 min), and 2.5MGlycine (32.5. Mu.L, final concentration 0.125M, 5min at room temperature) was added to terminate the crosslinking.
3. Permeabilizing cell membranes and nuclear membranes
200. Mu.L of cell permeabilization solution is added, and the mixture is treated at room temperature for 15min to permeabilize cell membranes. The lysis buffer was discarded, 200. Mu.L of wash buffer was added and the mixture was treated at room temperature for 5min. Discarding the washing buffer, adding 50. Mu.L of 0.5% SDS, treating at 62℃for 10min, permeabilizing the nuclear membrane, and adding 145. Mu.L of nuclease-free H 2 O and 25. Mu.L 10% TritonX-100 neutralized SDS. The ratio of the cell permeabilization liquid is shown in the following table 2, and the ratio of the cleaning buffer liquid is shown in the following tableTable 3.
Table 2:
table 3:
4. chromatin DNA fragmentation
To the solution of the above step, 25. Mu.L of 10 XNEB buffer 2 and 200U of restriction enzyme MboI were added, and the chromatin DNA was cut on a section and placed on a shaker at 37℃overnight to give a cohesive end.
5. Terminal filling and labeling biotin
And inactivating MboI at 62 ℃ for 20 min. The liquid was discarded, 45. Mu.L of fill-in master mix was added, reacted on a shaker for 1h at 37℃while the sticky ends were filled in and labeled with biotin. The fill-in master mix ratios are shown in Table 4 below.
Table 4:
6. adjacent connection
To the solution of the previous step, 137.25. Mu. L ligation master mix was added and the ligation was performed on a shaker overnight to allow for blunt end ligation of chromatin DNA. The proportions of Ligation master mix are shown in Table 5 below.
Table 5:
fragmenting Tn5 transposase and adding a linker
Preparation of a transposition complex: (1) assembling a joint: ME sequences (5 Phos/CTGTCTCTTATACATCT/3 ddC), adapter 1 (5 Phos/CGCGCTGCA TACTTGAGATGTGTATAAGAGACAG) and adapter 2 (GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAG) were dissolved in lysis buffer (40 mM Tris-HCl (pH 8.0), 50mM NaCl) at a concentration of 100. Mu.M, respectively. The ME sequence (10. Mu.L) was mixed with the linker sequence 1 and the linker sequence 2 in equal volumes (10. Mu.L), and annealed after thoroughly mixing: cooling to 20deg.C at-1deg.C/s after 5min, mixing the two liquid volumes to obtain joint mixture, and preserving at-20deg.C. (2) transposable complex (transposome) assembly: mu.L of novong Tn5 transposase (10 pmol/. Mu.L), 1. Mu.L of the linker mixture, and after thoroughly mixing, reacted at 23℃for 30min.
Fragmentation, PBS rinsing three times, 0.1mol/L HCl treatment for 5min, PBS fully washing, adding 50 mu L Tagmentation mix,37 ℃ reaction for 40min, discarding the reaction solution, adding 200 mu L40 mM EDTA, and treating at room temperature for 5min to terminate the reaction. Dd H for slicing 2 And (5) cleaning and then airing. The ratio of the tag mix is shown in Table 6 below.
Table 6:
spatial position Barcode combining marks:
(1) Preparation of the Barcode ligation complex by means of spatial position labelling of chromatin DNA: 5. Mu.L of Barcode H (5 Phos/CATCGGCGTACGACT [ Barcode Hi ] ATCCACGTGCTTGAG, barcodeHi is a Barcode sequence of 8bp, and consists of four deoxynucleotides of ATCG) (100. Mu.M) is added into a PCR tube, wherein the types of the Barcode Hi depend on the number of microfluidic channels, 50 Barcode H are adopted in the embodiment, 5. Mu.L of Linker 1H (100. Mu.M) (CAAGTATGCAGCGCGCTCAAGCACGTGGAT) and 10. Mu.L of 2X annealing buffer are adopted, after uniform mixing, denaturation is carried out at 95 ℃ for 5min, and then-0.1 ℃/s are cooled to 20 ℃; mu.L of Barcode Vj (100. Mu.M) (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG [ Barcode Vj ] GTGGC CGATGTTTCG Barcode Vj is a Barcode sequence of 8bp and consists of four deoxynucleotides ATCG) (100. Mu.M) is added into a PCR tube, wherein the types of the Barcode Vj depend on the number of microfluidic channels, 50 Barcode H are adopted in the embodiment), 5. Mu.L of Linker V (100. Mu.M) (AGTCGT ACGCCGATGCGAAACATCGGCCAC), 10. Mu.L of 2×profiling buffer are added, after uniform mixing, denaturation is carried out at 95 ℃ for 5min, and then-0.1 ℃/s is cooled to 20 ℃. The ratio of the 2×analyzing buffer is shown in table 7 below.
Table 7:
(2) And (3) assembling the chips of the section processed in the step 7 and the transverse microfluidic channel together, clamping the chips and the sections by using a clamp, forming a transverse microfluidic channel between the sections, adding Barcode H ligation mix (H1-H50, 4 mu L of ligation mix,1 mu L annealed Barcode H and 25 mu M) into each sample injection hole, vacuumizing until the channel is full of liquid, and reacting for 30min at 37 ℃. Liquid in each sample inlet hole and each sample outlet hole is sucked and removed, 1 XNEB buffer 3.1 is added into each sample inlet hole, vacuum is pumped for 5min, and a channel is flushed. Remove the chip and slice at ddH 2 And cleaning in O water and then airing. The ratio of the ligation mix to the 1 XNEB buffer 3.1 is shown in Table 8 below.
Table 8:
(3) The chips of the section and the longitudinal micro-fluidic channel after the 8 th step are assembled together, the chips and the section are clamped by a clamp, a longitudinal micro-fluidic channel is formed between the sections, barcode V ligation mix (V1-V50, 4 mu L of ligation mix,1 mu L annealed Barcode V,25 mu M) is added into each sample injection hole, and vacuum pumping is performed until the channel is full of liquid, and the reaction is performed for 30min at 37 ℃. Liquid in each sample inlet hole and each sample outlet hole is sucked and removed, 1 xDPBS is added into the sample inlet holes, and the channels are flushed by vacuumizing for 5 min. Removing the chip and slicing ddH 2 After washing in O water and air drying, 2500 pixels are generated at the crossing points of the transverse and longitudinal channels on the final slice.
8. Decrosslinking
mu.L of the inverse cross-linking mixture (containing 0.4. 0.4 mg/mL protease K) was added to the sections, digested at 58℃for 2h, and the liquid was transferred to PCR tubes at 65℃overnight. The proportions of the inverse crosslinking mixture are shown in Table 9.
Table 9:
9. recovery of DNA, gap filling
DNA was recovered using DNA concentrator-5 kit (Zymo), and eluted to 20. Mu.L of nucleic-free H 2 To O, 25. Mu.L of NEB Next High-Fidelity 2 XPCR Master Mix (NEB) was added, and the mixture was reacted at 72℃for 5 minutes to perform gap filling.
10. Enrichment of Biotin-labeled DNA fragments
After Gap filling, 2×binding buffer was added to the product, and after thoroughly mixing, the mixture was added to 1×TWB buffer-washed streptavidin magnetic beads (Dynabeads ™ MyOne ™ streptavidin C1, invitrogen), incubated at room temperature for 30 minutes, enriched for DNA with biotin tag, the beads were washed with 1× Tween wash buffer, and finally the beads were resuspended in 20. Mu.L of 10mM Tris-HCl (pH 8.0), and treated at 98℃for 10min for elution. The ratio of the 2×binding buffer is shown in table 10. The 1X Tween wash buffer ratios are shown in Table 11.
Table 10:
table 11:
11. PCR amplification
The PCR reaction system is shown in Table 12 below.
Table 12:
the PCR reaction conditions are shown in Table 13 below.
Table 13:
SPRI beads (Beckman) added to the 0.7-fold reaction system was used to recover DNA of 300bp or more, and sequencing was performed using the Illumina NovaSeq system.
12. Sequencing data processing
(1) Extracting two rounds of Barcode sequences in Read1 by using umi-tools and connecting the two rounds of Barcode sequences to a Readname, and simultaneously filtering readheads which are not connected correctly, wherein specific parameters allow a deviation of 5 bp;
(2) Removing the adaptor of the sequencing data using a trimmatic, while filtering low quality sequencing data;
(3) Alignment of Read1 and Read2, respectively, onto the reference genome using BWA;
(4) Converting the aligned bam file into a Hi-C matrix file of 1Mb bin by using HiCExPLorer;
(5) Splitting the Hi-C matrix file into Hi-C matrix files of each single cell by using bedtools and utilizing a Readname;
(6) Filtering out cells with the number of Reads less than 3000, and normalizing the Contact matrix of each cell to the sum of elements to 10000;
(7) Performing cluster analysis on the single pixel data to obtain a classification result;
(8) And mapping the result of the cluster analysis on a picture of the tissue slice according to the position of the pixel, and further analyzing by combining morphological characteristics.
13. Experimental results
The invention is applied to the experiments of Spatial-HiC (the flow is shown in FIG. 1A, FIG. 1B and FIG. 1
1C and 1D) and constructing a library (the structure is shown in FIG. 2), and the distribution of library fragments is shown in FIG. 3 and is 300-1500 bp. Sequencing was performed using the illuminea novoseq platform, yielding 485, 962, 701 pairs of raw Reads. The obtained sequencing data are analyzed by applying the analysis flow in the invention, and as shown in the table 1, the pairs of Reads of 445, 539 and 708 which are correctly connected with two rounds of Barcode, the ratio is 91.68%; wherein the Reads capable of mapping onto the mouse reference genome are 421, 562, 824 pairs, accounting for 94.61%. Reads (Valid reads), 102, 598 pairs, 29.44% of total reads, containing chromatin three-dimensional conformational information were effectively captured using hicexcore analysis; wherein long-range interactions within the chromosome (cis_long range >20kb contact) account for 45.05% of the total Valid reads. Sequencing data was split into individual data for each pixel according to the Barcode combination, resulting in 2353 data sets, so to speak, the number of effective pixels was 94.12% of the total number of pixels. Wherein the average reads number of individual pixels is approximately 200,000 pairs (mean= 186,496) (fig. 4A), and the average cis long contact (10 kb) number of individual pixels is approximately 30,000 pairs (mean= 27,338) (fig. 4B). The clustering analysis using Higashi resulted in 5 classes (fig. 5A), which were displayed in situ on the sections (fig. 5B), and it can be seen that the different classes had distinct positional specificities corresponding to the different tissue types of the tissue sections, and therefore Spatial-HiC was able to capture chromatin three-dimensional images efficiently with Spatial resolution.
The value of each pixel-specific A/B compartment (A/B component) was calculated at the same time to represent the open state of chromatin (the higher the A/B value, the more prone to be in the open state, the more active the gene transcription), and after mapping back to sections, the spA/B value was also tissue specific (FIGS. 5C, 5D). Further, taking the liver region as an example, pixels of the liver region are individually proposed, and the A/B components of the marker gene are calculated in combination with single cell transcriptome data, and the main cell types of the region are annotated as hepatocytocytocytotes and Erythroid lineage. In summary, spatial-HiC may not only be a method of capturing three-dimensional conformations of chromatin with Spatial resolution, but may also be used in conjunction with other histologic data, such as single cell transcriptomes, to study the function of the three-dimensional conformations of chromatin in an organism from multiple dimensions and to regulate the molecular mechanisms of gene expression.
Table 14:
table 14 shows the results of bioinformatic analysis of sequencing data from a Spatial Hi-C experiment performed on day 13.5 tissue sections of mice. Sequencing to obtain total reads; the number of reads of the Barcode H and the Barcode V are correctly connected; mapping, correctly mapping the number of reads on the mouse reference genome; valid reads, total reads number containing chromatin three-dimensional conformational information; trans, the number of reads containing interactions between different chromosomes; cis_ short range contact (< 20 kb) number of reads containing short-range interactions inside the chromosome; cis_ long range contact (> 20 kb) contains the number of reads of long-range interactions within the chromosome; pixnum, the number of all pixels that can detect reads; mean cis long, average number of reads per pixel chromosome interacting over long distances.
FIG. 6 shows the A/B values of pixels from liver regions in E13.5 day tissue sections of mice in the examples of the present invention in combination with single cell transcriptome analysis.
Claims (12)
1. Analysis of a three-dimensional conformation of a space chromatin, capture of a three-dimensional conformation of a space chromatin, or a method of high throughput sequencing and banking of a three-dimensional conformation of a space chromatin, the method being a non-disease diagnostic method, the method comprising the steps of:
(1) Crosslinking reaction is carried out on the tissue slice, cells and cell nuclei are permeabilized, and the chromatin in the cells is fragmented;
(2) Performing a chromatin proximity ligation reaction;
(3) Performing enzyme digestion fragmentation on the chromatin adjacent connection product obtained in the step (2) by using a Tn5 transposase complex, adding different connectors at two ends of the chromatin adjacent connection product fragment, wherein one end is a sequencing connector adapter 2, and the other end is a connector adapter 1 for connecting with Barcode, so as to obtain a chromatin adjacent connection product fragment with connectors;
(4) Connecting a spatial position information specific transverse marker BarcodeH connecting complex and a longitudinal marker BarcodeV connecting complex on the 5 'end or the 3' end of the chromatin adjacent connecting product fragment with the connector obtained in the step (3) through a connecting reaction, wherein the BarcodeH connecting complex comprises BarcodeH, and the BarcodeV connecting complex comprises BarcodeV; overlapping the tissue slice treated by the Tn5 transposase compound with a transverse microfluidic chip to form a transverse channel on the combined surface of the tissue slice and the microfluidic chip, and adding a connecting mixture mixed with different types of BarcodeH into a sample adding hole to perform a connecting reaction; then, overlapping the two micro-fluidic chips with a longitudinal micro-fluidic chip, forming a longitudinal channel on the combined surface of the tissue slice and the micro-fluidic chip, adding a connecting mixture mixed with different types of BarcodeV into a sample adding hole, and carrying out a connecting reaction, wherein the cross point of the transverse channel and the cross point of the longitudinal channel are Pixel;
The BarcodeH has the following sequence:
5Phos/CATCGGCGTACGACT[BarcodeHi]ATCCACGTGCTTGAG，
BarcodeHi is a DNA sequence with the length of 3-50bp, is used for positioning the position of a transverse channel where the Reads are positioned, i represents the number of channels,
the BarcodeV has the following sequence:
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG [ BarcodeVj ] GTGGCCGATGTTTCG the BarcodeVj is a DNA sequence with a length of 3-50bp, and is used for positioning the position of a longitudinal channel where the Reads are located, and j represents the number of channels;
the Tn5 transposase complex comprises a Tn transposase, an ME sequence, and a linker sequence comprising a sequence that matches the Barcode sequence ligated in step (4),
the linker sequences include adapter 1 and adapter 2,
the adapter 1 has the following structure:
[5Phos/linker1]-[ME-R]，
the ME-R is complementary to the ME sequence, and forms a complementary structure when annealing with the ME sequence, and linker1 is used for connecting with the BarcodeH connecting complex;
the adapter 2 has the following structure:
[ sequencing primer ] - [ ME-R ],
the ME-R is complementary to the ME sequence and forms a complementary structure when annealed to the ME sequence,
the cells in step (1) are cells in a tissue section and the method is performed in situ on the tissue section.
2. The method according to claim 1, characterized in that in step (2) the site where the chromatin proximity ligation reaction takes place is marked with a marker, which marker is biotin; and is also provided with
After the step (1) of fragmenting the chromatin in the cells to obtain a cohesive end, the cohesive end of the chromatin is filled in and biotin-labeled bases are introduced to obtain a blunt end fragment containing the biotin label.
3. The method of claim 1, wherein said adapter 1 has the sequence:
5Phos/CGCGCTGCATACTTGAGATGTGTATAAGAGACAG；
the adapter 2 has the following sequence:
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG；
the ME sequence has the following sequence:
5Phos/CTGTCTCTTATACACATCT/3ddC。
4. the method according to claim 1, wherein the barcoded H ligation complex and the barcoded V ligation complex are added to the 5 'end or the 3' end of the adaptor-ligated chromatin-adjacent ligation product fragment obtained in step (3),
the BarcodeH ligation complex comprises Linker H and BarcodeH domains,
the Linker H has the following structure:
[linker1-R]-[linker2]，
wherein the linker1-R comprises a part or all of the complementary sequences of the linker1,
the Barocde H domain has the following structure:
[5Phos/linker3]-[BarcodeHi]-[linker2-R]，
wherein the Linker2-R comprises a part or all of the complementary sequence of the Linker 2;
the Barcode V connection complex comprises Linker V and Barcode V domains,
the Linker V has the following structure:
[linker3-R]-[linker4]，
wherein the linker3-R comprises a part or all of the complementary sequences of the linker3,
The BarcodeV domain has the following structure:
[Primer]-[BarcodeVj]-[linker4-R]，
wherein the linker4-R comprises a part or all of the complementary sequence of the linker 4.
5. The method according to claim 4, wherein,
the Linker H has the following sequence:
CAAGTATGCAGCGCGCTCAAGCACGTGGAT；
the Linker V has the following sequence:
AGTCGTACGCCGATGCGAAACATCGGCCAC。
6. the method according to claim 1, further comprising the step of enriching the labeled fragments with magnetic beads after step (4), wherein the labeling is performed with a label at the site where the chromatin proximity ligation reaction occurs in step (2), and/or
The method further comprises the step of enriching the biotin-labeled fragments with magnetic beads after step (4).
7. The method according to claim 1, characterized in that the method further comprises the step of treating the chromatin with HCl after the chromatin proximity ligation reaction of step (2).
8. The method of claim 1, wherein in the step (4), a microfluidic chip marking technology is adopted to connect a spatial position information specific Barcode sequence mark, and the width of a microfluidic channel in the microfluidic chip is 5-500 μm; the number of the microfluidic channels in the microfluidic chip is 4-40000 channels.
9. A method according to claim 1, characterized in that the method comprises the steps of:
(a) Performing a cross-linking reaction on the tissue;
(b) Permeabilizing cells and nuclei;
(c) Fragmenting the chromatin in the cells by using an enzyme cleavage reaction;
(d) Introducing biotin-labeled bases into the chromatin fragment;
(e) Ligating spatially adjacent DNA fragments using a ligase, wherein the biotin marks the location where the adjacent ligation occurred;
(f) Treating the product obtained in step (e) with HCl to remove histones on chromatin, and then cleaving the chromatin DNA fragment in the nucleus with Tn5 transposase complex while adding a linker at both ends;
(g) Superposing the tissue slice treated by the Tn5 transposase compound in the step (f) with a transverse microfluidic chip, forming a transverse channel on the combined surface of the tissue slice and the microfluidic chip, and adding a connecting mixture mixed with different types of BarcodeH into a sample adding hole for connection reaction;
(h) Superposing the tissue slice processed in the step (g) and a longitudinal micro-fluidic chip together, forming a longitudinal channel on the combined surface of the tissue slice and the micro-fluidic chip, and adding a connecting mixture mixed with different types of Barcodev into a sample adding hole for connection reaction;
(i) Performing a decrosslinking reaction on the tissue slice treated in the step (h) by using a decrosslinking buffer solution; and
(j) After recovery of the DNA, the biotin-labeled fragments were enriched using magnetic beads.
10. A method of spatial chromatin three-dimensional conformational high throughput sequencing, the method being a non-disease diagnostic method, the method comprising the steps of the spatial chromatin three-dimensional conformational high throughput sequencing pooling method of any one of claims 1 to 9, and the step of performing sequencing.
11. A method for preparing a spatial multiplex optical map, which is a non-disease diagnosis method, comprising the steps of the method for capturing a three-dimensional conformation of a spatial chromatin according to any one of claims 1 to 9, a step of reverse transcription using a ploy T primer comprising a part or all of the linker sequence, and a step of performing a multiplex ligation reaction on each slice after ligation of a Barcode sequence marker specific for spatial position information in step (4).
12. A method of analysis of a spatially chromatin three-dimensional conformational high throughput sequencing library, the method being a non-disease diagnostic method, characterized in that the method comprises the steps of the method according to any one of claims 1-9, and the steps of:
(a) Extracting the Barcode combined sequence in the sequencing sequence, and filtering the pair of sequencing sequences which are not connected correctly;
(b) Removing the adaptor of the sequencing data, and simultaneously filtering low-quality sequencing data;
(c) Aligning the sequenced sequences to the reference genomes, respectively;
(d) Converting the aligned bam file into a chromatin interaction matrix file of 1Mb bin;
(e) Splitting the chromatin mutual matrix file into matrix files of a single transverse and longitudinal channel crossing area;
(f) Normalizing the interaction matrix of each single transverse and longitudinal channel intersection region to an element sum of 10000;
(g) Performing cluster analysis on the data of the crossing areas of the single transverse and longitudinal channels to obtain a classification result;
(h) Mapping the clustering analysis result on the picture of the tissue slice according to the pixel position formed by the transverse and longitudinal channels, and analyzing the corresponding relation between the cross area of each type of transverse and longitudinal channel and the position of each type of transverse and longitudinal channel by combining the morphological characteristics of the tissue slice.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210819357.7A CN114891858B (en) | 2022-07-13 | 2022-07-13 | Chromatin three-dimensional conformation capturing method and application thereof |
| PCT/CN2023/106632 WO2024012418A1 (en) | 2022-07-13 | 2023-07-10 | Chromatin three-dimensional conformation capture method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210819357.7A CN114891858B (en) | 2022-07-13 | 2022-07-13 | Chromatin three-dimensional conformation capturing method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114891858A CN114891858A (en) | 2022-08-12 |
| CN114891858B true CN114891858B (en) | 2023-05-02 |
Family
ID=82729258
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210819357.7A Active CN114891858B (en) | 2022-07-13 | 2022-07-13 | Chromatin three-dimensional conformation capturing method and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN114891858B (en) |
| WO (1) | WO2024012418A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891858B (en) * | 2022-07-13 | 2023-05-02 | 广州国家实验室 | Chromatin three-dimensional conformation capturing method and application thereof |
| CN116606910B (en) * | 2023-07-21 | 2023-10-13 | 中国农业科学院农业基因组研究所 | Metagenomic GutHi-C library building method suitable for microbial population and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107463801A (en) * | 2017-07-31 | 2017-12-12 | 浙江绍兴千寻生物科技有限公司 | A kind of Drop seq data quality controls and analysis method |
| CN113604545A (en) * | 2021-08-09 | 2021-11-05 | 浙江大学 | Ultrahigh-throughput single-cell chromatin transposase accessibility sequencing method |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017066907A1 (en) * | 2015-10-19 | 2017-04-27 | 安诺优达基因科技(北京)有限公司 | Method of building hi-c library having high usable data ratio |
| CN106591955B (en) * | 2015-10-19 | 2019-10-29 | 浙江安诺优达生物科技有限公司 | Construct high-resolution, the method in the unicellular library Hi-C of large information capacity |
| CN106480178B (en) * | 2016-09-27 | 2019-11-19 | 华中农业大学 | DLO Hi-C chromosomal conformation catching method |
| CN106754868A (en) * | 2016-11-29 | 2017-05-31 | 武汉菲沙基因信息有限公司 | A kind of method of the DNA fragmentation interacted in capture Matrix attachment region |
| CN106591289A (en) * | 2016-12-16 | 2017-04-26 | 武汉菲沙基因信息有限公司 | Method for capturing interacted DNA fragments in tissue nuclear genome |
| SG11201901822QA (en) * | 2017-05-26 | 2019-03-28 | 10X Genomics Inc | Single cell analysis of transposase accessible chromatin |
| US11074991B2 (en) * | 2017-12-27 | 2021-07-27 | The Jackson Laboratory | Methods for multiplex chromatin interaction analysis by droplet sequencing with single molecule precision |
| CN109056078A (en) * | 2018-09-18 | 2018-12-21 | 武汉菲沙基因信息有限公司 | A kind of Hi-C high-flux sequence banking process suitable for bacterium |
| US20230227809A1 (en) * | 2020-07-29 | 2023-07-20 | The Jackson Laboratory | Multiplex Chromatin Interaction Analysis with Single-Cell Chia-Drop |
| CN114085897A (en) * | 2020-09-29 | 2022-02-25 | 生物岛实验室 | Space omics sequencing method |
| CN112522371A (en) * | 2020-12-21 | 2021-03-19 | 广州基迪奥生物科技有限公司 | Analysis method of spatial transcriptome sequencing data |
| CN113466444B (en) * | 2021-06-18 | 2023-07-18 | 中山大学 | Chromatin conformation capturing method |
| CN113444768B (en) * | 2021-06-18 | 2023-07-18 | 中山大学 | Method for detecting chromosome interaction |
| CN114891858B (en) * | 2022-07-13 | 2023-05-02 | 广州国家实验室 | Chromatin three-dimensional conformation capturing method and application thereof |
-
2022
- 2022-07-13 CN CN202210819357.7A patent/CN114891858B/en active Active
-
2023
- 2023-07-10 WO PCT/CN2023/106632 patent/WO2024012418A1/en unknown
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107463801A (en) * | 2017-07-31 | 2017-12-12 | 浙江绍兴千寻生物科技有限公司 | A kind of Drop seq data quality controls and analysis method |
| CN113604545A (en) * | 2021-08-09 | 2021-11-05 | 浙江大学 | Ultrahigh-throughput single-cell chromatin transposase accessibility sequencing method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114891858A (en) | 2022-08-12 |
| WO2024012418A1 (en) | 2024-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114891858B (en) | Chromatin three-dimensional conformation capturing method and application thereof | |
| CN107586835B (en) | Single-chain-linker-based construction method and application of next-generation sequencing library | |
| US11702693B2 (en) | Methods for printing cells and generating arrays of barcoded cells | |
| JP7234114B2 (en) | Analysis system for orthogonal access to biomolecules within cellular compartments and tagging of biomolecules within cellular compartments | |
| US20210024996A1 (en) | Method for verifying bioassay samples | |
| US10731152B2 (en) | Method for controlled DNA fragmentation | |
| EP3192869B1 (en) | Isolated oligonucleotide and use thereof in nucleic acid sequencing | |
| CN105189308B (en) | The multiple labelling of length dna segment | |
| JP2022036975A (en) | Rapid Sequencing of Short DNA Fragments Using Nanopore Technology | |
| CN113832139A (en) | Suppression of errors in sequenced DNA fragments using redundant reads with Unique Molecular Index (UMI) | |
| US20160362735A1 (en) | Sequencing library, preparation method and use thereof | |
| EP4007818A1 (en) | Methods and reagents for nucleic acid sequencing and associated applications | |
| US20200362403A1 (en) | Methods and kits for amplification of double stranded dna | |
| CN111118001B (en) | Universal joint for multiple sequencing platforms, library construction method suitable for multiple sequencing platforms and kit | |
| KR20190037201A (en) | The number of long-range linkage information from the preserved samples | |
| US11370810B2 (en) | Methods and compositions for preparing nucleic acids that preserve spatial-proximal contiguity information | |
| CA3110800A1 (en) | Molecular neighborhood detection by oligonucleotides | |
| KR20230117036A (en) | Methods and systems for visualizing short reads in repetitive regions of a genome | |
| US11136576B2 (en) | Method for controlled DNA fragmentation | |
| CN115851876A (en) | Sequencing method for simultaneously obtaining whole genome transcription and protein-DNA binding information | |
| EP4172357B1 (en) | Methods and compositions for analyzing nucleic acid | |
| WO2021023123A1 (en) | Method and kit for non-specific amplification of natural short-fragment nucleic acid | |
| US20230235385A1 (en) | Method for adding spatially-addressable barcodes to nucleic acids of a cellular sample in situ | |
| WO2024078585A1 (en) | Method for generating probes on carrier and method for detecting target substance in sample | |
| US20230279489A1 (en) | Barcoded Solid Supports and Methods of Making and Using Same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |