CN114875135B - Application of OGN gene as biomarker in preparation of kit for diagnosing pancreatic cancer - Google Patents
Application of OGN gene as biomarker in preparation of kit for diagnosing pancreatic cancer Download PDFInfo
- Publication number
- CN114875135B CN114875135B CN202111605537.7A CN202111605537A CN114875135B CN 114875135 B CN114875135 B CN 114875135B CN 202111605537 A CN202111605537 A CN 202111605537A CN 114875135 B CN114875135 B CN 114875135B
- Authority
- CN
- China
- Prior art keywords
- ogn
- pancreatic cancer
- gene
- cells
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention provides application of an OGN gene as a biomarker in preparation of a kit for diagnosing pancreatic cancer; the expression level of the OGN gene in pancreatic cancer cells is obviously higher than that of tissues beside cancer, and the over-expression of the OGN gene can enhance the activity of the pancreatic cancer cells, promote the proliferation, migration and invasion of the pancreatic cancer cells and inhibit apoptosis; and the inhibition of the expression of the OGN gene can reduce the activity of pancreatic cancer cells, inhibit the proliferation, migration and invasion of the pancreatic cancer cells and promote apoptosis. Therefore, the OGN gene can be used as a biomarker for pancreatic cancer diagnosis and as a target for pancreatic cancer treatment.
Description
Technical Field
The invention belongs to the technical field of pancreatic cancer detection and treatment, and particularly relates to application of an OGN gene as a biomarker in preparation of a kit for diagnosing pancreatic cancer.
Background
Malignant tumor is a non-infectious epidemic disease, and the difficult cure and fatality become one of the diseases seriously jeopardizing the human life health. Pancreatic malignancies belong to the class of digestive system tumors, and due to their difficult diagnosis and lack of good therapeutic approaches, have a low overall survival rate of 5 years, and have an increasing incidence and mortality of pancreatic cancer worldwide. Therefore, understanding the mechanism of tumor development is crucial to the development of relevant drugs. Extracellular matrices (ECMs) regulate the growth and development of tumor cells, which play an important role in human development, maintenance of homeostasis and pathological responses. In tumor tissues, ECMs can cause dynamic changes in the tumor microenvironment, which affect the tumor development process by regulating the transmission of tumor proliferation signals and the proliferation and invasion capacity of tumor cells. SLRPs are involved in various processes such as inflammation, fibrosis and cell proliferation as a matrix proteoglycan, and play a certain role in regulation of various tumor cell proliferation and migration processes (Frikeche J, maiti G, chakravarti S. Small leucocyte-rich protein proteins in tumor infection and in peripheral health [ J ] Exp Eye Res,2016,151:142-9.; chen S W, tung Y C, jung S M, et al; simoes R S, soares J M, J. In the class III SLRP family, there is a poly glycosylation site protein OGN, which has multiple functions in mammalian bone and is named as osteoinductive factor because of its function of inducing bone formation, and is subsequently renamed OGN (Costa R A, martins R S T, capilla E, et al. Vertebrate SLRP family and the subfunction of osteoinductive gene duplicates in teleost fish [ J ]. BMC Evol Biol,2018,18 (1): 191), due to its small size and complex function. Studies have shown that OGN is involved in a variety of physiological processes (Xu T, zhang R, dog et al, osteologlycin (OGN) inhibition cell promotion and inactivation in cleavage assay pathway PI3K/Akt/mTOR signaling pathway No. on smooth muscle cells the term "his 20112"; in vitro OGN knockout experiments show that OGN knockout can promote the expression of proliferation-related cytokines such as angiotensin II (AngII) and Platelet Derived Growth Factor (PDGF) and the like, thereby promoting the proliferation of vascular smooth muscle cells (Gu X S, lei J P, shi J B, et al. Mimecan is secreted in an alpha-organic induced by systemic metabolic degradation in rates [ J ]. Mol Cell Biochem,2011,352 (1-2): 309-16.). OGN functions are diverse and play an important role in a variety of diseases. At present, the specific expression of the OGN gene has been found in various disease tissues, such as bone diseases such as arthritis, cardiovascular diseases such as atherosclerosis, tumor diseases such as laryngeal malignant tumor, colorectal malignant tumor and pulmonary malignant tumor, and eye diseases such as glaucoma.
ID4 is called DNA binding Inhibitor 4 (Inhibitor of DNA binding 4, ID4) and belongs to the family of DNA binding inhibitors. ID4 plays an important role in regulating the processes of cell proliferation and apoptosis, tumor formation, invasion and migration. It is widely distributed in human body, has expression in brain tissue, pancreatic cancer tissue, spermatogonium, thyroid gland and testis, and plays an irreplaceable role in the development process of prostate and mammary gland. The ID4 gene can play a role of a cancer promotion gene or a cancer inhibition gene in the process of tumor formation. It plays a role of cancer promotion gene in nervous system and tumor angiogenesis mechanism, and is cancer suppressor gene in acute leukemia, breast cancer, prostatic cancer, colorectal cancer, gastric cancer, esophageal cancer, etc. In colorectal Cancer, it inhibits Growth and metastasis of colorectal Cancer Cells by inhibiting the PI3K/AKT pathway in a CK 18-dependent manner (Chen HJ, yu Y, sun YX et al. Id4 supresses the Growth and Invasion of the colorectal Cancer HCT116 Cells through CK18-Related Inhibition of AKT and EMT signaling.j Oncol 2021. In liver Cancer, its expression promotes proliferation and in vitro clonogenic of hepatoma cells (Zhang Y, zhang LX, liu XQ et al. Id4 promoters cell promotion in hepatocellular Cancer. China J Cancer 20136. In lung cancer, it can promote the expression of E-cadherin (E-cadherin) by zinc finger transcription factor (slug), causing epithelial-mesenchymal transition (EMT), and inhibiting cancer metastasis (Wang CC, hsu YL, chang CJ et al. Inhibitor of DNA-binding protein 4 deletion cancer methods through the regulation of epithelial machinery transport in lung adoctarcocanors (Basel) 2019 (12): 2021). However, the relationship between OGN and ID4 in the development of pancreatic cancer is not reported so far.
Disclosure of Invention
In view of the above, the present invention aims to provide the use of the OGN gene as a biomarker in the preparation of a kit for diagnosing pancreatic cancer; the inventor researches and finds that the expression level of the OGN gene in pancreatic cancer cells is obviously higher than that of tissues beside cancer, and the over-expression of the OGN gene can enhance the activity of the pancreatic cancer cells, promote the proliferation, migration and invasion of the pancreatic cancer cells and inhibit apoptosis; and the inhibition of the expression of the OGN gene can reduce the activity of pancreatic cancer cells, inhibit the proliferation, migration and invasion of the pancreatic cancer cells and promote apoptosis. Therefore, the OGN gene can be used as a biomarker for pancreatic cancer diagnosis and as a target for pancreatic cancer therapy.
The invention provides application of OGN gene as a biomarker in preparation of a kit for diagnosing pancreatic cancer.
Preferably, the kit comprises a primer group for detecting the OGN gene, wherein the primer group comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2.
The invention provides application of a reagent for over-expressing OGN genes in promoting proliferation, migration and invasion of pancreatic cancer cells.
Preferably, the agent for over-expressing the OGN gene includes a recombinant vector for over-expressing the OGN gene.
Preferably, the recombinant vector uses pCMV3-C-myc plasmid as an initial vector.
The invention provides application of a reagent for over-expressing OGN genes in inhibiting pancreatic cancer cell apoptosis.
The invention provides application of an inhibitor of OGN gene expression in preparing a medicament for treating pancreatic cancer.
Preferably, the inhibitor of OGN gene expression comprises siRNA with OGN gene as a target gene.
Preferably, the sequence of the siRNA is shown as SEQ ID NO.3 and SEQ ID NO. 4.
The invention also provides application of the OGN gene as a DNA binding inhibition factor 4 expression promoter.
The invention provides application of an OGN gene as a biomarker in preparation of a kit for diagnosing pancreatic cancer; the expression of the OGN gene in pancreatic cancer cells is obviously higher than that of pancreatic normal tissue cells; the detection by MTT and CCK8 methods shows that the cell activity of pancreatic cancer can be obviously enhanced by over-expressing the OGN gene; edU and Tunel fluorescent detection shows that the OGN gene can promote pancreatic cancer cell proliferation and inhibit pancreatic cancer cell apoptosis; real-time PCR experiments show that the function of over-expressing OGN is realized by regulating and controlling the expression of cell proliferation and apoptosis related genes; cell migration and invasion experiments show that the pancreatic cancer cell migration and invasion capacity can be obviously enhanced by over-expressing the OGN gene; the OGN gene can promote the expression of ID4 by over-expression, which indicates that ID4 is one of downstream regulatory molecules of the OGN gene; the OGN gene can be used as a serum marker effective in diagnosing pancreatic cancer. Meanwhile, the OGN gene or the ID4 gene is taken as a target, and the inhibition of the expression of the target gene is an effective method for treating pancreatic cancer.
Drawings
FIG. 1 shows the OGN gene expression in pancreatic cancer tissues, wherein A is the OGN gene expression in pancreatic cancer tissue samples and normal pancreatic tissue samples in the GEPIA database; b is the expression level of OGN genes in pancreatic cancer tissue samples of pancreatic cancer patients with different pathological stages;
FIG. 2 is a graph of the difference in survival rates for patients with high and low expression pancreatic cancer of the OGN gene, wherein A and B are the overall survival rate and disease-free survival rate of patients with high and low expression pancreatic cancer of the OGN gene, respectively, using the GEPIA database;
FIG. 3 shows the OGN gene expression levels in pancreatic cancer cells and pancreatic normal cells, wherein A is the expression level of OGN protein in para-carcinoma tissues and carcinoma tissues measured by Western Blot method, (. X.P <0.001, n = 4); b, detecting the expression level of the OGN gene in normal pancreatic cells HPDE6-C7 and pancreatic cancer cells BxPC-3 by using a Real-time PCR method (P is less than 0.01, n is not less than 3);
FIG. 4 is an immunohistochemical method for observing the expression of OGN genes in pancreatic cancer groups and paracancer groups in different pathological stages;
FIG. 5 shows the effect of OGN gene overexpression on pancreatic cancer cell activity, wherein A is successful plasmid transfection detected by Real-time PCR method; b is the absorbance of pancreatic cancer BxPC-3 cells with empty transfection and OGN gene overexpression measured at 570nm by using an MTT method, C is the absorbance of pancreatic cancer BxPC-3 cells with empty transfection and OGN gene overexpression measured at 450nm by using a CCK8 method, respectively, (. About.P <0.05,. About.P <0.01,. About.P <0.001, n = 5);
FIG. 6 shows the effect of OGN gene overexpression on pancreatic cancer cell proliferation, wherein A is the EdU method for detecting cell proliferation; b is the proportion of positive fluorescent cells detected by an EdU method ([ multiple ] P <0.001, n = 5);
FIG. 7 shows the effect of OGN overexpression on proliferation-associated genes, wherein A-D are the expression levels of Cyclin A2, cyclin B1, cyclin D1, PCNA genes in null-transfected and OGN gene overexpressed pancreatic cancer BxPC-3 cells (. About.p <0.01,. About.p <0.001, n = 8);
FIG. 8 shows the effect of OGN gene overexpression on pancreatic cancer apoptosis, wherein A is the apoptosis detected by Tunel method; b is the proportion of positive cells detected by the Tunel method ([ P ] 0.01, n = 8);
FIG. 9 shows the effect of OGN gene overexpression on pancreatic cancer apoptosis-related gene expression, wherein A-E are the expression levels of P21, P53, bax, bcl-2 and Bax/Bcl-2 in pancreatic cancer BxPC-3 cells transfected idly and overexpressing OGN genes (. P <0.05,. P <0.01,. P <0.001, n = 4-6), respectively;
fig. 10 is a graph of the effect of OGN gene overexpression on pancreatic cancer cell migration rate, where a is cell migration in the middle region between 24h and 48h, and B is the percentage of wound healing area of cells (× P <0.05, × P <0.01, n = 3);
FIG. 11 is a graph of the effect of OGN gene overexpression on pancreatic cancer cell invasion, where A is the number of cells migrating in a field of view observed with a microscope; b is the average value of the cell number counted by randomly taking six fields in the control group and the OGN group, and statistics is carried out (× P <0.01, n = 4);
FIG. 12 is a correlation analysis of the expression level of the OGN gene with the ID4 in pancreatic cancer;
FIG. 13 shows the expression level of ID4 in pancreatic cancer cells, wherein A is the RNA expression level of ID4 in two groups of cells measured by Real-timePCR method (. About.P <0.01, n = 8); b is protein expression level of ID4 in two groups of cells detected by a Westernblot method (. About.P <0.05,. About.P <0.01, n = 4);
FIG. 14 is the expression level of the ID4 gene in OGN-overexpressing pancreatic cancer cells, wherein A is the RNA expression level of ID4 in both groups of cells measured by Real-timePCR method,. P <0.05, n =8; b Westernblot method for detecting the protein expression level of ID4 in two groups of cells (. About.P <0.05, n = 4).
Detailed Description
The invention provides application of an OGN gene as a biomarker in preparation of a kit for diagnosing pancreatic cancer.
In the invention, the kit comprises a primer group for detecting the OGN gene, wherein the primer group comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2; the method comprises the following specific steps:
CTACTTGGACCATAATGCCCTG(SEQ ID NO.1)；
GTCCCGGATGTAACTGGTGTC(SEQ ID NO.2)。
in the present invention, the kit further comprises a reagent for detecting the OGN gene, preferably a reagent used in the Real-time PCR detection process. The invention has no special limitation on the type and manufacturer of the specific reagent, and the detection of the OGN gene can be realized by adopting the conventional Real-time PCR detection reagent.
The invention also provides application of a reagent for over-expressing OGN genes in promoting proliferation, migration and invasion of pancreatic cancer cells and application of the reagent for over-expressing OGN genes in promoting inhibition of apoptosis of pancreatic cancer cells.
In the present invention, the agent for overexpressing an OGN gene comprises a recombinant vector for overexpressing an OGN gene; the invention has no special requirements on the specific type of the recombinant vector and the insertion site of the OGN gene, and can realize over-expression of the OGN gene in cells. The method for preparing the recombinant vector is not particularly limited in the present invention, and a conventional method for preparing a recombinant vector in the art may be used. In the specific implementation process of the invention, the recombinant vector is purchased from Beijing Yinqiao Shenzhou science and technology company, and the name is as follows: pCMV3-OGN-myc, obtained by inserting a total of 897bp of ORF region of the OGN gene into the vector pCMV3-C-myc plasmid. The specific method for transforming the cells by the recombinant vector is not particularly limited in the invention, and lipofectamine 2000 is preferably used for realizing transfection into the cells.
In the invention, the over-expression OGN gene can enhance the activity of pancreatic cancer cells, promote the proliferation, migration and invasion of the pancreatic cancer cells and inhibit apoptosis; the application of the over-expressed OGN gene has great significance in the aspects of pancreatic cancer cell culture, research on the performance of pancreatic cancer cells and the like; can provide research materials with better and more stable performance for scientific researchers.
The invention also provides application of the inhibitor of OGN gene expression in preparing a medicament for treating pancreatic cancer.
In the present invention, the inhibitor of OGN gene expression includes any substance capable of inhibiting OGN expression, preferably, the inhibitor of OGN gene expression includes siRNA with OGN gene as a target gene; further preferably, the sequence of the siRNA is shown as SEQ ID NO.3 and SEQ ID NO. 4; the method comprises the following specific steps:
S：5’-GCCAAGAUUAUGAGGAUAATT-3’(SEQ ID NO.3)；
AS:：5’-UUAUCCUCAUAAUCUUGGCTT-3’(SEQ ID NO.4)。
in the invention, the siRNA can inhibit the expression of OGN gene, reduce the activity of pancreatic cancer cells, inhibit the proliferation, migration and invasion of pancreatic cancer cells and promote apoptosis; can be used for preparing medicine for treating pancreatic cancer.
The invention also provides application of the OGN gene as a DNA binding inhibition factor 4 expression promoter. In the present invention, overexpression of the OGN gene can promote expression of DNA binding inhibitory factor 4 (hereinafter, abbreviated as ID 4) in pancreatic cancer cells; the expression level of ID4 in pancreatic cancer cells with OGN gene over-expression is obviously increased; the pancreatic cancer cells are exemplified by pancreatic cancer BxPC-3 cells.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
The main instruments and reagents used in the examples of the invention were as follows:
the instrument comprises:
reagent:
SDS-PAGE gel rapid preparation kit (A + B), western primary-anti secondary antibody removal solution (strong alkalinity), beyoneceCL StarA, B solution, tubulin antibody (mouse monoclonal antibody), CCK-8 cell proliferation and cytotoxicity detection kit, MTT cell proliferation and cytotoxicity detection kit, TUNEL apoptosis detection kit and BeyonClick EdU-488 cell proliferation detection kit are all purchased from Shanghai Bintian Biotech Co., ltd.
Statistics of data referred to in the examples are expressed as mean ± standard error (mean ± SEM), comparisons were performed using t-test, statistical analysis using GraphPad Prism 6.0 software, P <0.05 as a criterion for significant difference.
Example 1
In order to detect whether the expression of the OGN gene is related to the onset of pancreatic cancer, the expression levels of the OGN gene in different pathological stages of cancer tissues and normal pancreatic tissues of pancreatic cancer patients and pancreatic cancer patients are analyzed by using a GEPIA online database; the specific method comprises the following steps: searching GEPIA in the browser, searching OGN in a search box, respectively selecting Boxplots, stage Plot and Survival Analysis, and inputting PAAD in the search box to obtain the images shown in the figures 1 and 2.
The analysis results found that the expression of OGN gene was significantly higher in pancreatic cancer tissues than in normal pancreatic tissues (A in FIG. 1) and that the expression level of OGN gene was highest in stage III pancreatic cancer patients (B in FIG. 1).
The difference between the overall survival rate and the disease-free survival rate of the OGN (one glass grog cancer) gene high-expression and low-expression pancreatic cancer patients is analyzed through a GEPIA (gel information association) online database, and the analysis result is shown in figure 2, which shows that the 5-year survival rate of the OGN gene high-expression patients is obviously lower than that of the OGN gene low-expression patients.
Example 2
In order to determine the difference of OGN gene expression of normal pancreatic tissue cells and pancreatic tissue cells, the normal pancreatic tissue cells are used as a control group, the OGN gene expression level is detected by a Westernblot and Real-time PCR method after the normal pancreatic tissue cells are cultured to the same state as the pancreatic tissue cells. The specific method comprises the following steps:
western blot method
Normal pancreatic tissue cells and pancreatic cancer tissue cells were lysed in RIPA buffer containing protease inhibitors and phosphatase inhibitors. After quantification, 80. Mu.g of protein samples were loaded on 10% or 12% SDS-PAGE gels and transferred onto nitrocellulose membranes. Blocking with 5% skim milk dissolved in PBS for 2h, and then incubating with primary antibody at 4 deg.C for 12h; tubulin is used as an internal reference. After incubation with the secondary antibody, development was performed with a developer.
Real-time PCR method
After normal pancreatic tissue cells and pancreatic cancer tissue cells are respectively cracked by Trizol reagent, RNA is extracted, the concentration is measured, after washing and purification, reverse transcription is carried out to obtain cDNA, real-time PCR is carried out by taking the cDNA as a template and SEQ ID NO.1 and SEQ ID NO.2 as primers, and the expression condition of OGN gene is measured. The method comprises the following specific steps:
(1) Extraction of RNA
Every 3X 10 6 Adding 1ml TRIzol reagent into each cell, scraping off the cells, transferring to a 1.5ml EP tube, and labeling; adding 0.2ml chloroform solution for extraction, shaking vigorously for 5min, centrifuging at 12000g,4 ℃ for 15min, sucking 300 mu l of supernatant, transferring to another 1.5ml EP tube, marking, adding 0.5ml isopropanol for precipitation, standing for 10min, centrifuging at 12000g,4 ℃ for 10min, discarding supernatant, adding 1ml 75% ethanol, swirling, centrifuging, discarding supernatant, drying at room temperature, adding 20 mu l DEPC water, repeatedly blowing and beating the precipitation part, dissolving RNA, transferring to 0.2ml EP tube, heating at 58 ℃ for 12min in a thermal cycler, and measuring the RNA concentration.
(2) Removal of DNA
2 EP tubes of 0.2ml are taken and marked, 2. Mu.l of RNA is used, 5. Mu.l of 5 XgDNA Eraser buffer and 2.5. Mu.g of DNAeraser are respectively added, DEPC water is added to 25. Mu.l, and the mixture is kept stand for 5min at room temperature.
(3) Reverse transcription
After removal of the DNA, 2.5. Mu.l of Primescript RT Enzyme Mix 1, 2.5. Mu.l of RT Primer Mix, 10. Mu.l of 5X Primescript Buffer 2, 10. Mu.l of DEPC water (reagents used from kit: primeScript) TM RT reagent Kit with gDNA Eraser, takara company), vortexed, centrifuged, and then incubated at 37 ℃ for 15min and 85 ℃ for 5s in a thermal cycler to obtain 50. Mu.l of cDNA.
(4) Preparation of PCR reaction solution
Reaction system: preparing PCR reaction liquid for amplifying OGN gene, adding 5 mul of TB green Premix Ex Taq II into each hole, respectively adding 0.5 mul of upstream and downstream primers, 1 mul of DNA template and 3 mul of DEPC water, totaling 10 mul, centrifuging, carrying out Real-time PCR, and recording and analyzing final data.
Amplification procedure for Real-time PCR:
two-step PCR amplification standard procedure: sample volume: 10 μ l
Step 1：95℃30s；
Step 2: PCR reaction (40 Cycles)
95℃5s，
60℃30s；
Step 3: dissolution profile.
The experimental results show that the expression level of OGN gene in pancreatic cancer tissue cells is obviously higher than that of pancreatic normal tissue cells (P < 0.01) as shown in A and B in figure 3.
In order to further detect the expression difference of OGN in different pathological stages of pancreatic cancer patients, pancreatic cancer tissues of the patients are used as a control group and are compared with pancreatic cancer tissue groups, and the expression level of OGN genes in different pathological stages of the pancreatic cancer patients is detected through an immunohistochemical experiment; the specific detection method comprises the following steps:
taking pancreatic cancer tissues and tissues beside the pancreatic cancer, carrying out wax penetration and embedding, and slicing the embedded samples. Transfer to polylysine-coated slides. Tissue sections were deparaffinized and hydrated. Inactivating endogenous enzyme with 3% hydrogen peroxide, adding into EDTA solution for antigen retrieval, adding PBS skimmed milk powder solution, and sealing. OGN primary anti-dilution antibody was added, HRP-labeled secondary anti-dilution antibody was added, and each wet-box was incubated at room temperature. And (3) after color development, microscopic examination, hematoxylin counterstaining and hydration, dehydrating in reagents with different concentration gradients, and observing after mounting.
The results are shown in fig. 4, in which OGN gene expression did not change significantly in the Paracancer (Cancer) group, whereas in the pancreatic Cancer (Cancer) group, OGN gene expression varied significantly with the progression of the pathological stage, with highest expression in the stage iii Cancer tissue.
In order to detect whether the OGN gene influences the activity of pancreatic cancer cells, pancreatic cancer BxPC-3 cells transfected by an empty plasmid are used as a control group, and compared with an OGN gene overexpression pancreatic cancer BxPC-3 cell group, firstly, the success of OGN overexpression is detected by a Real-time PCR method (the specific steps are consistent with the record of the Real-time PCR method), then, the cell activity is detected by an MTT method and a CCK8 method, and the cell proliferation and the cell apoptosis are detected by an EdU method and a Tunel method; the method comprises the following specific steps:
cell transfection:
when the cell density reached 90%, the cells were trypsinized and the resuspended cells were seeded into six-well plates and 96-well plates, respectively. And (3) when the cell density reaches 80-90%, replacing the double-antibody-free culture medium, adding an empty plasmid transfection solution and an OGN transfection solution respectively for transfection, replacing a complete culture solution after culturing for 5h, culturing for 48h, and performing subsequent experiments such as EdU, MTT, CCK8 or Real-time PCR and the like.
MTT assay
Control and OGN groups 10 wells of transfected cells were added to each well with 10 μ l of MTT solution and incubated for 4h. Add 100. Mu.l of Formazan solution to each well, incubate at room temperature for 4h, shake until the purple crystals dissolve. The absorbance was measured at a wavelength of 570nm using a microplate reader.
CCK8 method
Inoculating the cell suspension (100 mL/well) in a 96-well plate, pre-culturing the plate in an incubator at 37 ℃,5% 2 Under the conditions of (a). To each well was added 10mL of CCK-8 solution. The plates were incubated in an incubator for 4h. The absorbance at 460nm was measured with a microplate reader.
EdU method
The cells inoculated into the two wells of the well plate were incubated for 2h at 37 ℃ with EdU working solution. Fixation was performed with 4% paraformaldehyde. Washed with 3% BSA in PBS, 0.3% Trotpm X-100 in PBS, and incubated at room temperature for 12min to permeabilize the cells. Adding Click reaction solution, and incubating at room temperature in a dark place. Add 1 × Hoechst33342 and incubate at room temperature in the dark to stain the nuclei. Fluorescence detection was performed in a cytofluorescence detector.
Tunel method
Fixing cells with 4% paraformaldehyde, incubating, penetrating with penetrating fluid, covering the sample with Tunel reagent, and storing at 37 deg.C in dark for 60min. PBS and Hoechst33342 reagent were added and stored at room temperature in the dark to transfect the nuclei. Observation was performed with a fluorescence microscope.
Results of the experiment
Effect of OGN Gene overexpression on pancreatic cancer cell Activity
The results show that the OGN gene overexpression is successfully detected by a Real-time PCR method (A in figure 5), and the OGN gene overexpression can obviously enhance the pancreatic cancer cell activity (B-C in figure 5).
Effect of OGN overexpression on pancreatic cancer BxPC-3 cell proliferation
Furthermore, edU fluorescent staining was performed, and the odn gene overexpression cell group had a significantly higher EdU-positive cell count ratio than the Control group (P < 0.001) as shown in fig. 6, as a result of counting the odu-positive cell count ratio between the two cell groups.
In order to detect whether the increase of pancreatic cancer cell proliferation through OGN gene overexpression is realized by up-regulating the expression of cell proliferation related genes, a Real-time PCR method is adopted to detect the expression conditions of cell cycle genes Cyclin A2, cyclin B1, cyclin D1 and cell proliferation genes PCNA. Experimental results show that the expression of proliferation related genes such as Cyclin A2, cyclin B1, cyclin D1, PCNA and the like in two groups of cells has obvious difference, and the expression of the genes in an OGN over-expression cell group is obviously higher than that of a Control group transfected by an empty plasmid (as shown in figure 7).
Effect of OGN overexpression on pancreatic cancer BxPC-3 apoptosis
To examine the effect of OGN overexpression on apoptosis, apoptosis was examined by Tunel. Tunel staining results (FIG. 8) indicated that OGN overexpression inhibited apoptosis in pancreatic cancer BxPC-3 cells (. About.P < 0.01).
The inhibition of pancreatic cancer cell apoptosis for detecting OGN overexpression is realized by regulating the expression of apoptosis-related genes. And detecting the expression of the OGN overexpression pancreatic cancer cell apoptosis related gene by adopting a Real-time PCR method. As shown in FIG. 9, the expression levels of p21, p53 and Bax/Bcl-2 were significantly lower in the experimental group than in the control group, and the expression levels of Bcl-2 and Bax were higher in the control group. The expression level of OGN gene in pancreatic cancer cells is higher than that of normal cells, and the over-expression of OGN has the effects of promoting proliferation and inhibiting apoptosis of pancreatic cancer cells.
In order to detect whether overexpression of the OGN gene affects the migration capacity of pancreatic cancer cells, a cell migration experiment is carried out; the method comprises the following specific steps:
cells in logarithmic growth phase were trypsinized to single cell suspension and plated in 12-well plates with a final total volume of 1mL of medium per well. After the cells grow well, a marker pen is used for drawing a transverse line behind the back of a 12-hole plate, the drawn cells are removed, then a fresh serum-free or low-serum (< 2%) culture medium is replaced, and the cells are placed into an incubator for culture. Cells were removed after 24, 48h, photographed under a mirror and counted using Image J software. The results are shown in fig. 10, where the migration rate of OGN-overexpressing group is significantly higher than that of the control group (fig. 10).
To test whether OGN gene overexpression would enhance the invasive potential of pancreatic cancer cells. Cell invasion experiments were performed; the method comprises the following specific steps:
the basement membrane and the matrix glue are hydrated for subsequent cell spreading. And (3) paving matrix glue, adding the prepared matrix glue into a transwell chamber, and incubating at 37 ℃. After the cell suspension is prepared, cells are inoculated, and after the cell culture is completed, fixation and staining are performed, and observation and counting are performed under a mirror.
As shown in FIG. 11, the number of cells migrated was significantly greater in the OGN gene-overexpressing group than in the empty transfected group (FIG. 11).
Example 3
From the above examples, it is known that the OGN Gene is a cancer-promoting Gene in pancreatic cancer, and whether OGN can promote the development of pancreatic cancer by controlling the expression of ID4 has not been reported so far, and in order to further examine the relationship between the OGN Gene and the pancreatic cancer, the correlation between the OGN Gene and the pancreatic cancer is predicted by using Multiple Gene Analysis in the GEPIA database. The results are shown in fig. 12, in which the expression of both is clearly and positively correlated with that of pancreatic cancer (fig. 12).
In order to detect whether the expression of the ID4 in the pancreatic cancer is increased, real-time PCR and Western blot experiments are respectively carried out to detect the expression of the ID4 of the normal ductal epithelium HPDE6-C7 cell and the pancreatic cancer BxPC-3 cell of the pancreas; the specific method is described in example 2; the primers for ID4 were as follows: CGATGAAGGCGGTGAGCC (SEQ ID NO. 5); CCAGGCTGTGGATCTTCGT (SEQ ID NO. 6).
As shown in FIG. 13, the expression of ID4 was significantly higher in BxPC-3 cells of pancreatic cancer than in HPDE6-C7 cells of pancreatic ductal epithelium (A and B in FIG. 13).
Furthermore, real-time PCR and Western blot experiments are carried out to detect the expression level of the OGN overexpression pancreatic cancer BxPC-3 cell ID 4. As shown in FIG. 14, the expression level of ID4 was significantly increased in BxPC-3 cells overexpressing OGN (A and B in FIG. 14).
As can be seen from the above examples, the expression of OGN gene in pancreatic cancer cells is significantly higher than that in pancreatic normal tissue cells; MTT and CCK8 method detection finds that the OGN gene over-expressed in pancreatic cancer BxPC-3 cells can obviously enhance the cell activity; edU and Tunel fluorescent detection shows that OGN gene overexpression can promote cell proliferation and inhibit cell apoptosis; real-time PCR experiments show that the OGN overexpression promotes cell proliferation and inhibits cell apoptosis by regulating and controlling the expression of cell proliferation and apoptosis related genes; cell migration and invasion experiments show that the cell migration and invasion capacity can be obviously enhanced by the over-expression of the OGN gene; in order to further explore the regulation mechanism of the OGN gene in the pancreatic cancer development, related regulatory molecules ID4 are determined, and Real-time PCR and Westernblot experiments show that the ID4 is increased in the pancreatic cancer cells and the OGN over-expression pancreatic cancer cells. Through the above examples, it was found that the OGN gene is a oncogene in pancreatic cancer, and ID4 is one of its downstream regulatory molecules; the OGN gene and ID4 may play an important role in the development of pancreatic cancer. The OGN can become an effective serum marker in future clinical pancreatic cancer diagnosis and treatment. Meanwhile, modulation of the expression level of OGN gene or ID4 may become an effective method for treating pancreatic cancer.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Jining medical college
Application of <120> OGN gene as biomarker in preparation of kit for diagnosing pancreatic cancer
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctacttggac cataatgccc tg 22
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtcccggatg taactggtgt c 21
<210> 3
<211> 21
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gccaagauua ugaggauaat t 21
<210> 4
<211> 21
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
uuauccucau aaucuuggct t 21
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgatgaaggc ggtgagcc 18
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ccaggctgtg gatcttcgt 19
Claims (4)
1. Application of a reagent for over-expressing OGN genes in preparation of a reagent for promoting proliferation, migration and invasion of pancreatic cancer cells, and is characterized in that the pancreatic cancer cells are pancreatic cancer BxPC-3 cells.
2. The use of claim 1, wherein the agent overexpressing the OGN gene comprises a recombinant vector for overexpressing the OGN gene.
3. The use according to claim 2, wherein the recombinant vector is a starting vector which is a pCMV3-C-myc plasmid.
4. Application of a reagent for over-expressing OGN genes in preparation of a reagent for inhibiting pancreatic cancer cell apoptosis is characterized in that pancreatic cancer cells are pancreatic cancer BxPC-3 cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111605537.7A CN114875135B (en) | 2021-12-25 | 2021-12-25 | Application of OGN gene as biomarker in preparation of kit for diagnosing pancreatic cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111605537.7A CN114875135B (en) | 2021-12-25 | 2021-12-25 | Application of OGN gene as biomarker in preparation of kit for diagnosing pancreatic cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114875135A CN114875135A (en) | 2022-08-09 |
| CN114875135B true CN114875135B (en) | 2023-01-10 |
Family
ID=82667130
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111605537.7A Active CN114875135B (en) | 2021-12-25 | 2021-12-25 | Application of OGN gene as biomarker in preparation of kit for diagnosing pancreatic cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114875135B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106456694A (en) * | 2013-12-20 | 2017-02-22 | 通用医疗公司 | Methods and assays relating to circulating tumor cells |
-
2021
- 2021-12-25 CN CN202111605537.7A patent/CN114875135B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106456694A (en) * | 2013-12-20 | 2017-02-22 | 通用医疗公司 | Methods and assays relating to circulating tumor cells |
Non-Patent Citations (2)
| Title |
|---|
| Proteins associated with pancreatic cancer survival in patients with resectable pancreatic ductal adenocarcinoma.;Ru等;《Laboratory investigation》;20141027;第95卷;43-55 * |
| Stromal galectin-1 expression is associated with long-term survival in resectable pancreatic ductal adenocarcinoma;Ru Chen等;《Cancer biology & therapy》;20120801;第13卷(第10期);899-907 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114875135A (en) | 2022-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhou et al. | Eukaryotic elongation factor 2 kinase promotes angiogenesis in hepatocellular carcinoma via PI3K/Akt and STAT3 | |
| Zhu et al. | S100A16 promotes cell proliferation and metastasis via AKT and ERK cell signaling pathways in human prostate cancer | |
| Li et al. | The lncRNA FEZF1-AS1 promotes the progression of colorectal cancer through regulating OTX1 and targeting miR-30a-5p | |
| Gong et al. | CCDC34 is up-regulated in bladder cancer and regulates bladder cancer cell proliferation, apoptosis and migration | |
| Wu et al. | Oncogene FOXK1 enhances invasion of colorectal carcinoma by inducing epithelial-mesenchymal transition | |
| Yuan et al. | Role of HOXB7 in regulation of progression and metastasis of human lung adenocarcinoma | |
| Xu et al. | The prognostic potential and carcinogenesis of long non-coding RNA TUG1 in human cholangiocarcinoma | |
| Jiang et al. | Galectin-1 gene silencing inhibits the activation and proliferation but induces the apoptosis of hepatic stellate cells from mice with liver fibrosis | |
| Kim et al. | E2F8 regulates the proliferation and invasion through epithelial-mesenchymal transition in cervical cancer | |
| Li et al. | The nutritional cytokine leptin promotes NSCLC by activating the PI3K/AKT and MAPK/ERK pathways in NSCLC cells in a paracrine manner | |
| CN114042072B (en) | New application of STM2457 | |
| Liu et al. | Upregulation of TRPM8 can promote the colon cancer liver metastasis through mediating Akt/GSK‐3 signal pathway | |
| Wang et al. | Long non-coding RNA TP73-AS1 promotes pancreatic cancer growth and metastasis through miRNA-128-3p/GOLM1 axis | |
| Ma et al. | AGR2 promotes the proliferation, migration and regulates epithelial-mesenchymal transition in salivary adenoid cystic carcinoma | |
| Li et al. | Reduction of TIP30 correlates with poor prognosis of gastric cancer patients and its restoration drastically inhibits tumor growth and metastasis | |
| Zhang et al. | circFCHO2 promotes gastric cancer progression by activating the JAK1/STAT3 pathway via sponging miR-194-5p | |
| Liu et al. | MicroRNA-30a-3p functions as a tumor suppressor in renal cell carcinoma by targeting WNT2 | |
| Yejia et al. | circRNA_0006470 promotes the proliferation and migration of gastric cancer cells by functioning as a sponge of miR-27b-3p. | |
| Abudoukerimu et al. | HIF-1α regulates the progression of cervical cancer by targeting YAP/TAZ | |
| Xia et al. | Proteasome subunit alpha type 7 promotes proliferation and metastasis of gastric cancer through MAPK signaling pathway | |
| Luo et al. | MiR-22-3p regulates the proliferation and invasion of Wilms' tumor cells by targeting AKT3. | |
| Sumida et al. | Targeting Id1 reduces proliferation and invasion in aggressive human salivary gland cancer cells | |
| He et al. | Harmine suppresses breast cancer cell migration and invasion by regulating TAZ-mediated epithelial-mesenchymal transition | |
| Zhu et al. | Jab1 promotes glioma cell proliferation by regulating Siah1/β-catenin pathway | |
| Zheng et al. | R-spondin2 suppresses the progression of hepatocellular carcinoma via MAPK signaling pathway |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |