CN114891828B - Application of cotton beta-1, 3-glucanase gene GhGLU18 in improving cotton fiber quality - Google Patents

Abstract

The invention discloses an application of beta-1, 3-glucanase gene GhGLU18 in improving cotton fiber quality, wherein the gene has a nucleotide sequence shown as SEQ ID NO. 1. The beta-1, 3-glucanase GhGLU18 is an important gene in the cotton fiber development process and plays an important role in the elongation of fiber cells and the thickening of secondary cell walls. The invention reports that the gene affects cotton fiber development through participating in saccharide metabolism and cell wall synthesis for the first time. The gene is used as a target gene to construct a positive and negative sense expression vector, and a cotton transgenic material is created for functional verification. The result shows that the over-expression of GhGLU18 gene increases the content of soluble sugar and cellulose in the fiber, and the length and strength of the fiber are obviously increased; and inhibiting the gene expression reduces the content of soluble sugar and cellulose in the fiber, and obviously reduces the length and strength of the fiber. Therefore, over-expression of the gene in cotton can significantly improve cotton fiber quality.

Description

Application of cotton beta-1, 3-glucanase gene GhGLU18 in improving cotton fiber quality

Technical Field

The invention belongs to the field of biotechnology application, and relates to application of cotton beta-1, 3-glucanase gene GhGLU18 in improving cotton fiber quality. The cotton beta-1, 3-glucanase gene GhGLU18 ORF is 1014bp in full length, codes for 337 amino acids, and structurally comprises an N-terminal signal peptide and a glycosylhydrolase 17 (GH 17) structural domain. Based on published upland cotton genetic standard line TM-1 transcriptome data and fluorescent quantitative PCR (qRT-PCR) analysis, ghGLU18 gene is specifically expressed in cotton fibers, and the expression level gradually increases from the beginning of fiber elongation period to the peak value of the expression level of the secondary cell wall thickening period. The genome sequence and full-length ORF sequence of the gene are further obtained in upland cotton genetic standard line TM-1 by a PCR technology. The function and action mechanism of the gene in fiber development are researched by using biotechnology, and the result shows that the cotton fiber quality can be obviously improved by over-expressing the GhGLU18 gene, the fiber length of the transgenic material is prolonged, and the strength is obviously increased.

Background

Cotton is an important commercial crop, is an important material for producing natural fibers, and has an irreplaceable effect in the textile industry, with fiber yield of about 35% of the total world annual fiber demand. Cotton fiber is an unbranched single cell formed by the differentiation and development of ovules from outer skin cells, cotton fiber cells are also one of the longest single cells in plants. The development of cotton fibers can be divided into four separate and overlapping phases, namely initiation (initiation), rapid elongation (elongation), secondary cell wall synthesis (second cell wall biosynthesis), and dehydration maturation (formation) (Mansoor and Paterson, 2012).

Beta-1, 3-glucanases (endoglucanases, E.C.3.2.1.39) are a class of hydrolases that catalyze the cleavage of 1, 3-beta-D-glycosidic bonds within beta-1, 3-glucans, present in bacteria, fungi, viruses and seed plants (Bachman and McClay,1996; sun et al, 2000). In plants, beta-1, 3-glucanases constitute a highly complex and functionally diverse gene family, which is widely involved in the growth and development of plants and in the defense against external stimuli, including pollen germination, regulation of plasmodesmata permeability, cold stress, seed germination, cell wall development and protection against fungal invasion (Hincha et al, 1997; jin et al, 1999; leubner-Metzger and Meins,1999; leubner-Metzger and Meins,2000; levy et al, 2007a; levy et al, 2007b; wan et al, 2011;Worrall et al, 1992).

Functional analysis of beta-1, 3-glucanase in cotton fibers is mainly focused on degrading callose of plasmodesmata to affect the opening and closing of plasmodesmata. Early studies showed that the fiber was in the fast elongation period (10-15 DPA) and the intercellular filaments were in the closed state, when the fiber cell was responsible for sucrose and K ⁺ Up-regulating the expression level of transported gene, and transporting sucrose and K in large quantity ⁺ To the fibroblasts, the osmotic pressure inside the cells is increased. At this point the fibroblast turgor pressure reached maximum and the elongation rate was fastest (Ruan et al, 2001). Comparison of cotton varieties of different fiber lengths shows that there is a difference in the time for intercellular continuous filaments to close. And cellThe longer the filament closure time, the longer the fiber length, and the time for the filament closure may be indicative of the length of the rapid elongation period. In the process of converting from the elongation period to the second cell wall thickening period, callose in the plasmodesmata is degraded, and the beta-1, 3-glucanase gene plays an important role. The pro-human identified in cotton fibers that a β -1, 3-glucanase GhPDBGBGB 3, which is located in the plasmodesmata, down-regulated expression of the GhPDBGB 3 gene resulted in inhibition of the degradation of the plasmodesmata callose, the transition of sucrose transport from symplast transport to apoplast transport, reduced sugar content in the fiber and shortened fiber length (Zhang et al, 2017).

During fiber development, callose is deposited not only in the plasmodesmata but also in the fiber cell wall in large quantities, and studies show that the elongation phase of fiber cells begins and the cell wall begins to deposit callose until the initial thickening of the secondary cell wall reaches a peak, which can account for up to 10% of the mass fraction of the cell wall (jamet al, 1982;Maltby et al, 1979;Rowland et al, 1984). During secondary cell wall synthesis, callose starts to be gradually degraded until the fiber matures, reducing the callose content to <1%.

Regarding the location of callose deposition in the fibrous cell wall, some researchers thought that callose might be deposited in the S1 layer of the secondary cell wall (Maltby et al, 1979). Another view is that callose forms a single wall, located between the cell membrane and the cellulose microfibrils, which is the component of the secondary cell wall closest to the cell membrane (Waterkeyn, 1981).

At the same time as callose degradation, synthesis of large amounts of cellulose begins in the fibroblasts and deposits on the secondary cell walls. Early researchers speculated that callose accumulated in the cell wall was a precursor for cellulose synthesis, meier et al found C supplied from the supply using isotope labeled technology ¹⁴ The rate of callose synthesis in the substrate of labeled UDPG was higher than predicted accumulation levels, and the conversion of callose radiology was consistent with changes in cellulose (Maltby et al, 1979;Waterkeyn 1981). Beta-1, 3-glucanase may function during the conversion of callose to cellulose. But at present there is noThere is new evidence that callose is a precursor to cotton fiber secondary cell wall cellulose synthesis.

Disclosure of Invention

The invention aims to provide an application of a cotton beta-1, 3-glucanase gene (GhGLU 18) in improving cotton fiber quality or cultivating new cotton germplasm. Provides the full-length cDNA ORF nucleotide sequence and amino acid sequence of the gene in upland cotton genetic standard line TM-1. The gene is used as target gene, and the gene engineering method is used in creating transgenic material, defining its function and culturing new germplasm for production.

It is another object of the present invention to provide a method for improving the quality of cotton fibers.

The aim of the invention is achieved by the following technical scheme:

the cotton beta-1, 3-glucanase gene GhGLU18 shown in SEQ ID NO.1 is applied to improving cotton fiber quality or cultivating new cotton germplasm.

The recombinant vector containing cotton beta-1, 3-glucanase gene GhGLU18 shown in SEQ ID NO.1, expression cassette, transgenic cell line or recombinant bacteria are applied in improving cotton fiber quality or cultivating new cotton germplasm.

The improved cotton fiber quality is improved cotton fiber length and fiber strength.

The application is to take the cotton beta-1, 3-glucanase gene GhGLU18 as a target gene, over express the GhGLU18 gene by a genetic engineering method, improve the quality of cotton fibers or cultivate new germplasm with obviously improved length and strength of the cotton fibers and apply the cotton fibers in production.

A method for improving cotton fiber quality, in which cotton beta-1, 3-glucanase gene GhGLU18 shown in SEQ ID NO.1 is overexpressed.

The amino acid sequence of the protein encoded by the cotton beta-1, 3-glucanase gene GhGLU18 is shown as SEQ ID NO. 2.

The invention has the advantages that:

(1) The cloned gene is beta-1, 3-glucanase GhGLU18, and the research finds that the gene expression is related to the degradation of callose on the cell wall in the cotton fiber development process.

(2) The cloned beta-1, 3-glucanase GhGLU18 has not been studied for its function in cotton before.

(3) The qRT-PCR result shows that GhGLU18 gene is specifically expressed in upland cotton genetic standard line TM-1 cotton fiber. The GhGLU18 gene starts to express from the fiber elongation period to the peak of the secondary cell wall thickening period, which indicates that the GhGLU18 gene can simultaneously play a role in the fiber elongation and secondary cell wall development process.

(5) Constructing sense and antisense expression vectors by utilizing a fiber development specialized RDL promoter, and carrying out GhGLU18 gene overexpression and suppression expression transgenic material creation by taking a upland cotton material W0 (G.hirsutum acc.W0) as a receptor. Gene expression analysis found that: the expression level of the GhGLU18 gene was significantly increased in the over-expressed strain and significantly decreased in the inhibited expression strain at different stages of fiber development (10 DPA, 15DPA, 20DPA[Day Post Anthesis) compared to the wild type. Manual detection of mature fiber length shows that compared with the receptor, the fiber length of the over-expressed strain of GhGLU18 gene is increased, while the fiber length of the inhibited-expressed strain of GhGLU18 gene is shortened. The same result is obtained by detecting the mature fiber by the HVI9000 fiber quality detector, the fiber length of the over-expressed strain of GhGLU18 gene is prolonged, the strength is increased, the fiber length of the inhibited expressed strain of GhGLU18 gene is shortened, and the strength is reduced.

(6) The fiber length of the GhGLU18 transgenic line and the wild type control material W0 at 10DPA, 15DPA and 20DPA are measured, and the result shows that the fiber length of the transgenic material is not significantly different from W0 at 10DPA and 15DPA,20DPA shows significant change, the fiber of the GhGLU18 over-expressed line is significantly longer than W0, and the fiber of the expression-inhibiting line is significantly shortened.

(7) The observation and measurement of the cell wall thickness of the GhGLU18 transgenic line, the wild-type control materials W0 DPA and W25 DPA and the mature period show that the fiber cell wall of the GhGLU18 over-expression line is obviously thickened, and the inhibition expression line shows obviously thinned cell wall.

(8) As compared with the wild type, the GhGLU18 over-expressed transgenic material has obviously increased helix degree of cotton fiber, the screw pitch is obviously smaller than that of the wild type, and the helix degree of cotton fiber of the expression inhibition strain is obviously reduced, the screw pitch is obviously larger than that of the wild type, which indicates that the GhGLU18 has important influence on the cotton fiber strength.

(9) Analysis of 15DPA and 20DPA fiber transcriptome shows that the enrichment result of the differential expression gene for up-regulating expression in the over-expression strain and the differential expression gene for down-regulating expression in the inhibition expression strain is obviously enriched in polysaccharide metabolism and cell wall development pathways.

(10) The determination of the soluble sugar content in fibers at different developmental stages revealed that in 15DPA,20DPA and 25DPA fibers, the soluble sugar content was significantly increased in the GhGLU18 over-expressed strain and significantly decreased in the repressed-expression strain. In the ghlu 18 gene overexpression line, the expression of the sucrose metabolism-related gene was significantly up-regulated, and in the repression expression line, it was significantly down-regulated. This suggests that the GhGLU18 gene plays an important role in the glucose metabolic pathway of fibroblasts.

(11) Cellulose content was determined in different developmental stages of the ghlu 18 transgenic line and control W0 fiber. The results show that, starting from 15DPA, the cellulose content of the GhGLU18 gene overexpression line is significantly higher than W0, and the cellulose content of the inhibition expression line is significantly lower than W0. While key genes involved in fiber cell wall development up-regulate expression in ghlu 18 over-expression lines and significantly down-regulate expression in inhibition expression lines, including EXP1, EXPA4, EXP15, EXPA1, EXPA13, XTH1, XTH2, XTH8, ACTIN3, ACTIN7, these results indicate that ghlu 18 genes affect cotton fiber cell wall development.

Drawings

FIG. 1 analysis of expression pattern of GhGLU18 Gene in upland cotton TM-1

Wherein, the expression pattern of E beta-1, 3-glucanase genes in the A TM-1 transcriptome in different tissues and organs is analyzed, and the qRT-PCR verification of the expression pattern of GhGLU18 genes in different tissues and organs is performed.

FIG. 2 GO enrichment analysis of GhGLU18 coexpression gene in cotton fiber.

FIG. 3 protein structure analysis of GhGLU18 and its homologous proteins.

FIG. 4 subcellular localization of GhGLU18 protein

Wherein, A is subcellular localization of empty GFP vector and GhGLU18-GFP fusion vector. Green fluorescence and red fluorescence represent GFP and cell membrane Marker AtPIP2-RFP, respectively. And B, positioning and observing the GhGLU18 protein after separating the epidermal cell cytoplasm of the tobacco leaf. Scale = 50 μm.

FIG. 5 genotyping and expression level identification of GhGLU18 transgenic lines

Wherein, the target gene PCR identification of GhGLU18 transgenic pure line. And B, analyzing the expression level of a target gene of the GhGLU18 transgenic pure line. The expression levels of the ghlu 18 gene in the overexpressing strain, the repressing strain and the receptor W0 were examined in fibers of 10DPA, 15DPA and 20DPA, respectively. Error bars represent standard error between three biological replicates. Asterisks indicate that there was a significant difference (< P <0.05, < P < 0.01) between the transgenic lines detected by the t-test and W0. M, DNA marker DL2000 plus; p: positive control. OE-1-OE-4 represents each of the over-expressed strains; AS-1-AS-5 represents 5 inhibition expression lines; w0 is a transgenic receptor.

FIG. 6 fiber length analysis of GhGLU18 transgenic lines and receptor W0 at different developmental stages

Wherein A: phenotype observations of GhGLU18 transgenic lines and receptor W0 mature fibers. B: ghGLU18 transgenic line and receptor W0 mature fiber length assay. C: ghGLU18 transgenic line and receptor W010DPA, 15DPA and 20DPA fiber phenotypes. D: ghGLU18 transgenic line and receptor W010DPA, 15DPA and 20DPA fiber length assays.

FIG. 7 analysis of wall thickness of GhGLU18 transgenic lines and recipients W020 DPA and 25DPA fiber cells

Wherein A: ghGLU18 transgenic line and receptor W020 DPA fiber cell wall phenotype. B: ghGLU18 transgenic line and receptor W025 DPA fiber cell wall phenotype. C: ghGLU18 transgenic line and receptor W020 DPA fiber cell wall thickness assay. D: ghGLU18 transgenic line and receptor W025 DPA fiber cell wall thickness assay.

FIG. 8 analysis of wall thickness of GhGLU18 transgenic line and receptor W0 mature fiber cells.

FIG. 9 GhGLU18 transgenic line and receptor W0 mature fiber pitch analysis.

FIG. 10 GhGLU18 transgenic line and recipient W010DPA, 15DPA and 20DPA transcriptome sequencing analysis

Wherein A: differential expression Gene analysis of GhGLU18 transgenic line (OE-1, AS-2) and W0 in 10DPA, 15DPA and 20DPA fibers. B: GO enrichment of 870 downregulated differentially expressed genes in AS-2 lines. GO enrichment of 1478 up-regulated differentially expressed genes in OE-1 strain.

FIG. 11 GO enrichment analysis of the GhGLU18 transgenic line (OE-1, AS-2) with W0 differentially expressed genes in 20DPA fibers

Wherein A: GO enrichment of 870 downregulated differentially expressed genes in AS-2 lines. GO enrichment of 1478 up-regulated differentially expressed genes in OE-1 strain.

FIG. 12 determination of sugar content in GhGLU18 transgenic lines and control W0 fibers

Wherein the content of total soluble sugar (A), sucrose (B), fructose (C) and glucose (D) in the GhGLU18 transgenic line and the control W0 fiber is measured.

FIG. 13 detection of the expression level of sucrose metabolism key gene in GhGLU18 transgenic line and W020 DPA fiber.

FIG. 14 GhGLU18 gene affects cellulose synthesis

Wherein A: ghGLU18 transgenic line and control W0 cellulose content determination. B: analysis of expression of primary cell wall cellulose synthesis related genes in 15DPA fiber in GhGLU18 transgenic line and W0. C: analysis of expression of the secondary cell wall cellulose synthesis related genes in 20DPA fibers in GhGLU18 transgenic lines and W0. Error bars represent standard error between three biological replicates, asterisks indicate significant differences in t-test transgenic lines compared to control (< 0.05, < 0.01).

FIG. 15 analysis of the expression of a cell wall development related gene in GhGLU18 transgenic lines and control W0 15DPA fibers.

FIG. 16 GhFSN1 can directly bind to the promoter of GhGLU18 gene and promote its expression.

Wherein A: SNBE motif analysis on GhGLU18 Gene promoter. B: analysis of expression patterns of GhFSN1 and GhGLU18 in different organs of TM-1. C-D: the promoter sequence of GhGLU18 1500bp was fused with the LUC reporter gene and injected with the effector as shown in the figure into tobacco leaves, and three days later the LUC fluorescent signal was observed. E: determination of LUC enzyme activity. The LUC assay is calibrated by the ratio to REN. Error bars represent standard error between three biological replicates, asterisks indicate that there was a significant difference in t-test promoter co-injection of GhFSN1 with GhGLU18 gene compared to control (< 0.05, < 0.01).

Detailed Description

The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the embodiments described herein are only for illustrating the present invention and are not intended to limit the present invention, and any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention should be included in the scope of the present invention.

EXAMPLE 1 identification of specific expression of GhGLU18 Gene by cotton fiber

130 beta-1, 3-glucanase genes are identified in TM-1, and a GhGLU18 gene specifically expressed in cotton fibers is identified in E beta-1, 3-glucanase genes through transcriptome data analysis of different tissues and organs. Among E-class beta-1, 3-glucanase genes, only GhGLU18 is expressed in cotton fibers in high abundance, and other genes are not expressed in the fibers or expressed in extremely low abundance. GhGLU18 is a more specific beta-1, 3-glucanase gene, and completely different from the homologous gene GhGLU40 (homology 70%) in expression pattern, ghGLU40 was expressed only in ovules of 3DPA and fibers of 5DPA, which also suggests that differentiation of both genes is functionally possible (FIG. 1A). The pattern of ghgl 18 gene expression was verified by qRT-PCR, consistent with transcriptome data, and ghgl 18 gene expression started from fiber elongation phase to peak secondary cell wall thickening phase, which also suggests that ghgl 18 gene may function simultaneously during fiber elongation and secondary cell wall development (fig. 1B). In order to investigate the function of the ghlu 18 gene, gene co-expression analysis was further performed using fibrogenesis transcriptome information. 42 co-expressed genes were identified in cotton fibers altogether, and GO enrichment analysis found that a significant enrichment to the cell wall development-related pathway, suggesting that the GhGLU18 gene may be associated with the cell wall development process in fiber development (fig. 2). Further we amplified the full-length ORF of this gene (GhGLU 18) from upland cotton TM-1 for subsequent functional verification. qRT-PCR and amplification primers are listed in Table 1.

TABLE 1 GhGLU18 Gene cloning and qRT-PCR primers

EXAMPLE 2 subcellular localization analysis of GhGLU18 protein

Systematic analysis of the GhGLU18 protein and its homologous protein structure in arabidopsis (Arabidopsis thaliana), poplar (popudrich ocarpa), grape (Vitisvinifera) and cocoa (theoroboma cacao) revealed that these proteins all contained the C-terminal signal peptide sequence as well as the GH17 domain and none had a GPI site (fig. 3). Subcellular localization of the GhGLU18 protein in tobacco leaves GhGLU18 protein was found to co-localize with cell membrane markers (FIG. 4A). Further, it was confirmed by the experiments of plasma wall separation of tobacco leaf epidermal cells that the GhGLU18 protein was localized to the cell wall (FIG. 4B).

Example 3 transgenic functional verification of beta-1, 3-glucanase Gene GhGLU18

The RDL1 gene is specifically expressed in cotton fibers and its expression levels peak during rapid elongation of the fiber (Xu et al, 2013). To study the function of GhGLU18 gene in fiber development, the full-length segment of the SEQ NO.1 sequence of the gene is used for constructing a positive and negative sense plant expression vector, respectively creating a fiber specific expression promoter RDL driven over-expression and an expression inhibition transgenic material, and identifying the genotype and target gene expression level of the transgenic material by utilizing a PCR (detection primer see Table 2) and qRT-PCR method through continuous selfing every generation to obtain four over-expression and five expression inhibition transgenic pure lines (figure 5)

TABLE 2 genomic detection primers for GhGLU18 transgenic lines

Primer name	Primer sequence (5 '-3')	Use of the same
			RDLF	AGTGTTATTCAGCAGTACTTGTTC	GhGLU18 over-expression strain detection
W6403	CGTAACCTTCGTCGTGCCTAA	GhGLU18 over-expression strain detection
			RDLF	AGTGTTATTCAGCAGTACTTGTTC	GhGLU18 inhibition expression line detection
W6407	CCGGTAACGAGCCTTACACGA	GhGLU18 inhibition expression line detection

The GhGLU18 transgenic line and control W0 mature fiber length were measured. The results show that the mature fiber length of the ghlu 18 over-expressed strain is significantly longer than W0, while the fiber length of the inhibition-expressed strain is shorter (fig. 6A-B). The quality detection of the mature fiber also shows a consistent phenotype, and the mature fiber of the GhGLU18 over-expression strain is obviously prolonged and the strength is obviously increased; inhibition of expressed strain fiber shortening and lower strength without significant changes in micronaire, elongation and uniformity index, all demonstrated that the GhGLU18 gene affected cotton fiber length and strength (table 3). Further length measurements were performed on fibers at different developmental stages using the running water method, with no significant difference between fiber length and W0 for the transgenic material at 10DPA and 15DPA, with a significant change for 20DPA, significantly longer than W0 for the ghlu 18 overexpressing strain, and the opposite phenotype for the repressing strain (fig. 6C-D). Taken together, the GhGLU18 gene affects the elongation process of the fiber.

Table 3 shows quality detection of GhGLU18 transgenic line and control W0 mature fiber

Example 4 GhGLU18 Gene affects thickening and spiraling of cotton fibers

The observation and measurement of the cotton fiber cell wall thicknesses of 20DPA, 25DPA revealed that the cell wall thickness of the ghlu 18 gene overexpression line was significantly thickened compared to the control W0, while the cell wall thickness of the inhibition expression line was significantly thinned (fig. 7). Consistent results were also obtained by observation of cotton fiber sections at maturity, with the ghlu 18 overexpressing strain showing a significantly thickened mature fiber cell wall, while the suppressed expressing strain showed a significantly thinned cell wall (fig. 8). The screw pitch of the GhGLU18 over-expression strain is obviously shortened and the screw degree is higher as the screw degree is observed by a scanning electron microscope on the mature fiber; while the pitch of the expression-suppressing strain was increased and the degree of helicity was decreased, indicating that the ghlu 18 gene affected fiber helicity (fig. 9). The cell wall thickness and degree of helicity are very important properties for fiber strength, with thicker cell wall thickness and higher fiber strength with higher degree of helicity. In the quality detection of the transgenic mature fibers, the fiber strength of the GhGLU18 gene over-expressed strain is higher, and the fiber strength of the expressed strain is inhibited from decreasing. The GhGLU18 gene can influence the strength of fiber by affecting the cell wall deposition of fiber cells and the degree of helicization.

Example 5 GhGLU18 Gene involved in polysaccharide metabolism and cell wall development

To further investigate the mechanism of action of the GhGLU18 gene in cotton fiber development, two transgenic lines OE-1 and AS-2 and the transgenic receptor W0 were selected and fibers of 10DPA, 15DPA and 20DPA were transcriptomed. Analysis of differentially expressed genes was performed with twice the difference, P <0.05 as the threshold. In 10DPA fibers, OE-1 has 127 up-regulated differentially expressed genes and 112 down-regulated differentially expressed 6 genes in total; whereas AS-2 had 61 down-regulated differentially expressed genes compared to W0. In 15DPA fiber, OE-1 has a total of 1478 up-regulated differentially expressed genes and 637 down-regulated differentially expressed genes compared to W0; whereas AS-2 had 433 up-regulated differentially expressed genes and 870 down-regulated differentially expressed genes compared to W0. Transcriptome data analysis of 20DPA fibers revealed 2846 up-regulated and 103 down-regulated differentially expressed genes for over-expressed strain OE-1 compared to W0, 6043 down-regulated and 82 up-regulated differentially expressed genes for inhibition-expressed strain AS-2 compared to W0 (fig. 10A). Phenotypic analysis of GhGLU18 transgenic cotton fiber shows that the GhGLU18 gene plays a positive role in the fiber development process, so that the difference gene of up-regulated expression in an OE-1 strain and the difference gene of down-regulated expression in an AS-2 strain are focused. In 10DPA fibers, the difference genes for up-regulated expression in OE-1 strain and down-regulated expression in AS-2 strain were 127 and 61, respectively, and no entries related to cell wall development were found by GO enrichment analysis. Analysis of the differentially expressed genes in 15DPA and 20DPA fibers revealed that both the up-regulated expressed differential gene in OE-1 strain and the down-regulated expressed differential gene in AS-2 material were significantly enriched in pathways associated with cell wall development and polysaccharide metabolism (FIG. 10B; FIG. 11). Taken together, the ghlu 18 gene may play a role in the late fiber elongation (15 DPA) and the secondary cell wall thickening (20 DPA), ultimately affecting fiber length and strength by participating in carbohydrate metabolism and cell wall development.

Example 6 GhGLU18 Gene involved in polysaccharide metabolism and cell wall development

In order to further determine whether the GhGLU18 gene changes the carbohydrate metabolism process of the fiber cells, the soluble sugar content in cotton fibers of different development periods of the GhGLU18 transgenic line and a control W0 is determined. Total soluble sugar content was determined to show that in 15DPA,20DPA and 25DPA fibers, the soluble sugar content was significantly increased in the GhGLU18 over-expressed strain and significantly decreased in the repressed expression strain. Three main soluble sugars in the fiber were further: the contents of sucrose, fructose and glucose are respectively measured, and the results show that in 15DPA and 20DPA fibers, the contents of three sugars in the GhGLU18 gene overexpression strain are obviously higher than W0, and the contents of three sugars in the expression inhibition strain are obviously lower than W0; in 25DPA, the differences were mainly concentrated in sucrose, sucrose content in the GhGLU18 gene overexpression line was significantly higher than W0, and in the repression line was significantly lower than W0, with no significant change in fructose and glucose content. In the 10DPA fiber, there was no significant difference in the transgenic lines compared to control W0, either in total soluble sugar content or in glucose, fructose and sucrose content (fig. 12). From the above results, it was found that the GhGLU18 gene affects saccharide accumulation in fibroblasts.

Meanwhile, based on 20DPA transgenic lines and W0 fiber transcriptome data analysis, it was found that the expression levels of key genes during some sucrose metabolic pathways vary significantly in the transgenic lines, including sucrose synthase (SuS), glucose phosphate isomerase (PGI), UDPG pyrophosphorylase (UDP-glucose pyrophosphorylase, UDPGP), sucrose phosphate synthase (sucrose phosphate synthase, SPS), sucrose phosphate phosphorylase (sucrose phosphate phosphatase, SPP), fructokinase (FrK), hexokinase (HK), and glucose phosphate mutase (PGM). The expression of these genes was verified by qRT-PCR, with significantly up-regulated expression of these sucrose metabolism related genes in the ghlu 18 gene overexpression line and significantly down-regulated in the repression expression line (fig. 13). In conclusion, the ghlu 18 gene plays an important role in the glucose metabolism pathway of fibroblasts.

Example 7 GhGLU18 Gene affects cotton fiber cell wall development

Cellulose content in fibers of GhGLU18 transgenic line and control W0 at each development stage was measured. The results show that, starting from 15DPA, the cellulose content of the GhGLU18 gene overexpression line is significantly higher than W0, and the cellulose content of the inhibition expression line is significantly lower than W0. This suggests that the ghlu 18 gene influences the synthesis process of cellulose (fig. 14A). Meanwhile, the expression quantity of the cellulose synthase gene is detected, and in the 15DPA fiber, the expression of CesA1, cesA3 and CesA6 genes responsible for primary cell wall cellulose synthesis is obviously increased in a GhGLU18 over-expression strain and is obviously reduced in an expression inhibition strain; in the 20DPA fibers, the expression of the CesA4, cesA7, cesA8 and COBL genes involved in secondary cell wall cellulose synthesis was significantly increased in the ghlu 18 overexpressing strain and significantly decreased in the repressing strain, indicating that the ghlu 18 gene affects both primary and secondary cell wall cellulose synthesis processes (fig. 14B-C). A series of key genes involved in fiber wall development were also found in transcriptome data analysis of 15DPA to up-regulate expression in GhGLU18 over-expressed lines, while significantly down-regulated in inhibited expression lines, including EXP1, EXPA4, EXP15, EXLA1, EXPA13, XTH1, XTH2, XTH8, ACTIN3, ACTIN7, which play an important role in fiber elongation, while GhGLU18 genes might be involved in the developmental regulation of fiber development of cell walls by affecting expression of these genes (FIG. 15).

Example 8 direct control of GhGLU18 Gene expression by transcription factor GhFSN1

To further investigate the molecular mechanism of action of the GhGLU18 gene, the upstream regulatory protein was identified, a 1500bp promoter sequence upstream of the GhGLU18 gene was cloned in TM-1 and analyzed for promoter binding elements, and the promoter was found to contain multiple SNBE motifs (16A) that bind to secondary cell wall developing NAC transcription factors. Meanwhile, a cotton fiber secondary cell wall development regulated NAC protein GhFSN1 is found in the co-expression gene of the GhGLU18 gene, and the two genes have highly similar expression patterns in fibers and are predominantly expressed in a secondary cell wall thickening period (figure 16B). GhFSN1 is an important regulating factor for cotton fiber secondary cell wall development, the length of the fiber of the GhFSN1 gene over-expression strain is shortened, the wall thickness of the secondary cell wall is increased, and the cellulose content is increased.

In order to verify whether GhFSN1 directly regulates the expression of GhGLU18 gene, a dual-luciferase report system is designed for interaction verification. When the effector (35S-GhFSN 1) and the reporter (REN-GhGLU 18 pro-LUC) were co-injected, ghFSN1 could activate the expression of the reporter gene and resulted in higher LUC activity than the control (FIGS. 16C-E). Experimental results show that GhFSN1 can positively regulate the expression of GhGLU18 gene, and further prove that the GhGLU18 gene plays a role in the development of fiber secondary cell walls.

Upland cotton (Gossypium hirsutum)

Beta-1, 3-glucanase gene GhGLU18 ORF sequence

ATGGGTCCAACATTTTCTGGGTTTTTAATCTCAGCAATGGTGTTTTTAACTCAACTCCTCTCTCTAACAGATGGCCGTGATATTGGTGTTTGCTATGGTTTGAACGGCAACAATCTTCCATCTCCAGGAGATGTTATTAATCTTTACAAAACTAGTGGCATAAACAATATCAGGCTCTACCAGCCTTACCCTGAAGTGCTCGAAGCAGCAAGGGGATCGGGAATATCCCTCTCGATGGGTCCGAGAAACGAGGACATACAAAGCCTCGCAAAAGATCAAAGTGCAGCCGATGCATGGGTTAACACCAACATCGTCCCTTATAAGGACGATGTTCAGTTCAAGTTGATCACTATTGGGAATGAAGCCATTTCAGGACAATCAAGCTCTTACATTCCTGATGCCATGAACAACATAATGAACTCGCTCGCCTTATTTGGGTTAGGCACGACGAAGGTTACGACCGTGGTCCCGATGAATGCCCTAAGTACCTCGTACCCTCCTTCAGACGGCGCTTTTGGAAGCGATATAACATCGATCATGACTAGTATCATGGCCATTCTGGCTGTACAGGATTCGCCCCTCCTGATCAATGTGTACCCTTATTTTGCCTATGCCTCAGACCCCACTCATATTTCCCTCGATTACGCCTTGTTCACCTCGACCGCACCGGTGGTGGTCGACCAAGGCTTGGAATACTACAACCTCTTTGACGGCATGGTCGATGCTTTCAATGCCGCCCTAGATAAGATCGGCTTCGGCCAAATTACTCTCATTGTAGCCGAAACTGGATGGCCGACCGCCGGTAACGAGCCTTACACGAGTGTCGCGAACGCTCAAACTTATAACAAGAACTTGTTAAATCATGTGACGCAGAAGGGGACTCCGAAAAGACCTGAATATATAATGCCGACGTTTTTCTTCGAGATGTTCAACGAGGATTTGAAGCAACCCACAGTTGAGCAGAATTTCGGATTCTTCTTCCCCAATATGAACCCTGTTTATCCATTTTGGTGA

Upland cotton

Beta-1, 3-glucanase GhGLU18 amino acid sequence

MGPTFSGFLISAMVFLTQLLSLTDGRDIGVCYGLNGNNLPSPGDVINLYKTSGINNIRLYQPYPEVLEAARGSGISLSMGPRNEDIQSLAKDQSAADAWVNTNIVPYKDDVQFKLITIGNEAISGQSSSYIPDAMNNIMNSLALFGLGTTKVTTVVPMNALSTSYPPSDGAFGSDITSIMTSIMAILAVQDSPLLINVYPYFAYASDPTHISLDYALFTSTAPVVVDQGLEYYNLFDGMVDAFNAALDKIGFGQITLIVAETGWPTAGNEPYTSVANAQTYNKNLLNHVTQKGTPKRPEYIMPTFFFEMFNEDLKQPTVEQNFGFFFPNMNPVYPFW。

Sequence listing

<110> Nanjing agricultural university

<120> application of cotton beta-1, 3-glucanase gene GhGLU18 in improving cotton fiber quality

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1014

<212> DNA

<213> upland cotton (Gossypium hirsutum)

<400> 1

atgggtccaa cattttctgg gtttttaatc tcagcaatgg tgtttttaac tcaactcctc 60

tctctaacag atggccgtga tattggtgtt tgctatggtt tgaacggcaa caatcttcca 120

tctccaggag atgttattaa tctttacaaa actagtggca taaacaatat caggctctac 180

cagccttacc ctgaagtgct cgaagcagca aggggatcgg gaatatccct ctcgatgggt 240

ccgagaaacg aggacataca aagcctcgca aaagatcaaa gtgcagccga tgcatgggtt 300

aacaccaaca tcgtccctta taaggacgat gttcagttca agttgatcac tattgggaat 360

gaagccattt caggacaatc aagctcttac attcctgatg ccatgaacaa cataatgaac 420

tcgctcgcct tatttgggtt aggcacgacg aaggttacga ccgtggtccc gatgaatgcc 480

ctaagtacct cgtaccctcc ttcagacggc gcttttggaa gcgatataac atcgatcatg 540

actagtatca tggccattct ggctgtacag gattcgcccc tcctgatcaa tgtgtaccct 600

tattttgcct atgcctcaga ccccactcat atttccctcg attacgcctt gttcacctcg 660

accgcaccgg tggtggtcga ccaaggcttg gaatactaca acctctttga cggcatggtc 720

gatgctttca atgccgccct agataagatc ggcttcggcc aaattactct cattgtagcc 780

gaaactggat ggccgaccgc cggtaacgag ccttacacga gtgtcgcgaa cgctcaaact 840

tataacaaga acttgttaaa tcatgtgacg cagaagggga ctccgaaaag acctgaatat 900

ataatgccga cgtttttctt cgagatgttc aacgaggatt tgaagcaacc cacagttgag 960

cagaatttcg gattcttctt ccccaatatg aaccctgttt atccattttg gtga 1014

<210> 2

<211> 337

<212> PRT

<213> upland cotton (Gossypium hirsutum)

<400> 2

Met Gly Pro Thr Phe Ser Gly Phe Leu Ile Ser Ala Met Val Phe Leu

1 5 10 15

Thr Gln Leu Leu Ser Leu Thr Asp Gly Arg Asp Ile Gly Val Cys Tyr

20 25 30

Gly Leu Asn Gly Asn Asn Leu Pro Ser Pro Gly Asp Val Ile Asn Leu

35 40 45

Tyr Lys Thr Ser Gly Ile Asn Asn Ile Arg Leu Tyr Gln Pro Tyr Pro

50 55 60

Glu Val Leu Glu Ala Ala Arg Gly Ser Gly Ile Ser Leu Ser Met Gly

65 70 75 80

Pro Arg Asn Glu Asp Ile Gln Ser Leu Ala Lys Asp Gln Ser Ala Ala

85 90 95

Asp Ala Trp Val Asn Thr Asn Ile Val Pro Tyr Lys Asp Asp Val Gln

100 105 110

Phe Lys Leu Ile Thr Ile Gly Asn Glu Ala Ile Ser Gly Gln Ser Ser

115 120 125

Ser Tyr Ile Pro Asp Ala Met Asn Asn Ile Met Asn Ser Leu Ala Leu

130 135 140

Phe Gly Leu Gly Thr Thr Lys Val Thr Thr Val Val Pro Met Asn Ala

145 150 155 160

Leu Ser Thr Ser Tyr Pro Pro Ser Asp Gly Ala Phe Gly Ser Asp Ile

165 170 175

Thr Ser Ile Met Thr Ser Ile Met Ala Ile Leu Ala Val Gln Asp Ser

180 185 190

Pro Leu Leu Ile Asn Val Tyr Pro Tyr Phe Ala Tyr Ala Ser Asp Pro

195 200 205

Thr His Ile Ser Leu Asp Tyr Ala Leu Phe Thr Ser Thr Ala Pro Val

210 215 220

Val Val Asp Gln Gly Leu Glu Tyr Tyr Asn Leu Phe Asp Gly Met Val

225 230 235 240

Asp Ala Phe Asn Ala Ala Leu Asp Lys Ile Gly Phe Gly Gln Ile Thr

245 250 255

Leu Ile Val Ala Glu Thr Gly Trp Pro Thr Ala Gly Asn Glu Pro Tyr

260 265 270

Thr Ser Val Ala Asn Ala Gln Thr Tyr Asn Lys Asn Leu Leu Asn His

275 280 285

Val Thr Gln Lys Gly Thr Pro Lys Arg Pro Glu Tyr Ile Met Pro Thr

290 295 300

Phe Phe Phe Glu Met Phe Asn Glu Asp Leu Lys Gln Pro Thr Val Glu

305 310 315 320

Gln Asn Phe Gly Phe Phe Phe Pro Asn Met Asn Pro Val Tyr Pro Phe

325 330 335

Trp

Claims (4)

1. Cotton beta-1, 3-glucanase gene shown as SEQ ID NO.1GhGLU18The application of the method in improving the quality of cotton fibers or cultivating new germplasm with significantly improved quality of cotton fibers.

2. Comprises cotton beta-1, 3-glucanase gene shown as SEQ ID NO.1GhGLU18The recombinant vector, the expression cassette, the transgenic cell line or the recombinant bacterium are applied to improving the quality of cotton fibers or cultivating new germplasm with obviously improved quality of cotton fibers.

3. The use according to claim 1 or 2, characterized in that the cotton β -1, 3-glucanase gene is usedGhGLU18As a target gene, the gene is overexpressed in cotton by a genetic engineering methodGhGLU18Improving cotton fiber quality or cultivating new germplasm with significantly improved cotton fiber quality and applying in production.

4. A method for improving the quality of cotton fibers, comprising the steps of: overexpression of cotton beta-1, 3-glucanase gene shown as SEQ ID NO.1 in cottonGhGLU18。

Images