CN114891831A

CN114891831A - Endothelial cell strain for over-expressing WNT2 gene and construction method and application thereof

Info

Publication number: CN114891831A
Application number: CN202210043202.9A
Authority: CN
Inventors: 王韫芳; 柳娟; 陈虹宇
Original assignee: Beijing Tsinghua Changgeng Hospital
Current assignee: Beijing Tsinghua Changgeng Hospital
Priority date: 2022-01-14
Filing date: 2022-01-14
Publication date: 2022-08-12

Abstract

The invention provides an endothelial cell strain for over-expressing WNT2 gene, a construction method and application thereof, wherein the method for constructing the cell strain comprises the following steps: the WNT2 gene of endothelial cells was overexpressed. The cell strain overexpresses WNT2 gene, can promote the proliferation of endothelial cells, increase the vascularization of the endothelial cells, promote the expression of drug metabolism related genes of hepatic progenitor cells, is beneficial to constructing models of vascular development, drug-induced liver injury and the like, can be applied to the mechanism research of diseases such as gene-defective vascular diseases, drug-induced liver injury and the like, the research and development of targeted drugs and the detection of hepatotoxicity and the like, and has wide application prospect.

Description

Endothelial cell strain for over-expressing WNT2 gene and construction method and application thereof

Technical Field

The invention relates to the field of biomedicine. Specifically, the invention relates to an endothelial cell strain over-expressing WNT2 gene, a construction method and application thereof.

Background

The normal vascular system is the basis for the maintenance of homeostasis and metabolism for cell growth, endothelial cells, also known as vascular endothelial cells, generally refer to a single layer of flattened epithelium lining the interior surfaces of the heart, blood vessels, and lymph vessels, which forms the interior walls of the blood vessels. They have the function of phagocytizing foreign bodies, bacteria, necrotic and senescent tissues and also participate in the immune activities of the body.

WNT protein encoded by WNT gene is secreted glycoprotein of 350-400 amino acids, which regulates intercellular signal transduction during embryogenesis, including fly, worm, human, etc. Many wnt genes have been discovered among different animals, and 19 genes are included in humans (wnt1, wnt2, wnt3, wnt4, wnt5, wnt5a, wnt5b, wnt6, wnt7b, wnt10b, wnt11, etc.). Dysregulation or overactivation of wnt gene-mediated signaling pathways can lead to tumor formation, invasion and metastasis. Wnt2 is an evolutionarily conserved secretory glycoprotein belonging to WNT family, a Wnt2 gene is positioned on human chromosome 7q31.3, and is combined with a 7-transmembrane protein receptor Fzd9, and a common receptor LRP5/6 is cooperated to activate Dishevelled (DLV) to prevent beta-catenin from degrading, so that the beta-catenin is translocated into the nucleus and transcription of related target genes at the downstream is promoted. Proved by research, the wnt2 can promote the growth and differentiation of tissues such as midbrain and abdomen and the like by activating the wnt/beta-catenin classical pathway. The abnormality of the wnt/beta-catenin signal transduction pathway is related to human diseases, including tumor, osteoporosis, aging, degeneration and the like. Wnt2 can promote the growth and invasion capacity of esophagus cancer cells by activating the wnt/beta-catenin classical pathway.

The liver is a parenchymal organ capable of rapid regeneration after injury, but this ability to regenerate is not unlimited. Under many disease conditions, the regeneration ability of the liver cells and the loss of liver functions cannot be completely compensated due to various pathological factors, so that transplantation is still the final choice for treating explosive liver failure and terminal chronic liver diseases, and the research on liver regeneration is very necessary today with the increasing shortage of liver sources.

Currently, the molecular mechanisms of WNT2 in regeneration following diseases such as liver injury and in tumorigenesis progression, particularly in angiogenesis and growth, remain to be studied.

Disclosure of Invention

The present invention aims to solve at least to some extent at least one of the technical problems of the prior art. Therefore, the invention provides a method for constructing a cell strain, the cell strain, application and a culture medium thereof, the cell strain overexpresses WNT2 gene, can promote proliferation of endothelial cells, increase vascularization of the endothelial cells, promote expression of liver progenitor cell drug metabolism related genes, is beneficial to constructing models of vascular development, drug-induced liver injury and the like, can be applied to mechanism research of diseases such as gene-defective vascular diseases and drug-induced liver injury, research and development of targeted drugs, detection of hepatotoxicity and the like, and has wide application prospect.

In a first aspect of the invention, the invention provides a method of constructing a cell line. According to an embodiment of the invention, the method comprises: the WNT2 gene of endothelial cells was overexpressed. Therefore, the cell strain constructed by the method disclosed by the embodiment of the invention overexpresses WNT2 gene, can promote the proliferation of endothelial cells, increase the vascularization of the endothelial cells and promote the expression of drug metabolism related genes of hepatic progenitor cells, is beneficial to constructing models of vascular development, drug-induced liver injury and the like, can be applied to the mechanism research of diseases such as gene-defective vascular diseases and drug-induced liver injury, the research and development of targeted drugs and the detection of hepatotoxicity and the like, and has wide application prospect.

According to an embodiment of the present invention, the method for constructing a cell line may further have the following additional technical features:

according to an embodiment of the invention, the endothelial cells are selected from SK-HEP-1, HUVEC or primary endothelial cells.

According to an embodiment of the invention, the method comprises: 1) amplifying a plasmid constructed with WNT2 gene overexpression; 2) Packaging the plasmid obtained in the previous step with lentivirus to obtain WNT2 gene overexpression lentivirus; 3) and infecting endothelial cells by using the WNT2 gene overexpression lentivirus to obtain a WNT2 gene overexpression cell strain.

According to an embodiment of the invention, the plasmid is selected from pLV-WNT 2-GFPSpark. The plasmid is purchased from Beijing Yiqiao Shenzhou science and technology corporation (Cat: HG10171-ACGLN), and the amplification process comprises the steps of plasmid transformation of competent cells of the large intestine, monoclonal colony selection, thallus amplification and plasmid extraction.

According to an embodiment of the invention, the lentivirus is selected from HEK-293T or HEK-293 FT. The HEK-293T cell can be used for retrovirus production, gene expression and protein production, and the HEK-293FT can obtain high-low-grade lentivirus.

According to an embodiment of the invention, the lentiviral packaging employs a plasmid selected from the group consisting of psPAX2 and pmd2. g. The two plasmids and pLV-WNT2-GFPSpark form a three-plasmid system together, so that the stability of the vector is increased, and the lentiviral particles with high titer and high infectivity are safely produced.

According to an embodiment of the invention, the method further comprises: 4) and (3) carrying out flow cytometric sorting on the obtained cell strain with the WNT2 gene over-expressed. Therefore, endothelial cells with high expression of WNT2 gene can be obtained by cell sorting.

In a second aspect of the invention, the invention provides a cell line. According to an embodiment of the invention, WNT2 gene was overexpressed in the cell lines. Therefore, the cell strain provided by the embodiment of the invention can promote the proliferation of endothelial cells, increase the vascularization of the endothelial cells and promote the expression of liver progenitor cell drug metabolism related genes, is beneficial to constructing models of vascular development, drug-induced liver injury and the like, can be applied to mechanism research of diseases such as gene-defective vascular diseases and drug-induced liver injury, research and development of targeted drugs and detection of hepatotoxicity and the like, and has a wide application prospect.

According to an embodiment of the present invention, the cell line is obtained by the method for constructing a cell line as described above.

According to the embodiment of the invention, the cell strain SK-HEP-1-WNT2 is preserved in China general microbiological culture Collection center (CGMCC) at 10.12.2021, with the address of No. 3 Xilu-Shi-1 of the rising area of Beijing, and the preservation number is CGMCC NO: 23036 and scientifically described as a cell line.

In a third aspect, the present invention provides the use of a cell line according to the second aspect above. The cell strain overexpresses WNT2 gene, can promote the proliferation of endothelial cells, reduce the vascularization of the endothelial cells, promote the differentiation of hepatic progenitor cells to bile duct cells and the like, is beneficial to constructing models of vascular development, liver regeneration, tumor angiogenesis and the like, can be applied to the mechanism research of diseases such as gene defective vascular diseases, liver injury, tumors and the like, the research and development and screening of preclinical targeted drugs and the like, and has wide application prospect.

According to the embodiment of the invention, the cell strain is used for constructing a disease model which is used for mechanism research of gene-deficient vascular diseases, liver injuries and tumor diseases, and development and/or screening of targeted drugs.

According to an embodiment of the present invention, the cell line is used for up-regulating the ALB gene, CYP2E1 gene, CYP1A2 gene, CYP3A4 gene expression of hepatic progenitor cells.

In a fourth aspect of the invention, a culture medium is provided. According to an embodiment of the present invention, the medium contains the cell line obtained by the method for constructing a cell line according to the first aspect or a metabolite secreted by the cell line according to the second aspect. Therefore, the culture medium according to the embodiment of the invention promotes the expression of the gene related to the drug metabolism of the liver cells, and is beneficial to establishing the drug metabolism function of the liver cells.

In a fifth aspect of the invention, a method of increasing endothelial cell tubulogenesis is provided. According to an embodiment of the invention, the method comprises: the WNT2 gene of endothelial cells was overexpressed. The inventor finds that the WNT2 gene overexpression of endothelial cells can improve the tube forming capability of the endothelial cells.

In a sixth aspect of the invention, a method of promoting endothelial cell proliferation is provided. According to an embodiment of the invention, the method comprises: the WNT2 gene of endothelial cells was overexpressed. The inventors found that overexpression of WNT2 gene in endothelial cells promoted endothelial cell proliferation.

In a seventh aspect of the invention, the invention provides a method of up-regulating the expression of the ALB gene, CYP2E1 gene, CYP1a2 gene and/or CYP3a4 gene of hepatic progenitors. According to an embodiment of the invention, the method comprises: co-culturing the cell line of the second aspect with hepatic progenitors; or culturing hepatic progenitors in a medium as described in the fourth aspect.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a WNT2 gene expression plasmid map;

FIG. 2 is a fluorescence image of plasmid-transfected HEK-293FT at the third day;

FIG. 3 is a fluorescence diagram of lentivirus-infected endothelial cell SK-HEP-1 at day ten;

FIG. 4 is a diagram of SK-HEP-1 cell flow sorting protocol after viral infection;

FIG. 5 shows the results of qPCR overexpression identification;

FIG. 6 shows the identification of WB overexpression;

FIG. 7 is a SK-HEP-1-WNT2 cell proliferation curve;

FIG. 8 shows the result of SK-HEP-1-WNT2 cell tube formation experiment;

FIG. 9 shows the ALB expression level changes in HepaRG after SK-HEP-1-WNT2 cells and hepatic progenitor cells HepaRG-ALB were three-dimensionally co-cultured in a medium containing 2% serum for 10 days;

FIG. 10 shows the effect of SK-HEP-1-WNT2 cell secretion on the expression of genes related to drug metabolism function of HepaRG liver cells.

Detailed Description

The present invention is directed to a WNT2 overexpressing endothelial cell line, and will be illustrated in detail by the following specific examples.

The primers used in the examples were synthesized by Beijing Rui Boxing Ke Biotechnology Ltd.

The embodiments are implemented on the premise of the technical scheme of the invention, and detailed implementation modes and specific operation processes are given, which are helpful for understanding the invention, but should not be taken as limiting the content of the invention.

The methods used in the following examples are conventional unless otherwise specified, and specific procedures can be found in: a Molecular Cloning guide ("Molecular Cloning: A Laboratory Manual", Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor ").

The various biological materials described in the examples are obtained by way of experimental acquisition for the purposes of this disclosure and should not be construed as limiting the source of the biological material of the invention. In fact, the sources of the biological materials used are wide and any biological material that can be obtained without violating the law and ethics can be used instead as suggested in the examples.

The cells and culture method used in the examples of the present invention were:

endothelial cell-derived human hepatoma cell line SK-HEP-1 was purchased from cell center of Chinese academy of medicine, and cultured in MEM medium containing 10%% Fetal Bovine Serum (FBS) for adherent culture; HEK-293FT cells: the SV40 large T transformed human embryonic kidney epithelial cell strain is self-prepared in a laboratory, and is subjected to adherent culture by using a DMEM culture medium containing 10% fetal calf serum for packaging lentivirus; terminally differentiated human liver cell strains hepar and hepar-ALB (a recombinant hepar cell with an mCherry fluorescent ALB reporter gene) are prepared in a laboratory, and are subjected to adherent culture by using a William' E culture medium containing 10% fetal calf serum.

The strains and plasmid vectors used in the examples of the present invention were:

coli DH5 α competent cells: the plasmid is used for transformation of general plasmids and recombinant ligation products, and is purchased from Beijing Quanjin Biotechnology Co.

WNT2 expression plasmid pLV-WNT2-GFPSpark, used in mammalian cells for eukaryotic expression of WNT2, purchased from Beijing Yi Qiao Shen science and technology GmbH, the plasmid map is shown in FIG. 1.

psPAX2 and pmd2.g (see CN 102174471A): belongs to lentivirus packaging plasmids, and a three-plasmid lentivirus packaging system is utilized to increase the stability of the vector and safely produce the lentivirus particles with high titer and high infectivity.

Example 1: amplification of plasmids

This example is applicable to the amplification of expression plasmids (pLV-WNT2-GFPSpark) and packaging plasmids (psPAX2, pMD2.G) comprising the following steps:

1) and (3) transformation: this was done according to the complete gold Trans5 α chemical company Cell (cat # CD201) instructions. Adding 1 μ l of the dissolved plasmid into 50 μ l of the just dissolved competent cells, standing on ice for 30min, performing metal bath at 42 ℃ for 45 sec, immediately turning to ice, standing for 2min, adding 500 μ l of liquid LB medium without antibiotics, and placing on a shaker at 37 ℃ for 1 hr to resuscitate the competent cells. Centrifugation was carried out at 1000rpm/min for 1min, 400. mu.l of the supernatant was removed, the remaining competent cells were resuspended, the cells were evenly spread on a solid LB plate containing ampicillin, and the plate was subjected to inverted culture at 37 ℃ for 12 to 14 hours. Colonies of individual clones on LB plates were picked up and numbered in LB liquid medium containing ampicillin, and cultured overnight at 37 ℃ with shaking at 200 r/min.

2) And (3) plasmid sequencing identification: sequencing 1ml of the overnight cultured bacterial liquid, and analyzing the sequencing result by using Snapgene software to obtain a positive clone with correct sequencing, wherein the nucleotide sequence of the positive clone is as follows:

ATAGGGCGGCCGGGATTCTAATACGACTCACTATAGGGGCCGCCACCAAGCTTGGTAC CATGAACGCCCCTCTCGGTGGAATCTGGCTCTGGCTCCCTCTGCTCTTGACCTGGCTC ACCCCCGAGGTCAACTCTTCATGGTGGTACATGAGAGCTACAGGTGGCTCCTCCAGG GTGATGTGCGATAATGTGCCAGGCCTGGTGAGCAGCCAGCGGCAGCTGTGTCACCGA CATCCAGATGTGATGCGTGCCATTAGCCAGGGCGTGGCCGAGTGGACAGCAGAATGC CAGCACCAGTTCCGCCAGCACCGCTGGAATTGCAACACCCTGGACAGGGATCACAGC CTTTTTGGCAGGGTCCTACTCCGAAGTAGTCGGGAATCTGCCTTTGTTTATGCCATCTC CTCAGCTGGAGTTGTATTTGCCATCACCAGGGCCTGTAGCCAAGGAGAAGTAAAATCC TGTTCCTGTGATCCAAAGAAGATGGGAAGCGCCAAGGACAGCAAAGGCATTTTTGAT TGGGGTGGCTGCAGTGATAACATTGACTATGGGATCAAATTTGCCCGCGCATTTGTGG ATGCAAAGGAAAGGAAAGGAAAGGATGCCAGAGCCCTGATGAATCTTCACAACAAC AGAGCTGGCAGGAAGGCTGTAAAGCGGTTCTTGAAACAAGAGTGCAAGTGCCACGG GGTGAGCGGCTCATGTACTCTCAGGACATGCTGGCTGGCCATGGCCGACTTCAGGAA AACGGGCGATTATCTCTGGAGGAAGTACAATGGGGCCATCCAGGTGGTCATGAACCA GGATGGCACAGGTTTCACTGTGGCTAACGAGAGGTTTAAGAAGCCAACGAAAAATGA CCTCGTGTATTTTGAGAATTCTCCAGACTACT

3) plasmid extraction: according to the obtained positive clone colony, 1ml of corresponding bacterial liquid is added into 50ml of liquid LB culture medium containing benzyl resistance to be cultured overnight, and plasmid extraction is carried out according to the specification of DP 108-endotoxin-free plasmid medium extraction kit of Tiangen Biotechnology (Beijing) Limited company.

Example 2: lentiviral packaging

In this embodiment, the plasmid with correct sequencing obtained in the above embodiment 1 is used for lentivirus packaging and purification to obtain a lentivirus concentrate carrying the target gene WNT2, and the specific packaging and purification steps are as follows:

1) one day before transfection, HEK-293FT lentivirus packaging cells are inoculated in a 10cm culture dish, and transfection can be carried out when the cell density reaches about 70% on the next day.

2) The transfection system was as follows:

name (R)	Dosage of
		pLV-WNT2-GFPSpark	10.7μg
psPAX2	8μg
		pMD2.G	5.3μg
CaCl ₂ (2.5M)	50μl
		Milli-Q water	To 500. mu.l
2×HBS	500μl
		General assembly	1ml

3) Repeatedly blowing with a gun head in the form of bubbling for at least 100 times to obtain flocculent precipitate in the liquid, standing at room temperature for 20 min, and adding into HEK-293FT cells in a Z shape. After 6-8h incubation in an incubator at 37 ℃ the medium was replaced with fresh medium and sodium butyrate was added to a final concentration of 5 mM. The observation of the GFP expression effect of the HEK-293FT cells is carried out by a fluorescence microscope in the culture process, as shown in figure 2, the HEK-293FT cells have high green fluorescence brightness and good poison production effect on the third day of transfection, and the HEK-293FT cells can be successfully transfected by the visible expression plasmid.

5) The culture supernatant was collected as a virus stock after 72 hours of transfection, and the collected virus stock was filtered through a 0.45 μm filter into a 50mL centrifuge tube and centrifuged at 12000 Xg for 15 minutes at 4 ℃ to remove cell debris, thereby obtaining a crude virus extract.

6) The virus solution was concentrated according to the full-scale gold TransLv viral precipitation solution (5X) protocol to obtain WNT2 lentivirus concentrate.

Example 3: construction of WNT2 endothelial cell line overexpressing SK-HEP-1(SK-HEP-1-WNT2)

In the embodiment, the WNT2 lentivirus concentrate obtained in the embodiment 2 is used for infecting SK-HEP-1 cells, and the infection effect of the target plasmid on the SK-HEP-1 cells is detected, and the method specifically comprises the following steps:

1) and (3) on the third day of virus packaging, inoculating the target cell SK-HEP-1 into a 6cm dish, and infecting when the cell density reaches 30% -50% on the second day.

2) 200. mu.l of freshly harvested or thawed virus concentrate taken from-80 ℃ was added to SK-HEP-1 medium, along with 4. mu.g/ml polybrene to increase the infection efficiency.

3) After 48 hours, the virus infection of SK-HEP-1 cells is observed by fluorescence, and the above step 2) can be repeated to enhance the infection efficiency. The tenth-day fluorescence microscope observation result of SK-HEP-1 cells infected by viruses is shown in figure 3, stable expression of green fluorescent protein can be seen, the infection effect is good, and the SK-HEP-1 cells can be verified to be successfully infected by the target plasmid pLV-WNT 2-GFPSpark. SK-HEP-1 cells confirmed to be infected with lentivirus as described above were designated as pSK-HEP-1-WNT2 cells.

4) Flow type separation: after pSK-HEP-1-WNT2 cells reached 80-90% of GFP positive cells under a fluorescence microscope, 1ml of MEM (2xFBS +2xPS + 10. mu. M Y-27) was used to resuspend the cells, and 1 × 10 cells were prepared ⁷ SK-HEP-1 and pSK-HEP-1-WNT2 cells, 70 μm filter cells into a sterile flow tube, placed on ice, ready for use. Setting a sorting program according to a flow sorting scheme of FIG. 4, adding 1ml of MEM (2xFBS +2xPS +10 mu M Y-27) in advance into a receiving tube, and respectively collecting pSK-HEP-1-WNT2 cells with high expression of GFP, corresponding to SK-HEP-1 cells with high expression of WNT2 and named as SK-HEP-1-WNT2 cells (preserved in China general microbiological culture Collection center at 10.12.2021, with the preservation number of CGMCC NO: 23036).

5) WNT2 overexpression validation:

the overexpression verification is mainly performed from mRNA transcription level and protein translation level and is realized through qPCR and WB respectively, and the specific steps are as follows:

a)qPCR:

extracting RNA by using a Trizol method, carrying out reverse transcription to obtain cDNA according to the instructions of a Toyo spin reverse transcription kit, and then carrying out qPCR detection:

dilution of cDNA: to 20. mu.l of cDNA after reverse transcription, 180. mu.l of ddH was added ₂ And O, mixing and centrifuging, and using the cDNA diluted by 10 times for real-time quantitative PCR reaction.

2. Preparation of primers: first, the primer is ddH ₂ O is diluted to 100. mu.M and then 10. mu.l forward + 10. mu.l reverse + 380. mu.l ddH is added ₂ And O, preparing 400 mu l of primer mixture, mixing uniformly, centrifuging and using for real-time quantitative PCR reaction.

3. Preparing a real-time quantitative PCR reaction system:

cDNA template	2μl
		Bidirectional primer mixture	2μl
TransStart Tip Green qPCR SuperMix	10μl
		ddH ₂ O	6μl
Total	20μl

qPCR reaction procedure

5. And (3) detecting the specificity of the primers: the primer specificity was detected by adding a melting curve reaction, and by observing a peak pattern from 0.5 ℃ to 90 ℃ every 10sec from the annealing temperature.

6. And (4) analyzing results: the result analysis is carried out by the instrument matched with special software, and the expression condition of the target gene mRNA in different cells relative to the internal reference is detected.

The qPCR result is shown in FIG. 5, and it can be seen that WNT2 has a significantly higher mRNA level expression in SK-HEP-1-WNT2 cells than in SK-HEP-1 cells, which indicates that SK-HEP-1 cells modified by the target plasmid infection successfully overexpress WNT2 at the transcription level.

b)Western Blot:

1. Protein cleavage: the lysis solution has the following formula

20％SDS	5mL
		DTT(1M)	5mL
Tris(1M，pH6.8)	3mL
		100% Glycerol	5mL
H ₂ O	32mL
		Protease inhibitors (100X)	Optionally
Phosphatase inhibitors (100X)	Optionally
		Bromophenol blue	On demand
Total volume	50ml

The medium was aspirated off the 6cm dish, washed twice with pre-cooled l × PBS, 400 μ l of cell lysate (containing bromophenol blue) was added, the cells were stirred and collected in a 1.5ml EP tube, the protein was denatured by a 98 ℃ metal bath for l 0min, centrifuged at 12000rpm/min for 5min at 4 ℃, the cell debris was removed, and the supernatant was used for electrophoresis or stored at-20 ℃ for future use.

The formulation of the SDS polyacrylamide gel is as follows:

	separating glue (10%)	Concentrated glue
			H ₂ O	4.8ml	2.85ml
30% polyacrylamide	4ml	0.85ml
			4 Xseparation/concentration of gel buffer	3ml	1.25ml
10％APS	0.3ml	0.1ml
			TEMED	9μl	10μl
Total volume	12ml	5ml

3. After electrophoresis, membrane conversion, 5% skimmed milk PBST solution sealing, primary antibody 4 ℃ incubation overnight, after washing, with primary antibody corresponding to horseradish peroxidase labeled IgG antibody for secondary antibody incubation, and finally on a chemiluminescence apparatus for color development.

The WB detection result is shown in FIG. 6, and it can be seen that the expression of WNT2 at the SK-HEP-1-WNT2 protein level is significantly higher than that of SK-HEP-1-Ctrl cells of a control plasmid group, which indicates that SK-HEP-1 cells transformed by target plasmid infection successfully overexpress WNT 2.

Example 4: effect of WNT2 overexpression on the SK-HEP-1 cell line

1) Effect on cell proliferation:

SK-HEP-1-Ctrl and SK-HEP-1-WNT2 cells are planted in a 96-well plate according to 1000 cells per well, 3 multiple wells are arranged on each cell, cell activity for 1, 2, 3 and 4 days is detected respectively by a trypan blue staining cell counting method, cell activity which is homogenized relative to the first day is calculated after 4 days are detected, and a proliferation curve is drawn by utilizing graphpad.

As shown in FIG. 7, the proliferation rate of SK-HEP-1-WNT2 cells was significantly increased compared with that of SK-HEP-1-Ctrl, indicating that WNT2 promotes the proliferation of SK-HEP-1 cells.

2) Effects on cell tubulogenesis:

starving SK-HEP-1-Ctrl and SK-HEP-1-WNT2 cells one day in advance with a basal medium for 24h, pre-spreading 50 μ l BME (a growth factor-reduced matrix component derived from Engelbreth-Holm-Swarm tumor) stock solution on a 96-well plate, forming a membrane at 37 ℃, then trypsinizing the cells, suspending in complete medium, and resuspending with 1 × 10 ⁴ Cell number per well cells were seeded in a BME-coated 96-well plate, and tube formation was observed microscopically every 2 hours from the start of seeding and recorded by photographing.

The tube forming result is shown in FIG. 8, the tube forming ability of SK-HEP-1-WNT2 cells is stronger than that of SK-HEP-1-Ctrl after inoculation for 8h, which indicates that WNT2 overexpression improves the tube forming ability of SK-HEP-1 cells.

Example 5: effect of SK-HEP-1-WNT2 on hepatocyte Hearg function

In this example, SK-HEP-1-Ctrl and SK-HEP-1-WNT2 cells were co-cultured with HepaRG-ALB reporter cells in three dimensions, respectively, and the expression of the HepaRG-ALB reporter gene after co-culture was observed by high content imaging, including the following steps:

1) after 8% agarose is heated to boil, a 96-well plate is pre-paved at 50 mu l/well, and ultraviolet irradiation is carried out for 30min after the cover is opened, so that a U-shaped 96-well plate is formed.

2) SK-HEP-1 and SK-HEP-1-WNT2 cells were treated 2h in advance with mitomycin 10. mu.g/ml to inhibit cell division and stopped growing, and the cells were seeded in agarose coated 96-well plates at a ratio of SK-HEP-1-Ctrl/SK-HEP-1-WNT2: HepaRG-ALB 1:2 at a total cell count of 600/well.

3) The following day the medium was half-changed to RPMI containing 2% FBS, 3 replicate wells per group.

4) Half-changing the culture medium every 2-3 days, and continuing culturing for 10 days.

5) The cell balls were collected in a 96-well plate (U-shaped bottom), incubated for 45min in hochests (1:1000), and tested on a computer.

The detection result is shown in FIG. 9, and it can be seen that SK-HEP-1-WNT2 can promote the ALB gene expression of HepaRG cells under the condition of 2% FBS culture medium.

Example 6: effect of SK-HEP-1-WNT2 endothelial cell secretion on HepaRG hepatocyte drug metabolism function

In this example, SK-HEP-1-Ctrl and SK-HEP-1-WNT2 cells were co-cultured with HepaRG cells in a transwell non-contact manner, and qPCR was performed to detect the expression of the genes related to drug metabolism of HepaRG, including the following steps:

1) heating 8% agarose for boiling, coating 24-pore plate with 250 μ l/pore, uncapping and ultraviolet irradiating for 30min, solidifying, adding 250 μ l/pore boiling agarose, immediately placing into porous stamp to obtain low adsorption bottom surface containing multiple micropores.

2) MMC treated SK-HEP-1-Ctrl/SK-HEP-1-WNT2 was seeded into the upper chamber at 20000 cells/well and thenHeparg at 2.5X10 ⁵ Individual cells/well were seeded in the lower chamber.

3) The medium was changed every 2 to 3 days, and the cells were cultured in complete medium of HepaRG for 10 days.

4) Collecting the HepaRG cells in the lower chamber to perform real-time quantitative PCR expression detection of the drug metabolism related genes.

The results are shown in FIG. 10. As can be seen, the secretion of SK-HEP-1-WNT2 cells has up-regulation effect on drug metabolism related genes CYP2E1, CYP1A2 and CYP3A4 of HepaRG cells.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Beijing Qinghua Changheptyl Hospital

<120> endothelial cell strain over-expressing WNT2 gene and construction method and application thereof

<130> BI3221105

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 891

<212> DNA

<213> Artificial Sequence

<220>

<223> 1

<400> 1

atagggcggc cgggattcta atacgactca ctataggggc cgccaccaag cttggtacca 60

tgaacgcccc tctcggtgga atctggctct ggctccctct gctcttgacc tggctcaccc 120

ccgaggtcaa ctcttcatgg tggtacatga gagctacagg tggctcctcc agggtgatgt 180

gcgataatgt gccaggcctg gtgagcagcc agcggcagct gtgtcaccga catccagatg 240

tgatgcgtgc cattagccag ggcgtggccg agtggacagc agaatgccag caccagttcc 300

gccagcaccg ctggaattgc aacaccctgg acagggatca cagccttttt ggcagggtcc 360

tactccgaag tagtcgggaa tctgcctttg tttatgccat ctcctcagct ggagttgtat 420

ttgccatcac cagggcctgt agccaaggag aagtaaaatc ctgttcctgt gatccaaaga 480

agatgggaag cgccaaggac agcaaaggca tttttgattg gggtggctgc agtgataaca 540

ttgactatgg gatcaaattt gcccgcgcat ttgtggatgc aaaggaaagg aaaggaaagg 600

atgccagagc cctgatgaat cttcacaaca acagagctgg caggaaggct gtaaagcggt 660

tcttgaaaca agagtgcaag tgccacgggg tgagcggctc atgtactctc aggacatgct 720

ggctggccat ggccgacttc aggaaaacgg gcgattatct ctggaggaag tacaatgggg 780

ccatccaggt ggtcatgaac caggatggca caggtttcac tgtggctaac gagaggttta 840

agaagccaac gaaaaatgac ctcgtgtatt ttgagaattc tccagactac t 891

Claims

1. A method for constructing a cell line, a method for promoting endothelial cell proliferation, or a method for improving endothelial cell tube forming ability, comprising: the WNT2 gene of endothelial cells was overexpressed.

2. The method of claim 1, wherein the endothelial cells are selected from SK-HEP-1, HUVEC or primary endothelial cells.

3. The method of claim 1, wherein the method of constructing the cell line comprises:

1) amplifying a plasmid constructed with WNT2 gene overexpression;

2) packaging the plasmid obtained in the previous step with lentivirus to obtain WNT2 gene overexpression lentivirus;

3) and infecting endothelial cells by using the WNT2 gene overexpression lentivirus to obtain a WNT2 gene overexpression cell strain.

4. The method according to claim 3, wherein the plasmid is selected from the group consisting of pLV-WNT 2-GFPSpark;

the lentivirus is selected from HEK-293T or HEK-293FT, and the plasmid adopted by the lentivirus package is selected from psPAX2 and pMD2. G;

optionally, the method of constructing a cell line further comprises:

4) and (3) carrying out flow cytometric sorting on the obtained cell strain with the WNT2 gene over-expressed.

5. A cell line in which WNT2 gene is overexpressed.

6. The cell line according to claim 5, which is obtained by the method for constructing a cell line according to any one of claims 1 to 4;

the cell strain is preserved in China general microbiological culture Collection center (CGMCC) at 10 months and 12 days in 2021, and the preservation number is CGMCC NO: 23036.

7. use of the cell line according to claim 5 or 6.

8. The use according to claim 7, wherein the cell line is used for constructing a disease model for mechanism research of gene-deficient vascular diseases, liver injury, tumor diseases, development and/or screening of targeted drugs;

optionally, the cell line is used for up-regulating the ALB gene, CYP2E1 gene, CYP1A2 gene, CYP3A4 gene expression of hepatic progenitor cells.

9. A culture medium comprising the cell line obtained by the method for constructing a cell line according to any one of claims 1 to 4 or a metabolite secreted by the cell line according to claim 7 or 8.

10. A method of upregulating the expression of the ALB gene, CYP2E1 gene, CYP1a2 gene, and/or CYP3a4 gene of hepatic progenitors comprising:

co-culturing the cell line of claim 5 or 6 with hepatic progenitors; or

Culturing hepatic progenitors in the medium of claim 9.