CN114887080A

CN114887080A - mRNA (messenger ribonucleic acid) type immunosuppressant and application thereof in preparation of tumor treatment drug

Info

Publication number: CN114887080A
Application number: CN202011444043.0A
Authority: CN
Inventors: 胡勇; 张苗苗; 洪丹; 胡迅
Original assignee: Shenzhen Ruiji Biotechnology Co ltd
Current assignee: Shenzhen Ruiji Biotechnology Co ltd
Priority date: 2020-12-08
Filing date: 2020-12-08
Publication date: 2022-08-12
Anticipated expiration: 2040-12-08
Also published as: CN114887080B

Abstract

The invention provides an mRNA (messenger ribonucleic acid) dosage form immunosuppressant and application thereof in preparing a medicament for treating tumors, belonging to the technical field of tumor treatment, wherein the mRNA dosage form immunosuppressant comprises one or more of mRNA for coding a CTLA-4 inhibitor, mRNA for coding a PD-1 inhibitor and mRNA for coding a PD-L1 inhibitor; after the immunosuppressive agent of the mRNA dosage form transfects cells, the immunosuppressive agent can express the corresponding inhibitors of CTLA-4, PD-1 and PD-L1 proteins and play the role of corresponding protein inhibitors; compared with a protein-type immunosuppressant, the mRNA-type immunosuppressant has the advantages of low immunogenicity, long in-vivo half-life and low cost.

Description

mRNA (messenger ribonucleic acid) type immunosuppressant and application thereof in preparation of tumor treatment drug

Technical Field

The invention belongs to the technical field of tumor treatment, and particularly relates to an mRNA (messenger ribonucleic acid) type immunosuppressant and application thereof in preparation of a tumor treatment drug.

Background

Immune checkpoints refer to some inhibitory signaling pathways present in the immune system, avoiding tissue damage by modulating the persistence and intensity of immune responses in peripheral tissues, and are involved in maintaining tolerance to self-antigens.

Inhibition of T cell activity using the inhibitory signaling pathway of immune checkpoints is an important mechanism for tumors to evade immune killing. In recent years, antibody drugs developed with targeted co-inhibitory molecules such as CTLA-4, PD-1 and PD-L1 have enjoyed great success in clinical applications, making tumor immunotherapy the most compelling research area. Therefore, the targeted immune check point has wide application prospect in anti-tumor immunotherapy.

The CTLA-4 inhibitor is used in the immune evasion mechanism of tumor, and one link is that dendritic immune cells (DC cells) cannot transmit tumor information to naive T lymphocytes in lymph nodes, so that the naive T lymphocytes cannot be activated into mature T lymphocytes. The main reason for this is the presence of a protein called CTLA-4, which is located on the surface of naive T lymphocytes and once it functions, prevents DC cells carrying tumor information from stimulating the activation of naive T lymphocytes, in other words, the number of mature T lymphocytes capable of killing tumors generated in human body is greatly reduced in the presence of protein CTLA-4, so that people do not have enough immune cells to attack tumor cells. Once the CTLA-4 inhibitor is combined with CTLA-4, a large amount of immature T lymphocytes are converted into mature T lymphocytes capable of killing tumors, so that the capacity of killing the tumor cells is greatly enhanced.

"PD-1/PD-L1" inhibitors, which are currently the most promising immunotherapeutic drugs for treating malignancies, are classified, if subdivided, as "PD-1" inhibitors (i.e., "O" drugs, "K" drugs, as we commonly speak) and "PD-L1" inhibitors. Although they are two drugs, the mechanism of antitumor activity is basically the same. One of the most critical links for tumor cells to escape immune attack is that the tumor cells are made up so that activated T lymphocytes cannot be identified. It is better than "enemies" hiding in the vast sea of people, so that the "special soldiers" can not find the object of attack. The two proteins of PD-1 and PD-L1 play critical roles; PD-1 and PD-L1 are located on the surface of activated T lymphocytes and tumor cells, respectively, and once bound, the "special soldier" mature T lymphocytes will treat the tumor cells as "friends" without attacking them. After entering the body, the 'PD-1' inhibitor or the 'PD-L1' inhibitor can be combined with PD-1 or PD-L1, so that the combination of PD-1 and PD-L1 is prevented, and the tumor cells show the original shape and cannot escape the pursuit of mature T lymphocytes of special soldiers.

It is obvious from the above description that the drugs such as "immune checkpoint inhibitor" are essentially different from the traditional anti-tumor drugs, and they do not directly kill tumor cells as targets, but rather adjust the immune function of human body, change the microenvironment of tumor cells by changing the inherent relationship between immune cells and tumor cells, stimulate the huge potential of immune cells to attack tumors, and kill tumors by means of autoimmune cells, thereby achieving the final goal of treating tumors.

Cancer immunotherapy, particularly immune checkpoint inhibitor therapy, has become an important component in the treatment of certain types of cancer and allows some patients to continue to relieve symptoms. Immune checkpoint inhibitors are drugs that "brake" the immune system and also help the immune system to recognize and attack cancer cells. Immune checkpoint inhibitors have been shown to be able to treat patients with a variety of cancers, such as those with breast, bladder, cervical, colon, head and neck, liver, lung, skin, stomach and rectal cancers.

At present, the dosage form of the immune checkpoint inhibitor is protein, and the protein can be rapidly combined with other proteins (on immune cells or tumor cells) existing in our bodies once entering the bodies, so that the immune cells have the capacity of killing the tumor cells or recognizing the tumor cells. But also has the disadvantages of high immunogenicity, short in vivo half-life, high cost and the like.

Disclosure of Invention

In view of the above, the present invention aims to provide an mRNA dosage form immunosuppressant and an application thereof in preparing a drug for treating tumor, wherein the mRNA dosage form immunosuppressant has significant advantages in drug efficacy, biological safety, synthesis process, cost, and the like.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides an immunosuppressive agent in the form of mRNA, which comprises mRNA encoding CTLA-4 inhibitor.

Preferably, the mRNA encoding the CTLA-4 inhibitor comprises the sequences shown in SEQ ID No.1 and SEQ ID No. 2.

The invention provides an immunosuppressant in mRNA dosage form, which comprises mRNA encoding a PD-1 inhibitor.

Preferably, the mRNA for encoding the PD-1 inhibitor comprises a sequence shown in SEQ ID No. 3-4 or a sequence shown in SEQ ID No. 5-6.

The invention provides an immunosuppressive agent in an mRNA dosage form, which comprises mRNA encoding a PD-L1 inhibitor.

Preferably, the mRNA for coding the PD-L1 inhibitor comprises a sequence shown in SEQ ID No. 7-8, a sequence shown in SEQ ID No. 9-10 or a sequence shown in SEQ ID No. 11-12.

The invention provides an mRNA (messenger ribonucleic acid) dosage form immunosuppressant, which comprises two or three of mRNA for coding a CTLA-4 inhibitor, mRNA for coding a PD-1 inhibitor and mRNA for coding a PD-L1 inhibitor.

Preferably, mRNA encoding CTLA-4 inhibitors and mRNA encoding PD-1 inhibitors are included.

Preferably, mRNA encoding CTLA-4 inhibitors and mRNA encoding PD-L1 inhibitors are included.

Preferably, mRNA encoding CTLA-4 inhibitor, mRNA encoding PD-1 inhibitor and mRNA encoding PD-L1 inhibitor are included.

Preferably, the uracil is replaced with pseudouracil.

The invention provides application of the immunosuppressant or the compound immunosuppressant in preparing a medicament for treating tumors.

Preferably, the tumor comprises human non-small cell lung cancer.

Preferably, the concentration of the immunosuppressant in the medicament is 5-15 mg/mL.

After the RNA-dosage immunosuppressant provided by the invention transfects cells, the RNA-dosage immunosuppressant can express corresponding CTLA-4, PD-1 and PD-L1 protein inhibitors and play a role of corresponding protein inhibitors; compared with a protein type immunosuppressant, the RNA-based immunosuppressant has the advantages of low immunogenicity, long in-vivo half-life, low cost and high drug stability.

Drawings

FIG. 1 shows the comparison of half-life of mRNA type immunosuppressant and protein type immunosuppressant in vivo;

FIG. 2 is a comparison of the expression efficiency, immunogenicity and half-life of chemically modified mRNA (uracil replaced with pseudouracil) and unmodified mRNA, wherein A is the effect of chemically modified mRNA and unmodified mRNA on the concentrations of the immune factors IFN gamma and TNF alpha; b is the concentration of the expression product of the chemically modified mRNA and the mRNA without chemical modification; c is the relative stability of the chemically modified mRNA and the mRNA without chemical modification in the body of the mouse;

FIG. 3 shows the results of protein expression 24h after transfection of 293T cells with mRNA encoding CTAL4, PD1, PDL-1 protein inhibitor;

FIG. 4 shows the change in tumor volume size of 40 days after injection of mRNA immunosuppressive agent in example 1;

FIG. 5 shows the body weight change of mice injected with the mRNA immunosuppressant for 40 days in example 1;

FIG. 6 is a graph of the proportion of CD8+ in mouse tumor-infiltrating T cells following injection of an RNA formulation of the present invention as an immunosuppressant;

fig. 7 is a graph of the change in survival of mice after administration.

Detailed Description

In the present invention, the mRNA encoding the CTLA-4 inhibitor preferably comprises the sequences shown in SEQ ID No.1 and SEQ ID No. 2; the mRNA for coding the CTLA-4 inhibitor comprises mRNA for coding a heavy chain of the CTLA-4 inhibitor shown in SEQ ID No.1 and mRNA for coding a light chain of the CTLA-4 inhibitor shown in SEQ ID No. 2. In the invention, the specific sequence of SEQ ID No.1 is as follows:

caggugcagcugguggaaagcggcggcggcguggugcagccgggccgcagccugcgccugagcugcgcggcgagcggcuuuaccuuuagcagcuauaccaugcauugggugcgccaggcgccgggcaaaggccuggaaugggugaccuuuauuagcuaugauggcaacaacaaauauuaugcggauagcgugaaaggccgcuuuaccauuagccgcgauaacagcaaaaacacccuguaucugcagaugaacagccugcgcgcggaagauaccgcgauuuauuauugcgcgcgcaccggcuggcugggcccguuugauuauuggggccagggcacccuggugaccgugagcagcgcgagcaccaaaggcccgagcguguuuccgcuggcgccgagcagcaaaagcaccagcggcggcaccgcggcgcugggcugccuggugaaagauuauuuuccggaaccggugaccgugagcuggaacagcggcgcgcugaccagcggcgugcauaccuuuccggcggugcugcagagcagcggccuguauagccugagcagcguggugaccgugccgagcagcagccugggcacccagaccuauauuugcaacgugaaccauaaaccgagcaacaccaaaguggauaaacgcguggaaccgaaaagcugcgauaaaacccauaccugcccgccgugcccggcgccggaacugcugggcggcccgagcguguuucuguuuccgccgaaaccgaaagauacccugaugauuagccgcaccccggaagugaccugcguggugguggaugugagccaugaagauccggaagugaaauuuaacugguauguggauggcguggaagugcauaacgcgaaaaccaaaccgcgcgaagaacaguauaacagcaccuaucgcguggugagcgugcugaccgugcugcaucaggauuggcugaacggcaaagaauauaaaugcaaagugagcaacaaagcgcugccggcgccgauugaaaaaaccauuagcaaagcgaaaggccagccgcgcgaaccgcagguguauacccugccgccgagccgcgaugaacugaccaaaaaccaggugagccugaccugccuggugaaaggcuuuuauccgagcgauauugcgguggaaugggaaagcaacggccagccggaaaacaacuauaaaaccaccccgccggugcuggauagcgauggcagcuuuuuucuguauagcaaacugaccguggauaaaagccgcuggcagcagggcaacguguuuagcugcagcgugaugcaugaagcgcugcauaaccauuauacccagaaaagccugagccugagcccgggcaaa

the specific sequence of SEQ ID No.2 is as follows:

gaaauugugcugacccagagcccgggcacccugagccugagcccgggcgaacgcgcgacccugagcugccgcgcgagccagagcgugggcagcagcuaucuggcgugguaucagcagaaaccgggccaggcgccgcgccugcugauuuauggcgcguuuagccgcgcgaccggcauuccggaucgcuuuagcggcagcggcagcggcaccgauuuuacccugaccauuagccgccuggaaccggaagauuuugcgguguauuauugccagcaguauggcagcagcccguggaccuuuggccagggcaccaaaguggaaauuaaacgcaccguggcggcgccgagcguguuuauuuuuccgccgagcgaugaacagcugaaaagcggcaccgcgagcguggugugccugcugaacaacuuuuauccgcgcgaagcgaaagugcaguggaaaguggauaacgcgcugcagagcggcaacagccaggaaagcgugaccgaacaggauagcaaagauagcaccuauagccugagcagcacccugacccugagcaaagcggauuaugaaaaacauaaaguguaugcgugcgaagugacccaucagggccugagcagcccggugaccaaaagcuuuaaccgcggcgaaugc。

the invention also provides an immunosuppressive agent in the form of mRNA, comprising mRNA encoding a PD-1 inhibitor.

In the invention, the mRNA for coding the PD-1 inhibitor comprises a sequence shown in SEQ ID No. 3-4 or a sequence shown in SEQ ID No. 5-6; among the sequences of the mRNA coding for the PD-1 inhibitor, SEQ ID No.3 and SEQ ID No.5 are mRNA sequences coding for the heavy chain of the PD-1 inhibitor, and SEQ ID No.4 and SEQ ID No.6 are mRNA sequences coding for the light chain of the PD-1 inhibitor. In the invention, the specific sequence of SEQ ID No.3 is as follows:

caggugcagcugguggaaagcggcggcggcguggugcagccgggccgcagccugcgccuggauugcaaagcgagcggcauuaccuuuagcaacagcggcaugcauugggugcgccaggcgccgggcaaaggccuggaauggguggcggugauuugguaugauggcagcaaacgcuauuaugcggauagcgugaaaggccgcuuuaccauuagccgcgauaacagcaaaaacacccuguuucugcagaugaacagccugcgcgcggaagauaccgcgguguauuauugcgcgaccaacgaugauuauuggggccagggcacccuggugaccgugagcagcgcgagcaccaaaggcccgagcguguuuccgcuggcgccgugcagccgcagcaccagcgaaagcaccgcggcgcugggcugccuggugaaagauuauuuuccggaaccggugaccgugagcuggaacagcggcgcgcugaccagcggcgugcauaccuuuccggcggugcugcagagcagcggccuguauagccugagcagcguggugaccgugccgagcagcagccugggcaccaaaaccuauaccugcaacguggaucauaaaccgagcaacaccaaaguggauaaacgcguggaaagcaaauauggcccgccgugcccgccgugcccggcgccggaauuucugggcggcccgagcguguuucuguuuccgccgaaaccgaaagauacccugaugauuagccgcaccccggaagugaccugcguggugguggaugugagccaggaagauccggaagugcaguuuaacugguauguggauggcguggaagugcauaacgcgaaaaccaaaccgcgcgaagaacaguuuaacagcaccuaucgcguggugagcgugcugaccgugcugcaucaggauuggcugaacggcaaagaauauaaaugcaaagugagcaacaaaggccugccgagcagcauugaaaaaaccauuagcaaagcgaaaggccagccgcgcgaaccgcagguguauacccugccgccgagccaggaagaaaugaccaaaaaccaggugagccugaccugccuggugaaaggcuuuuauccgagcgauauugcgguggaaugggaaagcaacggccagccggaaaacaacuauaaaaccaccccgccggugcuggauagcgauggcagcuuuuuucuguauagccgccugaccguggauaaaagccgcuggcaggaaggcaacguguuuagcugcagcgugaugcaugaagcgcugcauaaccauuauacccagaaaagccugagccugagccugggcaaa。

the specific sequence of SEQ ID No.4 is as follows:

gaaauugugcugacccagagcccggcgacccugagccugagcccgggcgaacgcgcgacccugagcugccgcgcgagccagagcgugagcagcuaucuggcgugguaucagcagaaaccgggccaggcgccgcgccugcugauuuaugaugcgagcaaccgcgcgaccggcauuccggcgcgcuuuagcggcagcggcagcggcaccgauuuuacccugaccauuagcagccuggaaccggaagauuuugcgguguauuauugccagcagagcagcaacuggccgcgcaccuuuggccagggcaccaaaguggaaauuaaacgcaccguggcggcgccgagcguguuuauuuuuccgccgagcgaugaacagcugaaaagcggcaccgcgagcguggugugccugcugaacaacuuuuauccgcgcgaagcgaaagugcaguggaaaguggauaacgcgcugcagagcggcaacagccaggaaagcgugaccgaacaggauagcaaagauagcaccuauagccugagcagcacccugacccugagcaaagcggauuaugaaaaacauaaaguguaugcgugcgaagugacccaucagggccugagcagcccggugaccaaaagcuuuaaccgcggcgaaugc。

the specific sequence of SEQ ID No.5 is as follows:

caggugcagcuggugcagagcggcguggaagugaaaaaaccgggcgcgagcgugaaagugagcugcaaagcgagcggcuauaccuuuaccaacuauuauauguauugggugcgccaggcgccgggccagggccuggaauggaugggcggcauuaacccgagcaacggcggcaccaacuuuaacgaaaaauuuaaaaaccgcgugacccugaccaccgauagcagcaccaccaccgcguauauggaacugaaaagccugcaguuugaugauaccgcgguguauuauugcgcgcgccgcgauuaucgcuuugauaugggcuuugauuauuggggccagggcaccaccgugaccgugagcagcgcgagcaccaaaggcccgagcguguuuccgcuggcgccgugcagccgcagcaccagcgaaagcaccgcggcgcugggcugccuggugaaagauuauuuuccggaaccggugaccgugagcuggaacagcggcgcgcugaccagcggcgugcauaccuuuccggcggugcugcagagcagcggccuguauagccugagcagcguggugaccgugccgagcagcagccugggcaccaaaaccuauaccugcaacguggaucauaaaccgagcaacaccaaaguggauaaacgcguggaaagcaaauauggcccgccgugcccgccgugcccggcgccggaauuucugggcggcccgagcguguuucuguuuccgccgaaaccgaaagauacccugaugauuagccgcaccccggaagugaccugcguggugguggaugugagccaggaagauccggaagugcaguuuaacugguauguggauggcguggaagugcauaacgcgaaaaccaaaccgcgcgaagaacaguuuaacagcaccuaucgcguggugagcgugcugaccgugcugcaucaggauuggcugaacggcaaagaauauaaaugcaaagugagcaacaaaggccugccgagcagcauugaaaaaaccauuagcaaagcgaaaggccagccgcgcgaaccgcagguguauacccugccgccgagccaggaagaaaugaccaaaaaccaggugagccugaccugccuggugaaaggcuuuuauccgagcgauauugcgguggaaugggaaagcaacggccagccggaaaacaacuauaaaaccaccccgccggugcuggauagcgauggcagcuuuuuucuguauagccgccugaccguggauaaaagccgcuggcaggaaggcaacguguuuagcugcagcgugaugcaugaagcgcugcauaaccauuauacccagaaaagccugagccugagccugggcaaa。

the specific sequence of SEQ ID No.6 is as follows:

gaaauugugcugacccagagcccggcgacccugagccugagcccgggcgaacgcgcgacccugagcugccgcgcgagcaaaggcgugagcaccagcggcuauagcuaucugcauugguaucagcagaaaccgggccaggcgccgcgccugcugauuuaucuggcgagcuaucuggaaagcggcgugccggcgcgcuuuagcggcagcggcagcggcaccgauuuuacccugaccauuagcagccuggaaccggaagauuuugcgguguauuauugccagcauagccgcgaucugccgcugaccuuuggcggcggcaccaaaguggaaauuaaacgcaccguggcggcgccgagcguguuuauuuuuccgccgagcgaugaacagcugaaaagcggcaccgcgagcguggugugccugcugaacaacuuuuauccgcgcgaagcgaaagugcaguggaaaguggauaacgcgcugcagagcggcaacagccaggaaagcgugaccgaacaggauagcaaagauagcaccuauagccugagcagcacccugacccugagcaaagcggauuaugaaaaacauaaaguguaugcgugcgaagugacccaucagggccugagcagcccggugaccaaaagcuuuaaccgcggcgaaugc。

the invention also provides an immunosuppressive agent in the form of mRNA, which comprises mRNA encoding PD-L1 inhibitor.

In the invention, the mRNA for coding the PD-L1 inhibitor comprises a sequence shown in SEQ ID No. 7-8, a sequence shown in SEQ ID No. 9-10 or a sequence shown in SEQ ID No. 11-12; among the sequences of mRNA encoding PD-L1 inhibitor, SEQ ID No.7, SEQ ID No.9 and SEQ ID No.11 are mRNA sequences encoding the heavy chain of PD-L1 inhibitor, and SEQ ID No.8, SEQ ID No.10 and SEQ ID No.12 are mRNA sequences encoding the light chain of PD-L1 inhibitor.

In the invention, the specific sequence of SEQ ID No.7 is as follows:

gaagugcagcugguggaaagcggcggcggccuggugcagccgggcggcagccugcgccugagcugcgcggcgagcggcuuuaccuuuagcgauagcuggauucauugggugcgccaggcgccgggcaaaggccuggaauggguggcguggauuagcccguauggcggcagcaccuauuaugcggauagcgugaaaggccgcuuuaccauuagcgcggauaccagcaaaaacaccgcguaucugcagaugaacagccugcgcgcggaagauaccgcgguguauuauugcgcgcgccgccauuggccgggcggcuuugauuauuggggccagggcacccuggugaccgugagcagcgcgagcaccaaaggcccgagcguguuuccgcuggcgccgagcagcaaaagcaccagcggcggcaccgcggcgcugggcugccuggugaaagauuauuuuccggaaccggugaccgugagcuggaacagcggcgcgcugaccagcggcgugcauaccuuuccggcggugcugcagagcagcggccuguauagccugagcagcguggugaccgugccgagcagcagccugggcacccagaccuauauuugcaacgugaaccauaaaccgagcaacaccaaaguggauaaaaaaguggaaccgaaaagcugcgauaaaacccauaccugcccgccgugcccggcgccggaacugcugggcggcccgagcguguuucuguuuccgccgaaaccgaaagauacccugaugauuagccgcaccccggaagugaccugcguggugguggaugugagccaugaagauccggaagugaaauuuaacugguauguggauggcguggaagugcauaacgcgaaaaccaaaccgcgcgaagaacaguaugcgagcaccuaucgcguggugagcgugcugaccgugcugcaucaggauuggcugaacggcaaagaauauaaaugcaaagugagcaacaaagcgcugccggcgccgauugaaaaaaccauuagcaaagcgaaaggccagccgcgcgaaccgcagguguauacccugccgccgagccgcgaagaaaugaccaaaaaccaggugagccugaccugccuggugaaaggcuuuuauccgagcgauauugcgguggaaugggaaagcaacggccagccggaaaacaacuauaaaaccaccccgccggugcuggauagcgauggcagcuuuuuucuguauagcaaacugaccguggauaaaagccgcuggcagcagggcaacguguuuagcugcagcgugaugcaugaagcgcugcauaaccauuauacccagaaaagccugagccugagcccgggcaaa。

in the invention, the specific sequence of SEQ ID No.8 is as follows:

gauauucagaugacccagagcccgagcagccugagcgcgagcgugggcgaucgcgugaccauuaccugccgcgcgagccaggaugugagcaccgcgguggcgugguaucagcagaaaccgggcaaagcgccgaaacugcugauuuauagcgcgagcuuucuguauagcggcgugccgagccgcuuuagcggcagcggcagcggcaccgauuuuacccugaccauuagcagccugcagccggaagauuuugcgaccuauuauugccagcaguaucuguaucauccggcgaccuuuggccagggcaccaaaguggaaauuaaacgcaccguggcggcgccgagcguguuuauuuuuccgccgagcgaugaacagcugaaaagcggcaccgcgagcguggugugccugcugaacaacuuuuauccgcgcgaagcgaaagugcaguggaaaguggauaacgcgcugcagagcggcaacagccaggaaagcgugaccgaacaggauagcaaagauagcaccuauagccugagcagcacccugacccugagcaaagcggauuaugaaaaacauaaaguguaugcgugcgaagugacccaucagggccugagcagcccggugaccaaaagcuuuaaccgcggcgaaugc。

in the invention, the specific sequence of SEQ ID No.9 is as follows:

gaagugcagcugcuggaaagcggcggcggccuggugcagccgggcggcagccugcgccugagcugcgcggcgagcggcuuuaccuuuagcagcuauauuaugaugugggugcgccaggcgccgggcaaaggccuggaaugggugagcagcauuuauccgagcggcggcauuaccuuuuaugcggauaccgugaaaggccgcuuuaccauuagccgcgauaacagcaaaaacacccuguaucugcagaugaacagccugcgcgcggaagauaccgcgguguauuauugcgcgcgcauuaaacugggcaccgugaccaccguggauuauuggggccagggcacccuggugaccgugagcagcgcgagcaccaaaggcccgagcguguuuccgcuggcgccgagcagcaaaagcaccagcggcggcaccgcggcgcugggcugccuggugaaagauuauuuuccggaaccggugaccgugagcuggaacagcggcgcgcugaccagcggcgugcauaccuuuccggcggugcugcagagcagcggccuguauagccugagcagcguggugaccgugccgagcagcagccugggcacccagaccuauauuugcaacgugaaccauaaaccgagcaacaccaaaguggauaaaaaaguggaaccgaaaagcugcgauaaaacccauaccugcccgccgugcccggcgccggaacugcugggcggcccgagcguguuucuguuuccgccgaaaccgaaagauacccugaugauuagccgcaccccggaagugaccugcguggugguggaugugagccaugaagauccggaagugaaauuuaacugguauguggauggcguggaagugcauaacgcgaaaaccaaaccgcgcgaagaacaguauaacagcaccuaucgcguggugagcgugcugaccgugcugcaucaggauuggcugaacggcaaagaauauaaaugcaaagugagcaacaaagcgcugccggcgccgauugaaaaaaccauuagcaaagcgaaaggccagccgcgcgaaccgcagguguauacccugccgccgagccgcgaugaacugaccaaaaaccaggugagccugaccugccuggugaaaggcuuuuauccgagcgauauugcgguggaaugggaaagcaacggccagccggaaaacaacuauaaaaccaccccgccggugcuggauagcgauggcagcuuuuuucuguauagcaaacugaccguggauaaaagccgcuggcagcagggcaacguguuuagcugcagcgugaugcaugaagcgcugcauaaccauuauacccagaaaagccugagccugagcccgggcaaa。

in the invention, the specific sequence of SEQ ID No.10 is as follows:

cagagcgcgcugacccagccggcgagcgugagcggcagcccgggccagagcauuaccauuagcugcaccggcaccagcagcgaugugggcggcuauaacuaugugagcugguaucagcagcauccgggcaaagcgccgaaacugaugauuuaugaugugagcaaccgcccgagcggcgugagcaaccgcuuuagcggcagcaaaagcggcaacaccgcgagccugaccauuagcggccugcaggcggaagaugaagcggauuauuauugcagcagcuauaccagcagcagcacccgcguguuuggcaccggcaccaaagugaccgugcugggccagccgaaagcgaacccgaccgugacccuguuuccgccgagcagcgaagaacugcaggcgaacaaagcgacccuggugugccugauuagcgauuuuuauccgggcgcggugaccguggcguggaaagcggauggcagcccggugaaagcgggcguggaaaccaccaaaccgagcaaacagagcaacaacaaauaugcggcgagcagcuaucugagccugaccccggaacaguggaaaagccaucgcagcuauagcugccaggugacccaugaaggcagcaccguggaaaaaaccguggcgccgaccgaaugcagc。

in the invention, the specific sequence of SEQ ID No.11 is as follows:

gaagugcagcugguggaaagcggcggcggccuggugcagccgggcggcagccugcgccugagcugcgcggcgagcggcuuuaccuuuagccgcuauuggaugagcugggugcgccaggcgccgggcaaaggccuggaauggguggcgaacauuaaacaggauggcagcgaaaaauauuauguggauagcgugaaaggccgcuuuaccauuagccgcgauaacgcgaaaaacagccuguaucugcagaugaacagccugcgcgcggaagauaccgcgguguauuauugcgcgcgcgaaggcggcugguuuggcgaacuggcguuugauuauuggggccagggcacccuggugaccgugagcagcgcgagcaccaaaggcccgagcguguuuccgcuggcgccgagcagcaaaagcaccagcggcggcaccgcggcgcugggcugccuggugaaagauuauuuuccggaaccggugaccgugagcuggaacagcggcgcgcugaccagcggcgugcauaccuuuccggcggugcugcagagcagcggccuguauagccugagcagcguggugaccgugccgagcagcagccugggcacccagaccuauauuugcaacgugaaccauaaaccgagcaacaccaaaguggauaaacgcguggaaccgaaaagcugcgauaaaacccauaccugcccgccgugcccggcgccggaauuugaaggcggcccgagcguguuucuguuuccgccgaaaccgaaagauacccugaugauuagccgcaccccggaagugaccugcguggugguggaugugagccaugaagauccggaagugaaauuuaacugguauguggauggcguggaagugcauaacgcgaaaaccaaaccgcgcgaagaacaguauaacagcaccuaucgcguggugagcgugcugaccgugcugcaucaggauuggcugaacggcaaagaauauaaaugcaaagugagcaacaaagcgcugccggcgagcauugaaaaaaccauuagcaaagcgaaaggccagccgcgcgaaccgcagguguauacccugccgccgagccgcgaagaaaugaccaaaaaccaggugagccugaccugccuggugaaaggcuuuuauccgagcgauauugcgguggaaugggaaagcaacggccagccggaaaacaacuauaaaaccaccccgccggugcuggauagcgauggcagcuuuuuucuguauagcaaacugaccguggauaaaagccgcuggcagcagggcaacguguuuagcugcagcgugaugcaugaagcgcugcauaaccauuauacccagaaaagccugagccugagcccgggcaaa。

in the invention, the specific sequence of SEQ ID No.12 is as follows:

gaaauugugcugacccagagcccgggcacccugagccugagcccgggcgaacgcgcgacccugagcugccgcgcgagccagcgcgugagcagcagcuaucuggcgugguaucagcagaaaccgggccaggcgccgcgccugcugauuuaugaugcgagcagccgcgcgaccggcauuccggaucgcuuuagcggcagcggcagcggcaccgauuuuacccugaccauuagccgccuggaaccggaagauuuugcgguguauuauugccagcaguauggcagccugccguggaccuuuggccagggcaccaaaguggaaauuaaacgcaccguggcggcgccgagcguguuuauuuuuccgccgagcgaugaacagcugaaaagcggcaccgcgagcguggugugccugcugaacaacuuuuauccgcgcgaagcgaaagugcaguggaaaguggauaacgcgcugcagagcggcaacagccaggaaagcgugaccgaacaggauagcaaagauagcaccuauagccugagcagcacccugacccugagcaaagcggauuaugaaaaacauaaaguguaugcgugcgaagugacccaucagggccugagcagcccggugaccaaaagcuuuaaccgcggcgaaugc。

the invention also provides a compound immunosuppressant of an mRNA dosage form, which comprises two or three kinds of mRNA of CTLA-4, PD-1 and PD-L1 protein inhibitors. In the present invention, the immunosuppressive agent preferably includes mRNA encoding a CTLA-4 inhibitor and mRNA encoding a PD-1 inhibitor; the immunosuppressive agent preferably comprises mRNA encoding a CTLA-4 inhibitor and mRNA encoding a PD-L1 inhibitor. The combination of mRNA for coding CTLA-4 inhibitor and mRNA for coding PD-1 inhibitor has obvious synergistic effect; the combination of mRNA encoding CTLA-4 inhibitor and mRNA encoding PD-L1 inhibitor also has significant synergy. In the invention, the concentration of mRNA encoding CTLA-4, PD-1 or PD-L1 protein inhibitor in the composite immunosuppressant is equal.

The invention also provides application of the immunosuppressant in tumor treatment. The type of the tumor is not particularly limited in the present invention, and any tumor type commonly used in the art may be used. In the practice of the present invention, human NSCLC is taken as an example. In the specific implementation process of the invention, the immunosuppressive agent is preferably introduced into a tumor-bearing mouse, the introduction is preferably injection, and the injection site is preferably intratumoral injection; the injection dosage is preferably 80-120 mu l, more preferably 100 mu l, and the concentration of the injected immunosuppressant is preferably 8-12 mg/ml, more preferably 10 mg/ml; the frequency of the injections is preferably once per week.

The invention also provides application of the immunosuppressant in preparing a medicament for treating tumors. The type of the tumor is not particularly limited in the present invention, and any tumor type commonly used in the art may be used. In the practice of the present invention, human NSCLC is taken as an example. In the invention, the concentration of the immunosuppressant in the medicament is preferably 5-15 mg/mL, more preferably 8-12 mg/mL, and most preferably 10 mg/mL; when the compound immunosuppressant is adopted, the concentration of mRNA encoding CTLA-4, PD-1 or PD-L1 protein inhibitor in the medicament is preferably 8-12 mg/ml respectively, and more preferably 10mg/ml respectively.

The dosage form of the drug is not particularly limited, and the drug can be prepared by adopting the conventional dosage form in the field, and in the specific implementation process of the invention, the drug is an injection preparation, and the injection preparation preferably takes normal saline as a solvent. In the specific implementation process of the invention, the immunosuppressive agent is preferably introduced into a tumor-bearing mouse, the introduction is preferably injection, and the injection site is preferably intratumoral injection; the injection dosage is preferably 80-120 mu l, more preferably 100 mu l, and the concentration of the injected immunosuppressant is preferably 8-12 mg/ml, more preferably 10 mg/ml; the frequency of the injections is preferably once per week.

In the invention, uracil in the immunosuppressant of the mRNA dosage form is preferably replaced by pseudouracil, and during the synthesis process of the specific mRNA, the uracil is replaced by the pseudouracil, so that the stability of the mRNA in vivo can be further enhanced, and the half-life period of the mRNA can be prolonged; improve the expression rate of the target protein and reduce the immunogenicity of mRNA.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1 comparison of in vivo Activity and half-Life of protein drugs and mRNA drugs

Injecting a protein type PD-1 inhibitor Inbitor 2(20 mug/muL, 500 muL) and a corresponding mRNA medicament (10 mug/muL, 100 muL) into tail veins of a Balb/c mouse aged for 6 weeks, wherein the inhibitor2 is mRNA shown in SEQ ID No. 3-4; carrying out orbital bleeding on the mice for 3h, 6h, 12h, 24h, 2d, 3d, 5d and 7d, and separating serum; ELISA experiments were performed to detect the concentration of protein drugs or protein products in serum as follows:

experimental materials:

reagent: inhibitor1, 2, 3, 4, 5 and 6 protein standard substance

Consumable material: greiner 96-well enzyme label plate, 25ml pipette tip, 1ml pipette tip and 300 mu L pipette tip

An instrument device: biotekEpch2 type enzyme-linked immunosorbent assay device and Microplate 50TS type automatic plate washing machine

The experimental steps are as follows:

1) coating: the volume of the coated sample is 100. mu.L, the mass of the coated standard substance is 2ng, 0.2ng, 0.02ng, 0.002ng, 0.0002ng and 0.00002ng, and the calculated sample amount is diluted in coatingbuffer, and the volume is 100. mu.L. The row gun was added to the 96-well plate, covered with the closure film and coated overnight at 4 ℃.

2) And (3) sealing: pouring out the coating liquid from the coated 96-well plate to the water absorption paper to force the plate to be fastened until no residue is left in the hole.

3) Washing the plate: preparing an eluent, diluting the eluent by 50x by using deionized water, adding the diluted eluent into a liquid inlet bottle of a plate washing machine, setting a program, setting the volume of each hole of the plate washing machine to be 300 mu L, and repeatedly washing for 4 times.

4) And (3) sealing: the washed plate was rinsed, the solution inside was drained, a Blockingbuffer was added in a volume of 250. mu.L per well, followed by sealing with a sealing plate membrane and sealing at room temperature for 2 h.

5) Washing the plate: and (4) finishing plate washing by the closed enzyme label plate according to the step 3).

6) Primary antibody incubation: primary antibody was diluted with dilutinbuffer and added to washed 96-well plates in a volume of 100. mu.L per well, followed by incubation for 1.5h at room temperature with a sealed membrane.

7) Washing the plate: and 3) finishing plate washing according to the step 3), wherein the plate washing times are increased to 6 times.

8) Adding a secondary antibody: diluting HRP-labeled goat anti-rabbit IgG with Diluenbuffer at a dilution ratio of 10000x, adding the diluted antibody into an enzyme label plate according to the volume of 100 mu L per hole, sealing the plate-sealing membrane, and incubating for 1h at room temperature in a dark place.

9) Washing the plate: and 7) finishing plate washing according to the step 7), wherein the plate must be washed clean and the solution is dried.

Color development: adding 100 mu l of TMB buffer, and developing for 20-30 min in a dark place, wherein the positive sample develops blue.

And (4) terminating: add Stop buffer 100. mu.L, read on the ELISA plate within 10min, set the absorption wavelength at 450 nm.

The results are shown in figure 1, where the mRNA drug has higher in vivo activity and longer half-life.

Example 2

Testing the immunogenicity, expression efficiency and half-life differences of unmodified mRNA formulations and chemically modified mRNA formulations of said immunosuppressive agents

mRNA synthesis: in vitro transcription to synthesize mRNA shown in SEQ ID No.3 and SEQ ID No.4, and mRNA shown in SEQ ID No.3 and SEQ ID No.4 with uracil replaced by pseudouracil.

Inoculating the mice: the above mRNA shown in SEQ ID No.3 and SEQ ID No.4 synthesized by in vitro transcription and the mRNA shown in SEQ ID No.3 and SEQ ID No.4 obtained by substituting uracil with pseudouracil (the mRNA is dissolved in physiological saline, the concentration is 10 mug/muL, the injection volume is 200 muL) are injected into tail veins of Balb/c mice at 6 weeks of age, and orbital bleeding is carried out on the mice at different time points (3h, 6h, 12h, 24h, 2d, 3d, 5d, 7d, 9d and 12d) to separate serum. ELISA experiment is carried out to detect the concentration of protein products or immune factors in serum, and fluorescent quantitative PCR is carried out to detect the stability of mRNA molecules in mice.

Elisa protocol:

reagent: an inhibitor2 protein standard; mouse TNF alphaELISA kit (ab46105), mouse IFNbeta ELISA kit (ab 252363);

consumable material: greiner 96-well enzyme label plate, 25ml pipette tip, 1ml pipette tip and 300ul pipette tip

The instrument equipment comprises: biotekEpch2 type enzyme-linked immunosorbent assay device and Microplate 50TS type automatic plate washing machine

The experimental steps are as follows:

1) coating: the volume of the coated sample is 100. mu.L, the mass of the coated standard substance is 2ng, 0.2ng, 0.02ng, 0.002ng, 0.0002ng and 0.00002ng, and the calculated sample amount is diluted in coatingbuffer, and the volume is 100. mu.L. Rifle is added to 96-well plates, covered with a cover film and coated overnight at 4 ℃.

2) And (3) sealing: pouring out the coating liquid from the coated 96-well plate, and fastening the plate on the absorbent paper until no residue is left in the hole.

7) Washing the plate: and (4) finishing plate washing according to the step 3), wherein the plate washing times are increased to 6 times.

8) Adding a secondary antibody: diluting HRP-labeled goat anti-rabbit IgG with Dilutionbuffer by 10000x, adding the diluted antibody into an ELISA plate according to the volume of 100 mu L per hole, sealing the plate sealing membrane, and incubating for 1h at room temperature in a dark place.

9) Washing the plate: the plate washing is completed according to step 7, which is a task to wash clean the plate and rinse the solution dry.

Fluorescent quantitative PCR: using iTaq ^TM Universal

Green One-Step Kit，bio-rad 1725150。

The results are shown in fig. 2, a is that the concentration changes of the immune factors IFN γ and TNF α caused by the chemically modified mRNA are significantly lower than those caused by the mRNA without the chemical modification, which indicates that the chemically modified mRNA has lower immunogenicity; b is the concentration of the chemical modification mRNA and the mRNA expression immunosuppressant without chemical modification, and the result shows that the expression intensity and the expression cycle damage of the chemical modification mRNA are superior to those of the mRNA without chemical modification; c is the relative stability of the chemically modified mRNA and the mRNA without chemical modification in mice, and the result shows that the chemically modified mRNA has longer half-life in organisms.

Therefore, the chemically modified mRNA has the advantages of high expression efficiency, low immunogenicity and long half-life.

Example 3

Expression of immune checkpoint inhibitors in cells based on mRNA dosage forms

Cell culture: HEK-293T cells (purchased from a cell bank of Chinese academy of sciences) are inoculated to a 6-well cell culture plate, the state of the cells in the 6-well plate is observed 24 hours after the inoculation of the cells, and the confluence degree is about 90%.

In a biosafety cabinet, 10mL of 90% (volume percent) DMEM + 10% (volume percent) FBS medium was prepared. The plate was discarded 30min prior to transfection and 1mL of fresh medium (90% DMEM + 10% FBS) was added per well. Taking 200 mu L of opti-MEM, adding 10 mu g of a test sample (wherein the inhibitor1 is shown in SEQ ID No. 1-2, the inhibitor2 is shown in SEQ ID No. 3-4, the inhibitor3 is shown in SEQ ID No. 5-6, the inhibitor4 is shown in SEQ ID No. 7-8, the inhibitor5 is shown in SEQ ID No. 9-10, and the inhibitor6 is shown in SEQ ID No. 11-12) or negative control GFP-mRNA (SEQ ID No.13), lightly blowing and beating with a gun head, adding 60 mu L of polyethyleneimine PEI (with the concentration of 1mg/mL), immediately placing on a vortex oscillator for 10 times of oscillation, 1s each time, fully mixing, and standing for 10 min. The prepared transfection system is directly and evenly dripped into the cultured cells, and then the cells are evenly shaken front and back and left and right, so that the transfection system is evenly distributed on the cells. The medium was changed 6h after transfection, old medium was aspirated off and replaced with 2mL fresh medium per well (90% DMEM + 10% FBS). Harvested 24h after transfection. Old medium was aspirated and washed once with 1mL PBS. The PBS was aspirated off, the cells were blown off with 1mL PBS and collected in a 1.5mL centrifuge tube and centrifuged at 300g for 5 min. The centrifuged supernatant was aspirated to the greatest extent and the precipitated cells were used to extract total protein for western blot detection.

The results are shown in FIG. 3, with different levels of expression 24h after transfection of 293T cells with mRNA encoding CTAL4, PD1, PDL-1 inhibitor (monoclonal antibody).

Wherein, the specific sequence of SEQ ID No.13 is as follows:

cacucguucccgcuccucgacaaguggccccaccacggguaggaccagcucgaccugccgcugcauuugccgguguucaagucgcacaggccgcucccgcucccgcuacgguggaugccguucgacugggacuucaaguagacgugguggccguucgacgggcacgggaccgggugggagcacuggugggacuggaugccgcacgucacgaagucggcgauggggcugguguacuucgucgugcugaagaaguucaggcgguacgggcuuccgaugcagguccucgcgugguagaagaaguuccugcugccguugauguucugggcgcggcuccacuucaagcucccgcugugggaccacuuggcguagcucgacuucccguagcugaaguuccuccugccguuguaggaccccguguucgaccucauguugauguugucgguguugcagauauaguaccggcuguucgucuucuugccguaguuccacuugaaguucuaggcgguguuguagcuccugccgucgcacgucgagcggcuggugauggucgucuuguggggguagccgcugccggggcacgacgacgggcuguuggugauggacucgugggucaggcgggacucguuucugggguugcucuucgcgcuaguguaccaggacgaccucaagcacuggcggcggcccuagugagagccguaccugcucgacauguucauu。

example 4

Antitumor effect of mRNA-based immune checkpoint inhibitors in mouse models

Firstly, a humanized immunodeficiency mouse model is constructed, PBMCs are separated from human peripheral blood cells by using human peripheral blood lymphocyte separation liquid (DKW-KLSH-0100 in Dake family), and the specific steps are as follows:

1. a suitable amount of lymphocyte separation medium was added to a 50mL centrifuge tube.

2. Heparin anticoagulated venous blood and Hanks liquid of the same amount are mixed well, and the mixture is superposed on the layered liquid level slowly with a dropper along the tube wall while maintaining clear interface. Horizontal centrifugation at 2000rpm × 20 min.

3. The tube is divided into three layers after centrifugation, the upper layer is plasma and Hanks liquid, and the lower layer is mainly red blood cells and granulocytes. The middle layer is lymphocyte separation liquid, and a white cloud layer narrow band mainly comprising mononuclear cells including lymphocytes and monocytes is arranged at the interface between the upper layer and the middle layer.

4. And inserting capillary vessels into the cloud layer to absorb the mononuclear cells. Put into another centrifuge tube, add Hank's solution or RPMI1640 with volume more than 5 times, 1500rpm × 10min, and wash the cells twice.

5. After the final centrifugation, the supernatant was discarded, and RPMI1640 containing 10% calf serum was added to resuspend the cells. A drop of cell suspension was mixed with a drop of 0.2% trypan blue stain and counted on a hemocytometer.

NCGs mice (purchased from Ji Jing Yao kang) were injected tail vein with 10 injections per mouse ⁶ And (4) cells. 14d, taking the blood of the mice for flow analysis, and successfully constructing if the human CD4\ CD8 cells are positive, wherein the back of the mice is subcutaneously inoculated with the human non-small cell lung cancer cells A549, and each mouse is inoculated with 5 multiplied by 10 ⁶ And (4) cells.

After 7 days, tumor size and body weight changes in mice were measured. The immunosuppressive agent in the form of mRNA was dissolved in physiological saline at a concentration of 10mg/mL, and 100. mu.l of the solution was injected intratumorally. The immunosuppressant is divided into 10 groups, wherein the inhibitor1 is shown in SEQ ID No. 1-2, the inhibitor2 is shown in SEQ ID No. 3-4, the inhibitor3 is shown in SEQ ID No. 5-6, the inhibitor4 is shown in SEQ ID No. 7-8, the inhibitor5 is shown in SEQ ID No. 9-10, and the inhibitor6 is shown in SEQ ID No. 11-12; when the inhibitor1+2 is adopted, the ratio of the two is 1: 1, each component was 10mg/ml, and the tumor size and body weight of the mice were measured periodically. As shown in FIGS. 4 and 5 and tables 1 and 2, the mRNA-based immunosuppressant significantly reduced the tumor volume and the weight loss in mice.

TABLE 1 tumor size changes in mice following mRNA immunodetection inhibitor injection

TABLE 2 weight (unit: g) changes in mice following injection of immunosuppressant in mRNA dosage form

Example 5

The mRNA-based immune checkpoint inhibitor can obviously improve the cellular immune level of tumor mice

Firstly, a humanized immunodeficiency mouse model is constructed, PBMCs are separated from human peripheral blood cells, and NCGs mice are injected with tail vein, and each mouse is injected with 10 ⁶ And (3) PBMCs cells. 14d, taking the blood of the mice for flow analysis, and successfully constructing if the human CD4\ CD8 cells are positive, wherein the back of the mice is subcutaneously inoculated with the human non-small cell lung cancer cells A549, and each mouse is inoculated with 5 multiplied by 10 ⁶ And (4) cells.

After 7 days, the immunosuppressant mRNA was dissolved in physiological saline at a concentration of 10mg/mL, and 100. mu.L of the solution was injected intratumorally. After 1 week, mice tumors were harvested, digested and separated with tumor cell isolate (Valley ground, GOY-1221P), and the separated cells were analyzed by flow cytometry (antibodies used were FITC RatAntani-Human CD3a, BD, #558261, and APC-R700 Mouse Anti-Human CD8, #565192) to determine the proportion of CD8+ in tumor-infiltrating T cells.

The results are shown in fig. 6 and table 3, and the mRNA-based immune checkpoint Inhibitor can significantly improve the cellular immune level of tumor mice, wherein the ratios of the Inhibitor1+2, the Inhibitor1+ 3, the Inhibitor1+ 4, the Inhibitor1+ 5 and the Inhibitor1+ 6 to CD8+ cells in tumor infiltrating cells can be increased by nearly 2 times.

TABLE 3 proportion of CD8+ cells in tumor-infiltrating T cells after injection of an immunosuppressant drug in the form of mRNA (%)

Example 6

The mRNA-based immune checkpoint inhibitor can obviously improve the survival rate of tumor mice

Firstly, a humanized immunodeficiency mouse model is constructed, PBMCs are separated from human peripheral blood cells, and the PBMCs are separatedTail vein injection of NCGs mice, 10 per mouse ⁶ And (3) PBMCs cells. 14d later, the mice were inoculated with human non-small cell lung cancer cells A549 subcutaneously on the backs; each mouse was inoculated with 5X 10 ⁶ And (4) cells.

After 7 days, the immunosuppressant in the form of mRNA was dissolved in physiological saline at a concentration of 10mg/mL, and 100. mu.L of the solution was injected intratumorally. The survival of the mice was observed once a week, and the results are shown in fig. 7 and table 4, wherein the immunosuppressive agent in the form of mRNA significantly improves the survival rate of tumor-bearing mice.

TABLE 4 survival of tumor-bearing mice injected with immunosuppressant mRNA drugs

	21d	28d	35d
				Control	75％	50％	25％
Inhibitor1
		100％	72.7％	36.4％
Inhibitor2
		100％	81.8％	71.59％
Inhibitor4
		100％	100％	62.5％
Inhibitor1+2					100％	100％	75％
	Inhibitor1+4	100％	100％	100％

The above examples show that the immunosuppressive agent in the form of mRNA provided by the present invention has the advantages of low immunogenicity, long in vivo half-life, low cost and high drug stability.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Shenzhen Ruiji Biotechnology Limited

<120> an immunosuppressive agent of mRNA dosage form and its application in preparing tumor treatment medicine

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1344

<212> RNA

<213> Artificial Sequence

<400> 1

caggugcagc ugguggaaag cggcggcggc guggugcagc cgggccgcag ccugcgccug 60

agcugcgcgg cgagcggcuu uaccuuuagc agcuauacca ugcauugggu gcgccaggcg 120

ccgggcaaag gccuggaaug ggugaccuuu auuagcuaug auggcaacaa caaauauuau 180

gcggauagcg ugaaaggccg cuuuaccauu agccgcgaua acagcaaaaa cacccuguau 240

cugcagauga acagccugcg cgcggaagau accgcgauuu auuauugcgc gcgcaccggc 300

uggcugggcc cguuugauua uuggggccag ggcacccugg ugaccgugag cagcgcgagc 360

accaaaggcc cgagcguguu uccgcuggcg ccgagcagca aaagcaccag cggcggcacc 420

gcggcgcugg gcugccuggu gaaagauuau uuuccggaac cggugaccgu gagcuggaac 480

agcggcgcgc ugaccagcgg cgugcauacc uuuccggcgg ugcugcagag cagcggccug 540

uauagccuga gcagcguggu gaccgugccg agcagcagcc ugggcaccca gaccuauauu 600

ugcaacguga accauaaacc gagcaacacc aaaguggaua aacgcgugga accgaaaagc 660

ugcgauaaaa cccauaccug cccgccgugc ccggcgccgg aacugcuggg cggcccgagc 720

guguuucugu uuccgccgaa accgaaagau acccugauga uuagccgcac cccggaagug 780

accugcgugg ugguggaugu gagccaugaa gauccggaag ugaaauuuaa cugguaugug 840

gauggcgugg aagugcauaa cgcgaaaacc aaaccgcgcg aagaacagua uaacagcacc 900

uaucgcgugg ugagcgugcu gaccgugcug caucaggauu ggcugaacgg caaagaauau 960

aaaugcaaag ugagcaacaa agcgcugccg gcgccgauug aaaaaaccau uagcaaagcg 1020

aaaggccagc cgcgcgaacc gcagguguau acccugccgc cgagccgcga ugaacugacc 1080

aaaaaccagg ugagccugac cugccuggug aaaggcuuuu auccgagcga uauugcggug 1140

gaaugggaaa gcaacggcca gccggaaaac aacuauaaaa ccaccccgcc ggugcuggau 1200

agcgauggca gcuuuuuucu guauagcaaa cugaccgugg auaaaagccg cuggcagcag 1260

ggcaacgugu uuagcugcag cgugaugcau gaagcgcugc auaaccauua uacccagaaa 1320

agccugagcc ugagcccggg caaa 1344

<210> 2

<211> 645

<212> RNA

<213> Artificial Sequence

<400> 2

gaaauugugc ugacccagag cccgggcacc cugagccuga gcccgggcga acgcgcgacc 60

cugagcugcc gcgcgagcca gagcgugggc agcagcuauc uggcguggua ucagcagaaa 120

ccgggccagg cgccgcgccu gcugauuuau ggcgcguuua gccgcgcgac cggcauuccg 180

gaucgcuuua gcggcagcgg cagcggcacc gauuuuaccc ugaccauuag ccgccuggaa 240

ccggaagauu uugcggugua uuauugccag caguauggca gcagcccgug gaccuuuggc 300

cagggcacca aaguggaaau uaaacgcacc guggcggcgc cgagcguguu uauuuuuccg 360

ccgagcgaug aacagcugaa aagcggcacc gcgagcgugg ugugccugcu gaacaacuuu 420

uauccgcgcg aagcgaaagu gcaguggaaa guggauaacg cgcugcagag cggcaacagc 480

caggaaagcg ugaccgaaca ggauagcaaa gauagcaccu auagccugag cagcacccug 540

acccugagca aagcggauua ugaaaaacau aaaguguaug cgugcgaagu gacccaucag 600

ggccugagca gcccggugac caaaagcuuu aaccgcggcg aaugc 645

<210> 3

<211> 1320

<212> RNA

<213> Artificial Sequence

<400> 3

caggugcagc ugguggaaag cggcggcggc guggugcagc cgggccgcag ccugcgccug 60

gauugcaaag cgagcggcau uaccuuuagc aacagcggca ugcauugggu gcgccaggcg 120

ccgggcaaag gccuggaaug gguggcggug auuugguaug auggcagcaa acgcuauuau 180

gcggauagcg ugaaaggccg cuuuaccauu agccgcgaua acagcaaaaa cacccuguuu 240

cugcagauga acagccugcg cgcggaagau accgcggugu auuauugcgc gaccaacgau 300

gauuauuggg gccagggcac ccuggugacc gugagcagcg cgagcaccaa aggcccgagc 360

guguuuccgc uggcgccgug cagccgcagc accagcgaaa gcaccgcggc gcugggcugc 420

cuggugaaag auuauuuucc ggaaccggug accgugagcu ggaacagcgg cgcgcugacc 480

agcggcgugc auaccuuucc ggcggugcug cagagcagcg gccuguauag ccugagcagc 540

guggugaccg ugccgagcag cagccugggc accaaaaccu auaccugcaa cguggaucau 600

aaaccgagca acaccaaagu ggauaaacgc guggaaagca aauauggccc gccgugcccg 660

ccgugcccgg cgccggaauu ucugggcggc ccgagcgugu uucuguuucc gccgaaaccg 720

aaagauaccc ugaugauuag ccgcaccccg gaagugaccu gcgugguggu ggaugugagc 780

caggaagauc cggaagugca guuuaacugg uauguggaug gcguggaagu gcauaacgcg 840

aaaaccaaac cgcgcgaaga acaguuuaac agcaccuauc gcguggugag cgugcugacc 900

gugcugcauc aggauuggcu gaacggcaaa gaauauaaau gcaaagugag caacaaaggc 960

cugccgagca gcauugaaaa aaccauuagc aaagcgaaag gccagccgcg cgaaccgcag 1020

guguauaccc ugccgccgag ccaggaagaa augaccaaaa accaggugag ccugaccugc 1080

cuggugaaag gcuuuuaucc gagcgauauu gcgguggaau gggaaagcaa cggccagccg 1140

gaaaacaacu auaaaaccac cccgccggug cuggauagcg auggcagcuu uuuucuguau 1200

agccgccuga ccguggauaa aagccgcugg caggaaggca acguguuuag cugcagcgug 1260

augcaugaag cgcugcauaa ccauuauacc cagaaaagcc ugagccugag ccugggcaaa 1320

<210> 4

<211> 642

<212> RNA

<213> Artificial Sequence

<400> 4

gaaauugugc ugacccagag cccggcgacc cugagccuga gcccgggcga acgcgcgacc 60

cugagcugcc gcgcgagcca gagcgugagc agcuaucugg cgugguauca gcagaaaccg 120

ggccaggcgc cgcgccugcu gauuuaugau gcgagcaacc gcgcgaccgg cauuccggcg 180

cgcuuuagcg gcagcggcag cggcaccgau uuuacccuga ccauuagcag ccuggaaccg 240

gaagauuuug cgguguauua uugccagcag agcagcaacu ggccgcgcac cuuuggccag 300

ggcaccaaag uggaaauuaa acgcaccgug gcggcgccga gcguguuuau uuuuccgccg 360

agcgaugaac agcugaaaag cggcaccgcg agcguggugu gccugcugaa caacuuuuau 420

ccgcgcgaag cgaaagugca guggaaagug gauaacgcgc ugcagagcgg caacagccag 480

gaaagcguga ccgaacagga uagcaaagau agcaccuaua gccugagcag cacccugacc 540

cugagcaaag cggauuauga aaaacauaaa guguaugcgu gcgaagugac ccaucagggc 600

cugagcagcc cggugaccaa aagcuuuaac cgcggcgaau gc 642

<210> 5

<211> 1341

<212> RNA

<213> Artificial Sequence

<400> 5

caggugcagc uggugcagag cggcguggaa gugaaaaaac cgggcgcgag cgugaaagug 60

agcugcaaag cgagcggcua uaccuuuacc aacuauuaua uguauugggu gcgccaggcg 120

ccgggccagg gccuggaaug gaugggcggc auuaacccga gcaacggcgg caccaacuuu 180

aacgaaaaau uuaaaaaccg cgugacccug accaccgaua gcagcaccac caccgcguau 240

auggaacuga aaagccugca guuugaugau accgcggugu auuauugcgc gcgccgcgau 300

uaucgcuuug auaugggcuu ugauuauugg ggccagggca ccaccgugac cgugagcagc 360

gcgagcacca aaggcccgag cguguuuccg cuggcgccgu gcagccgcag caccagcgaa 420

agcaccgcgg cgcugggcug ccuggugaaa gauuauuuuc cggaaccggu gaccgugagc 480

uggaacagcg gcgcgcugac cagcggcgug cauaccuuuc cggcggugcu gcagagcagc 540

ggccuguaua gccugagcag cguggugacc gugccgagca gcagccuggg caccaaaacc 600

uauaccugca acguggauca uaaaccgagc aacaccaaag uggauaaacg cguggaaagc 660

aaauauggcc cgccgugccc gccgugcccg gcgccggaau uucugggcgg cccgagcgug 720

uuucuguuuc cgccgaaacc gaaagauacc cugaugauua gccgcacccc ggaagugacc 780

ugcguggugg uggaugugag ccaggaagau ccggaagugc aguuuaacug guauguggau 840

ggcguggaag ugcauaacgc gaaaaccaaa ccgcgcgaag aacaguuuaa cagcaccuau 900

cgcgugguga gcgugcugac cgugcugcau caggauuggc ugaacggcaa agaauauaaa 960

ugcaaaguga gcaacaaagg ccugccgagc agcauugaaa aaaccauuag caaagcgaaa 1020

ggccagccgc gcgaaccgca gguguauacc cugccgccga gccaggaaga aaugaccaaa 1080

aaccagguga gccugaccug ccuggugaaa ggcuuuuauc cgagcgauau ugcgguggaa 1140

ugggaaagca acggccagcc ggaaaacaac uauaaaacca ccccgccggu gcuggauagc 1200

gauggcagcu uuuuucugua uagccgccug accguggaua aaagccgcug gcaggaaggc 1260

aacguguuua gcugcagcgu gaugcaugaa gcgcugcaua accauuauac ccagaaaagc 1320

cugagccuga gccugggcaa a 1341

<210> 6

<211> 654

<212> RNA

<213> Artificial Sequence

<400> 6

gaaauugugc ugacccagag cccggcgacc cugagccuga gcccgggcga acgcgcgacc 60

cugagcugcc gcgcgagcaa aggcgugagc accagcggcu auagcuaucu gcauugguau 120

cagcagaaac cgggccaggc gccgcgccug cugauuuauc uggcgagcua ucuggaaagc 180

ggcgugccgg cgcgcuuuag cggcagcggc agcggcaccg auuuuacccu gaccauuagc 240

agccuggaac cggaagauuu ugcgguguau uauugccagc auagccgcga ucugccgcug 300

accuuuggcg gcggcaccaa aguggaaauu aaacgcaccg uggcggcgcc gagcguguuu 360

auuuuuccgc cgagcgauga acagcugaaa agcggcaccg cgagcguggu gugccugcug 420

aacaacuuuu auccgcgcga agcgaaagug caguggaaag uggauaacgc gcugcagagc 480

ggcaacagcc aggaaagcgu gaccgaacag gauagcaaag auagcaccua uagccugagc 540

agcacccuga cccugagcaa agcggauuau gaaaaacaua aaguguaugc gugcgaagug 600

acccaucagg gccugagcag cccggugacc aaaagcuuua accgcggcga augc 654

<210> 7

<211> 1344

<212> RNA

<213> Artificial Sequence

<400> 7

gaagugcagc ugguggaaag cggcggcggc cuggugcagc cgggcggcag ccugcgccug 60

agcugcgcgg cgagcggcuu uaccuuuagc gauagcugga uucauugggu gcgccaggcg 120

ccgggcaaag gccuggaaug gguggcgugg auuagcccgu auggcggcag caccuauuau 180

gcggauagcg ugaaaggccg cuuuaccauu agcgcggaua ccagcaaaaa caccgcguau 240

cugcagauga acagccugcg cgcggaagau accgcggugu auuauugcgc gcgccgccau 300

uggccgggcg gcuuugauua uuggggccag ggcacccugg ugaccgugag cagcgcgagc 360

accaaaggcc cgagcguguu uccgcuggcg ccgagcagca aaagcaccag cggcggcacc 420

gcggcgcugg gcugccuggu gaaagauuau uuuccggaac cggugaccgu gagcuggaac 480

agcggcgcgc ugaccagcgg cgugcauacc uuuccggcgg ugcugcagag cagcggccug 540

uauagccuga gcagcguggu gaccgugccg agcagcagcc ugggcaccca gaccuauauu 600

ugcaacguga accauaaacc gagcaacacc aaaguggaua aaaaagugga accgaaaagc 660

ugcgauaaaa cccauaccug cccgccgugc ccggcgccgg aacugcuggg cggcccgagc 720

guguuucugu uuccgccgaa accgaaagau acccugauga uuagccgcac cccggaagug 780

accugcgugg ugguggaugu gagccaugaa gauccggaag ugaaauuuaa cugguaugug 840

gauggcgugg aagugcauaa cgcgaaaacc aaaccgcgcg aagaacagua ugcgagcacc 900

uaucgcgugg ugagcgugcu gaccgugcug caucaggauu ggcugaacgg caaagaauau 960

aaaugcaaag ugagcaacaa agcgcugccg gcgccgauug aaaaaaccau uagcaaagcg 1020

aaaggccagc cgcgcgaacc gcagguguau acccugccgc cgagccgcga agaaaugacc 1080

aaaaaccagg ugagccugac cugccuggug aaaggcuuuu auccgagcga uauugcggug 1140

gaaugggaaa gcaacggcca gccggaaaac aacuauaaaa ccaccccgcc ggugcuggau 1200

agcgauggca gcuuuuuucu guauagcaaa cugaccgugg auaaaagccg cuggcagcag 1260

ggcaacgugu uuagcugcag cgugaugcau gaagcgcugc auaaccauua uacccagaaa 1320

agccugagcc ugagcccggg caaa 1344

<210> 8

<211> 642

<212> RNA

<213> Artificial Sequence

<400> 8

gauauucaga ugacccagag cccgagcagc cugagcgcga gcgugggcga ucgcgugacc 60

auuaccugcc gcgcgagcca ggaugugagc accgcggugg cgugguauca gcagaaaccg 120

ggcaaagcgc cgaaacugcu gauuuauagc gcgagcuuuc uguauagcgg cgugccgagc 180

cgcuuuagcg gcagcggcag cggcaccgau uuuacccuga ccauuagcag ccugcagccg 240

gaagauuuug cgaccuauua uugccagcag uaucuguauc auccggcgac cuuuggccag 300

ggcaccaaag uggaaauuaa acgcaccgug gcggcgccga gcguguuuau uuuuccgccg 360

agcgaugaac agcugaaaag cggcaccgcg agcguggugu gccugcugaa caacuuuuau 420

ccgcgcgaag cgaaagugca guggaaagug gauaacgcgc ugcagagcgg caacagccag 480

gaaagcguga ccgaacagga uagcaaagau agcaccuaua gccugagcag cacccugacc 540

cugagcaaag cggauuauga aaaacauaaa guguaugcgu gcgaagugac ccaucagggc 600

cugagcagcc cggugaccaa aagcuuuaac cgcggcgaau gc 642

<210> 9

<211> 1350

<212> RNA

<213> Artificial Sequence

<400> 9

gaagugcagc ugcuggaaag cggcggcggc cuggugcagc cgggcggcag ccugcgccug 60

agcugcgcgg cgagcggcuu uaccuuuagc agcuauauua ugaugugggu gcgccaggcg 120

ccgggcaaag gccuggaaug ggugagcagc auuuauccga gcggcggcau uaccuuuuau 180

gcggauaccg ugaaaggccg cuuuaccauu agccgcgaua acagcaaaaa cacccuguau 240

cugcagauga acagccugcg cgcggaagau accgcggugu auuauugcgc gcgcauuaaa 300

cugggcaccg ugaccaccgu ggauuauugg ggccagggca cccuggugac cgugagcagc 360

gcgagcacca aaggcccgag cguguuuccg cuggcgccga gcagcaaaag caccagcggc 420

ggcaccgcgg cgcugggcug ccuggugaaa gauuauuuuc cggaaccggu gaccgugagc 480

uggaacagcg gcgcgcugac cagcggcgug cauaccuuuc cggcggugcu gcagagcagc 540

ggccuguaua gccugagcag cguggugacc gugccgagca gcagccuggg cacccagacc 600

uauauuugca acgugaacca uaaaccgagc aacaccaaag uggauaaaaa aguggaaccg 660

aaaagcugcg auaaaaccca uaccugcccg ccgugcccgg cgccggaacu gcugggcggc 720

ccgagcgugu uucuguuucc gccgaaaccg aaagauaccc ugaugauuag ccgcaccccg 780

gaagugaccu gcgugguggu ggaugugagc caugaagauc cggaagugaa auuuaacugg 840

uauguggaug gcguggaagu gcauaacgcg aaaaccaaac cgcgcgaaga acaguauaac 900

agcaccuauc gcguggugag cgugcugacc gugcugcauc aggauuggcu gaacggcaaa 960

gaauauaaau gcaaagugag caacaaagcg cugccggcgc cgauugaaaa aaccauuagc 1020

aaagcgaaag gccagccgcg cgaaccgcag guguauaccc ugccgccgag ccgcgaugaa 1080

cugaccaaaa accaggugag ccugaccugc cuggugaaag gcuuuuaucc gagcgauauu 1140

gcgguggaau gggaaagcaa cggccagccg gaaaacaacu auaaaaccac cccgccggug 1200

cuggauagcg auggcagcuu uuuucuguau agcaaacuga ccguggauaa aagccgcugg 1260

cagcagggca acguguuuag cugcagcgug augcaugaag cgcugcauaa ccauuauacc 1320

cagaaaagcc ugagccugag cccgggcaaa 1350

<210> 10

<211> 648

<212> RNA

<213> Artificial Sequence

<400> 10

cagagcgcgc ugacccagcc ggcgagcgug agcggcagcc cgggccagag cauuaccauu 60

agcugcaccg gcaccagcag cgaugugggc ggcuauaacu augugagcug guaucagcag 120

cauccgggca aagcgccgaa acugaugauu uaugauguga gcaaccgccc gagcggcgug 180

agcaaccgcu uuagcggcag caaaagcggc aacaccgcga gccugaccau uagcggccug 240

caggcggaag augaagcgga uuauuauugc agcagcuaua ccagcagcag cacccgcgug 300

uuuggcaccg gcaccaaagu gaccgugcug ggccagccga aagcgaaccc gaccgugacc 360

cuguuuccgc cgagcagcga agaacugcag gcgaacaaag cgacccuggu gugccugauu 420

agcgauuuuu auccgggcgc ggugaccgug gcguggaaag cggauggcag cccggugaaa 480

gcgggcgugg aaaccaccaa accgagcaaa cagagcaaca acaaauaugc ggcgagcagc 540

uaucugagcc ugaccccgga acaguggaaa agccaucgca gcuauagcug ccaggugacc 600

caugaaggca gcaccgugga aaaaaccgug gcgccgaccg aaugcagc 648

<210> 11

<211> 1353

<212> RNA

<213> Artificial Sequence

<400> 11

gaagugcagc ugguggaaag cggcggcggc cuggugcagc cgggcggcag ccugcgccug 60

agcugcgcgg cgagcggcuu uaccuuuagc cgcuauugga ugagcugggu gcgccaggcg 120

ccgggcaaag gccuggaaug gguggcgaac auuaaacagg auggcagcga aaaauauuau 180

guggauagcg ugaaaggccg cuuuaccauu agccgcgaua acgcgaaaaa cagccuguau 240

cugcagauga acagccugcg cgcggaagau accgcggugu auuauugcgc gcgcgaaggc 300

ggcugguuug gcgaacuggc guuugauuau uggggccagg gcacccuggu gaccgugagc 360

agcgcgagca ccaaaggccc gagcguguuu ccgcuggcgc cgagcagcaa aagcaccagc 420

ggcggcaccg cggcgcuggg cugccuggug aaagauuauu uuccggaacc ggugaccgug 480

agcuggaaca gcggcgcgcu gaccagcggc gugcauaccu uuccggcggu gcugcagagc 540

agcggccugu auagccugag cagcguggug accgugccga gcagcagccu gggcacccag 600

accuauauuu gcaacgugaa ccauaaaccg agcaacacca aaguggauaa acgcguggaa 660

ccgaaaagcu gcgauaaaac ccauaccugc ccgccgugcc cggcgccgga auuugaaggc 720

ggcccgagcg uguuucuguu uccgccgaaa ccgaaagaua cccugaugau uagccgcacc 780

ccggaaguga ccugcguggu gguggaugug agccaugaag auccggaagu gaaauuuaac 840

ugguaugugg auggcgugga agugcauaac gcgaaaacca aaccgcgcga agaacaguau 900

aacagcaccu aucgcguggu gagcgugcug accgugcugc aucaggauug gcugaacggc 960

aaagaauaua aaugcaaagu gagcaacaaa gcgcugccgg cgagcauuga aaaaaccauu 1020

agcaaagcga aaggccagcc gcgcgaaccg cagguguaua cccugccgcc gagccgcgaa 1080

gaaaugacca aaaaccaggu gagccugacc ugccugguga aaggcuuuua uccgagcgau 1140

auugcggugg aaugggaaag caacggccag ccggaaaaca acuauaaaac caccccgccg 1200

gugcuggaua gcgauggcag cuuuuuucug uauagcaaac ugaccgugga uaaaagccgc 1260

uggcagcagg gcaacguguu uagcugcagc gugaugcaug aagcgcugca uaaccauuau 1320

acccagaaaa gccugagccu gagcccgggc aaa 1353

<210> 12

<211> 645

<212> RNA

<213> Artificial Sequence

<400> 12

gaaauugugc ugacccagag cccgggcacc cugagccuga gcccgggcga acgcgcgacc 60

cugagcugcc gcgcgagcca gcgcgugagc agcagcuauc uggcguggua ucagcagaaa 120

ccgggccagg cgccgcgccu gcugauuuau gaugcgagca gccgcgcgac cggcauuccg 180

gaucgcuuua gcggcagcgg cagcggcacc gauuuuaccc ugaccauuag ccgccuggaa 240

ccggaagauu uugcggugua uuauugccag caguauggca gccugccgug gaccuuuggc 300

cagggcacca aaguggaaau uaaacgcacc guggcggcgc cgagcguguu uauuuuuccg 360

ccgagcgaug aacagcugaa aagcggcacc gcgagcgugg ugugccugcu gaacaacuuu 420

uauccgcgcg aagcgaaagu gcaguggaaa guggauaacg cgcugcagag cggcaacagc 480

caggaaagcg ugaccgaaca ggauagcaaa gauagcaccu auagccugag cagcacccug 540

acccugagca aagcggauua ugaaaaacau aaaguguaug cgugcgaagu gacccaucag 600

ggccugagca gcccggugac caaaagcuuu aaccgcggcg aaugc 645

<210> 13

<211> 717

<212> RNA

<213> Artificial Sequence

<400> 13

cacucguucc cgcuccucga caaguggccc caccacgggu aggaccagcu cgaccugccg 60

cugcauuugc cgguguucaa gucgcacagg ccgcucccgc ucccgcuacg guggaugccg 120

uucgacuggg acuucaagua gacguggugg ccguucgacg ggcacgggac cgggugggag 180

cacugguggg acuggaugcc gcacgucacg aagucggcga uggggcuggu guacuucguc 240

gugcugaaga aguucaggcg guacgggcuu ccgaugcagg uccucgcgug guagaagaag 300

uuccugcugc cguugauguu cugggcgcgg cuccacuuca agcucccgcu gugggaccac 360

uuggcguagc ucgacuuccc guagcugaag uuccuccugc cguuguagga ccccguguuc 420

gaccucaugu ugauguuguc gguguugcag auauaguacc ggcuguucgu cuucuugccg 480

uaguuccacu ugaaguucua ggcgguguug uagcuccugc cgucgcacgu cgagcggcug 540

gugauggucg ucuugugggg guagccgcug ccggggcacg acgacgggcu guuggugaug 600

gacucguggg ucaggcggga cucguuucug ggguugcucu ucgcgcuagu guaccaggac 660

gaccucaagc acuggcggcg gcccuaguga gagccguacc ugcucgacau guucauu 717

Claims

1. An immunosuppressive agent in the form of mRNA comprising mRNA encoding an inhibitor of CTLA-4.

2. The immunosuppressant of claim 1, wherein the mRNA encoding a CTLA-4 inhibitor comprises the sequences shown in SEQ ID No.1 and SEQ ID No. 2.

3. An immunosuppressive agent in the form of mRNA comprising mRNA encoding a PD-1 inhibitor.

4. The immunosuppressant of claim 3, wherein the mRNA encoding a PD-1 inhibitor comprises a sequence shown in SEQ ID Nos. 3 to 4 or a sequence shown in SEQ ID Nos. 5 to 6.

5. An immunosuppressive agent in the form of mRNA comprising mRNA encoding a PD-L1 inhibitor.

6. The immunosuppressant of claim 5, wherein the mRNA encoding a PD-L1 inhibitor comprises SEQ ID Nos. 7 to 8, 9 to 10, or 11 to 12.

7. The mRNA-based composite immunosuppressant is characterized by comprising two or three of mRNA encoding a CTLA-4 inhibitor, mRNA encoding a PD-1 inhibitor and mRNA encoding a PD-L1 inhibitor.

8. The immunosuppressant of any one of claims 1 to 6 or the combined immunosuppressant of claim 7, wherein uracil is replaced with pseudouracil.

9. Use of the immunosuppressant of any one of claims 1 to 6 or the composite immunosuppressant of claim 7 for the preparation of a medicament for the treatment of tumors.

10. The use of claim 9, wherein the tumor comprises human non-small cell lung cancer; the concentration of the immunosuppressant in the medicine is 5-15 mg/mL.