CN114874956A

CN114874956A - Yorkshiraia rekinsonii strain GXAS49-I and application thereof

Info

Publication number: CN114874956A
Application number: CN202210708619.2A
Authority: CN
Inventors: 房文霞; 汪斌; 徐艺珈; 李有志; 金城; 祁艳华; 覃启剑
Original assignee: Guangxi Academy of Sciences
Current assignee: Guangxi Academy of Sciences
Priority date: 2022-06-21
Filing date: 2022-06-21
Publication date: 2022-08-09
Anticipated expiration: 2042-06-21
Also published as: CN114874956B

Abstract

The invention relates to the technical field of microorganisms, and particularly relates to a Klebsiella reinhardtii GXAS49-I and application thereof. The bacterium Yokenella regensburgi GXAS49-I has heavy metal adsorption effect and has a collection number of GDMCC No. 62497. The strain GXAS49-I can efficiently adsorb heavy metals of lead, copper and cadmium in soil or water, so that the strain can be used for preparing a soil remediation agent. Meanwhile, the strain GXAS49-I also has good ammonia production capacity, can produce indoleacetic acid and has a growth promoting effect on plant growth, so that the invention also provides application of the strain GXAS49-I in microbial fertilizers.

Description

Yorkshiraia rekinsonii strain GXAS49-I and application thereof

[ technical field ] A method for producing a semiconductor device

The invention relates to the technical field of microorganisms, in particular to a Klebsiella reinhardtii strain GXAS49-I and application thereof.

[ background of the invention ]

With the rapid development of industrialization and the further opening of natural resources in China, heavy metal pollution in the ecological environment is becoming more and more serious. The heavy metal pollution mainly comprises representative heavy metal ions such as copper, cadmium, lead, mercury, hexavalent chromium and the like, has continuous toxicity and biological degradability, and can be accumulated continuously along with a food chain to enter a human body to cause various diseases. The pollution of copper mainly comes from organic fertilizers applied to mining industry and farmlands, and a large amount of copper elements contained in soil and ores are affected by rainwater washing or surface runoff, so that serious pollution can be further caused to underground water. The pollution of lead mainly comes from mining industry and metal processing industry, and the discharge process of waste slag and waste water generated in industrial production can cause pollution to soil and underground water. Cadmium is an element with prominent toxicity in heavy metals, and the regulation of the cadmium element in the irrigation water quality standard is also strict. However, since the 80 s of the last century, the problem of excessive cadmium content in sewage from irrigation has not been solved, and as the economy of China is further developed and the water resource supply is increasingly tense, sewage as a precious water resource is also more and more widely applied to agricultural irrigation. In the actual sewage treatment, the average metal removal rate of a sewage plant is generally lower than 60% due to the low metal concentration in the inlet sewage. Therefore, the method for further optimizing the treatment and remediation of heavy metal sewage and soil is urgent.

The means of removing or reducing heavy metal contamination from contaminated water sources can be divided into physical, chemical and biological methods. Physical and chemical methods include membrane techniques, filtration, ion exchange, activated carbon adsorption, electrochemical treatment, chemical precipitation, evaporation, and the like. However, when the metal ions in the aqueous solution are at a low concentration, chemical precipitation and electrochemical treatment have little effect, and a large amount of sludge which is difficult to treat is also generated, and ion exchange, membrane technology and activated carbon adsorption processes are expensive in treating low-concentration heavy metal wastewater and difficult to use on a large scale.

Because the physical method and the chemical method have poor effect on the treatment of the low-concentration heavy metal wastewater, in recent years, the biological method is gradually an ideal choice for treating the high-volume low-concentration heavy metal composite wastewater. Biological methods for removing heavy metals comprise bioadsorption and biomineralization, wherein the bioadsorption can utilize natural materials from various biological sources to naturally adsorb dissolved metal ions, so that the effect of biologically enriching the metal ions is achieved; biomineralization can produce heavy metal precipitates from specific metabolic pathways of cells, thereby reducing the toxicity of heavy metals in the environment or easily restoring them to a non-toxic state. The characteristics of small energy consumption and no secondary pollution of the biological method make the biological method become a research hotspot in the field of heavy metal pollution.

At present, the research on the application of biomineralization to pollution removal mainly focuses on cadmium and lead, and the technology for removing copper pollution by using a biomineralization method has a plurality of defects. Because the source of copper pollution in the environment is different from that of heavy metal elements such as lead and the like, and the copper element is distributed in the areas such as farmlands, alluvial plains and the like along with the application of organic fertilizers and the scouring of surface runoff, the influence of the copper pollution on the growth of crops is widely higher than that of the elements such as lead and the like. On the other hand, cadmium and lead, although lower in the environment compared to copper, are more toxic, with cadmium having a more pronounced tendency to migrate downward under irrigation conditions, which would threaten soil and groundwater. Therefore, in the heavy metal pollution treatment of the environment, a pollution treatment method with a function of removing various heavy metals needs to be established by combining the characteristics of pollution degree, toxicity and the like of different heavy metal element accumulation.

In conclusion, based on the urgent need of treatment and soil remediation of various heavy metal pollution, the strain capable of mineralizing and removing copper ions and other heavy metals is obtained by screening, and the method is an important way for solving the current heavy metal pollution problem.

[ summary of the invention ]

In view of the above, the invention aims to provide a joker's reinhardtii strain GXAS49-I with the effects of adsorbing or removing heavy metals and promoting growth and application thereof.

In order to achieve the aim, the invention obtains a strain GXAS49-I of Yokenella regensburgii (Yokenella regensburgei) through screening, wherein the preservation number is GDMCC No.62497, and the preservation date is as follows: 30/5/2022, the preservation address is: the preservation unit of No. 59 building 5 of No. 100 college of the first Liehuo of Guangzhou city in China: guangdong province culture collection of microorganisms (GDMCC).

The bacterial strain GXAS49-I (Yokenella regensburgei) of the invention is derived from a soil sample obtained near the root of a banana tree, and bacterial strain identification is carried out on the screened bacterial strain through genome extraction, PCR amplification and sequencing to obtain a sequence with the length of 1354 bp. Homology sequence alignment analysis shows that the 16S rDNA sequence of the strain has 100% homology with the Yokenella regensburgii (Yokenella regensburgei), and the strain is classified as the genus Yokenella. The nucleotide sequence of 16S rDNA of the strain GXAS49-I of the Klebsiella reinhardbergii (Yokenella regensburgei) is shown in a sequence table.

The present invention also provides a soil remediation agent comprising, as an active ingredient, the bacterium johnsonia reinhardsburgi (Yokenella regensburgei) strain GXAS49-I of claim 1.

The invention also comprises a microbial inoculum containing the Yokenella regensburgii (Yokenella regensburgei) strain GXAS 49-I.

The invention also comprises application of the Yokenella regensburgii strain GXAS49-I or the heavy metal pollution remediation agent or the microbial inoculum in adsorption and/or removal of mineralized heavy metals.

Further, the heavy metal is copper and/or lead and/or cadmium.

The invention also comprises application of the strain GXAS49-I of the joker of legungrashiger (Yokenella regensburgei) in plant growth promotion, and is characterized in that the strain GXAS49-I of the joker of legungrashiger (Yokenella regensburgei) can produce growth hormone indoleacetic acid IAA and promote synthetic ammonia.

The invention also comprises a microbial fertilizer containing the Yokenella regensburgii strain GXAS 49-I.

The invention also provides a method for adsorbing and/or removing mineralized heavy metals by using the bacterial strain GXAS49-I of the Yokenella regensburgii, which comprises the following steps: inoculating the strain in LB liquid culture medium, culturing to OD600 value of 0.5-0.6 to obtain culture solution containing thallus, centrifuging, removing supernatant, centrifuging, re-suspending in water, centrifuging, removing supernatant, and adjusting OD ₆₀₀ The value is 0.9, and bacterial suspension is obtained; the bacterial suspension is then added to a solution containing heavy metals.

In summary, due to the adoption of the technical scheme, the invention has the beneficial effects that:

the adsorbent prepared by the Yokenella regensburgi strain GXAS49-I of the invention adsorbs metal ions in aqueous solution containing copper/cadmium/lead, and when the adsorption is carried out for 48 hours, the lead removal rate can reach 90.4%, and the copper and cadmium removal rates can reach 48.7% and 32.0% respectively. The microbial inoculum prepared by the Yokenella regensburgi strain GXAS49-I of the invention is adsorbed and mineralized under the culture condition of adding nutrient substances, and the removal rate of the strain to copper with the initial concentration of 40mg/L can reach more than 85 percent within 120 hours of culture; the lead removal rate of the lead with the initial concentration of 130mg/L can reach 58.2 percent; the cadmium removal rate of the initial concentration of 84mg/L can reach 36.72%. Meanwhile, the strain GXAS49-I also has good ammonia generating capacity, can generate indoleacetic acid and possibly has a growth promoting effect on plant growth. The Gikenella reinhardtii provided by the invention can be used for treating heavy metal pollution, wherein the effects of removing copper by mineralization and removing lead by adsorption are excellent, and meanwhile, the Gikenella reinhardtii also has certain effects of removing cadmium by mineralization and adsorption. Compared with physical and chemical methods, the method has the advantages of good treatment effect, no secondary pollution and the like. Meanwhile, the strain provided by the invention also has the potential of promoting the growth of plants. In conclusion, the strain GXAS49-I has wide application prospect in the fields of heavy metal polluted wastewater treatment and polluted soil remediation.

[ description of the drawings ]

FIG. 1: phylogenetic tree of strain GXAS49-I (A) and a photograph of a bacterial solution cultured in LB medium containing 100mg/L of copper sulfate (B).

FIG. 2: adsorption removal curve of GXAS49-I strain for heavy metal ions.

FIG. 3: removal curve of GXAS49-I strain for copper ion under culture condition.

FIG. 4: removal curve of GXAS49-I strain to lead ion under culture condition.

FIG. 5: removing curve of GXAS49-I strain to cadmium ion under culture condition.

FIG. 6: scanning Electron Microscope (SEM) of the strain GXAS49-I in a culture solution system of 0.63mM copper ions. FIG. A is a Scanning Electron Microscope (SEM) of bacterial cells of strain GXAS49-I in a culture medium system containing 0.63mM lead ions; FIG. B is a Scanning Electron Microscope (SEM) image (C) of cells of strain GXAS49-I in a culture medium system containing 0.63mM cadmium ion.

FIG. 7: ammonium chloride standard curve.

FIG. 8: IAA standard curve.

FIG. 9: photographs of the growth of the strain on LB plates at a copper concentration of 0-960 mg/L. (A) The growth picture of the strain on LB plate with lead concentration of 0-2340 mg/L; (B) photograph (C) of the strain grown on LB plate with a cadmium concentration of 0-426 mg/L.

[ detailed description ] embodiments

All of the features disclosed in this specification, or all of the steps in any method or process so disclosed, may be combined in any combination, except combinations of features and/or steps that are mutually exclusive.

Any feature disclosed in this specification (including any accompanying claims, abstract) is merely an example of a generic series of equivalent or similar features, unless explicitly described as such.

Heavy metal mother liquor:

copper mother liquor: 12.48g of copper sulfate pentahydrate is weighed and dissolved in 50mL of deionized water to prepare a copper sulfate mother liquor with the concentration of 159.61g/L (1M).

Lead mother liquor: 18.97g of lead acetate trihydrate were weighed out and dissolved in 50mL of deionized water to prepare a lead acetate mother liquor with a concentration of 325.29g/L (1M).

Cadmium mother liquor: 219.32g of cadmium chloride dihydrate are weighed and dissolved in 50mL of deionized water to prepare 183.32g/L (1M) of cadmium chloride mother liquor.

The media involved in the following examples are as follows:

LB liquid medium: 10g/L of peptone, 5g/L of yeast extract and 10g/L of sodium chloride.

LB plate: 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride and 15g/L of agar powder.

Example 1: screening and identification 1 of strain GXAS49-I of Yokenella regensburgei (Yokenella regensburgei), screening of strain

The method comprises the following specific steps:

(1) collecting soil sample from root of Musa basjoo of Tan Luo town of south-Guangxi, and shake culturing the separated different strains at 25 deg.C and 220r/min overnight to obtain activated strain;

(2) 0.1mL of the activated bacteria liquid obtained in the step (1) is inoculated into 20mL of LB liquid culture medium in each tube, only 20mL of LB liquid culture medium is added into a blank control, 100mg/L of Copper sulfate solution is added into each tube of culture medium, shaking culture is carried out in a shaking table for 24h and 48h under the conditions of 25 ℃ and 180r/min, and then the culture solution is observed by Graciso LH et al (coating mining bacteria: Converting toxin conjugates in stable single-atom coater. Sci adv.2021Apr 23; 7(17): eabd9210.) in a color contrast way, so as to screen out the strain which possibly has the Copper mineralization function.

(3) As shown in FIG. 1B, the selected strain was labeled GXAS49-I, and growth of the strain at a copper sulfate concentration of 100mg/L resulted in a change of color of LB liquid medium containing copper ions from green to orange and a slight yellowish brown mineralized precipitate, which did not occur when the strain was cultured without addition of copper ions, indicating that the strain GXAS49-I has the potential to transform copper ions, and thus, the strain GXAS49-I was identified in the next step.

2. Identification of strains

The method comprises the following specific steps:

(1) DNA extraction of the strains: a single colony of the strain GXAS49-I was inoculated into 5ml of LB medium and cultured for 16 hours, 3000g was centrifuged for 10 minutes, the supernatant was discarded, the precipitate was resuspended and washed with sterile water, 3000g was centrifuged for 10 minutes, and the supernatant was discarded. The pellet was resuspended in 1ml buffer (20mM Tris-HCl, pH 7.5,1.2M sorbitol, 10mM EDTA) and 50. mu.g zymolyase was added and incubated for 30 minutes at 30 ℃. Then, 100. mu.L of 10% SDS and 1ml of a mixture of phenol and chloroform isoamyl alcohol were added in this order, and after thoroughly mixing, 6000g of the mixture was centrifuged for 15 minutes to separate layers. The clear aqueous phase in the supernatant was transferred to a new tube, 5. mu.L of ribonuclease was added, and the temperature was maintained at 37 ℃ for 2 hours. 0.5mL of phenol-chloroform was added, mixed well and centrifuged at 6000g for 15 minutes. The clear aqueous phase of the supernatant was transferred to a clean tube and one-tenth volume of 3M sodium acetate and 2 volumes of absolute ethanol were added. After precipitating at-20 ℃ for 2 hours, the precipitate was centrifuged at 6000g for 15 minutes, and the supernatant was discarded. After washing the precipitate with 70% ethanol 2 times, the DNA was air-dried at room temperature.

(2) Molecular identification of the strains: the extracted DNA was concentrated using nanodrop and diluted to an appropriate concentration for Polymerase Chain Reaction (PCR). The primers were 16s rRNA region universal primers 27F (AGAGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT), synthesized by Gnaphalium japonicum. The PCR reaction system was performed according to the instruction of PrimeSTAR HS (Premix) polymerase of Takara, and the reaction procedure was: pre-denaturation at 98 ℃ for 3min, then circulation, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 72 ℃ for 1min, 30 cycles in total, and finally extension at 72 ℃ for 10 min. The amplified product is separated by 1% agarose gel electrophoresis, the target fragment is recovered and purified by a DNA gel recovery kit and then sent to Jinweizhi company for sequencing, and the sequencing primer is 27F/1492R. The sequencing results were aligned on-line in the NCBI nucleic acid database using BLAST analysis program, and the results showed that the strain had 100% homology to the bacterial Yokenella regensburgei 16S rRNA sequence, the alignment was performed in the NCBI database using BLAST, the nucleotide sequence of the strain GXAS49-I is shown in the sequence Listing, and the position of the strain on the phylogenetic tree is shown in FIG. 1A.

(3) The strain GXAS49-I is identified as Yokenella regensburgei and belongs to the genus Johnsonia, and the bacterial colony of the strain GXAS49-I in LB solid medium is characterized in that: the bacteria were smooth, round, yellow-white (fig. 9A).

The identified strain GXAS49-I of Yokenella regensburgii has been deposited at 30.5.2022 in Guangdong province culture Collection (GDMCC) with accession number GDMCC No.62497 and accession number: no. 59 building 5 of No. 100 college of the first furious Zhonglu of Guangzhou, China.

Example 2: adsorption performance of johnsonia regensburgii GXAS49-I strain

The method comprises the following specific steps:

1. preparation of suspension of johnsonia regensburgii GXAS49-I bacteria

(1) Picking out a single colony of the Klebsiella reingensburgi GXAS49-I, inoculating the single colony into a 50mL centrifuge tube added with 35mL LB liquid medium, and culturing to OD ₆₀₀ The value is between 0.5 and 0.6, and a culture solution containing the thalli is obtained;

(2) centrifuging the culture solution obtained in the step (1) for 10min at 5000r/min, removing the supernatant, washing the precipitated thallus with pure water, centrifuging for 10min at 5000r/min, removing the supernatant, and respectively adjusting the concentration of the bacterial suspension to OD by using pure water ₆₀₀ A value of 0.9 gave a bacterial suspension.

2. Adding copper, lead and cadmium mother liquor into the Raffinsburg obtained in step 1 according to the addition amount of final concentration of 0.63mM (copper concentration is about 40mg/L, lead concentration is about 130mg/L and cadmium concentration is about 80mg/L)Concentration OD of Yokenella regensburgi GXAS49-I ₆₀₀ Among the bacterial suspensions having a value of 0.9.

Respectively mixing the above suspensions OD ₆₀₀ The reaction system with the value of 0.9 is subjected to adsorption reaction by taking GXAS49-I bacteria as an adsorbent under the condition of 180r/min at 28 ℃, after 24h and 48h of reaction, each reaction system solution is sampled and centrifuged, quantitative supernatant is taken and diluted to a certain multiple by pure water, the concentration of corresponding metal ions in the supernatant is measured by an atomic absorption spectrometer, and the GXAS49-I strain is calculated as a pure adsorbent according to the measurement result, so that the adsorption removal rate of the corresponding metal ions is realized when no exogenous nutrient substance exists.

The result of the adsorption removal rate measurement is shown in FIG. 2, and through detection, when the bacterial strain provided by the invention is used as an adsorbent to perform an adsorption reaction for 48 hours, the Yokenella regensburgi GXAS49-I of the Klebsiella reingensburgii is detected to be in OD ₆₀₀ The removal rate of copper in the adsorption reaction can reach 49% when the value is 0.9, and GXAS49-I bacterial suspension is in OD ₆₀₀ The adsorption reaction lead removal rate can reach 90% when the value is 0.9, and GXAS49-I bacterial suspension is in OD ₆₀₀ The adsorption reaction cadmium removal rate at a value of 0.9 was about 32%. The adsorption reaction of the metal ions is carried out in a system without adding exogenous nutrient substances, so the measured removal rate of the metal ions is the adsorption removal rate of the GXAS49-I strain. The measurement result shows that thalli of the GXAS49-I strain have certain adsorption effect on copper/lead/cadmium metal ions, wherein the GXAS49-I strain has high adsorption efficiency on lead and copper, and relatively poor adsorption efficiency on cadmium.

The about-kefir strain claimed by the invention can adsorb different types of heavy metals, and can be used as a heavy metal adsorbent for treating and repairing heavy metal polluted water and soil environments.

Example 3: mineralization and adsorption performance of johnstonia reinhardsburgi GXAS49-I strain

Preparing strain into bacterial suspension with LB liquid culture medium, and adjusting OD ₆₀₀ 0.6, adding 5% of the total weight of the extract into 15mL LB culture solution system containing 0.63mM copper/lead, performing shake culture at 28 deg.C and 180r/min, and periodically samplingAnd (4) determining the concentration of the corresponding heavy metal ions in the solution.

The concentration of copper/lead/cadmium is measured by an atomic absorption spectrometer, each culture liquid system solution is sampled and centrifuged, quantitative supernatant is taken and diluted by a certain multiple by pure water, the concentration of lead/copper/cadmium is measured by the atomic absorption spectrometer, and the removal rate of corresponding metal ions when the GXAS49-I strain is propagated, mineralized and adsorbed by using exogenous nutrient substances is calculated according to the measurement result.

The results of measurement of the change in the concentration of metal ions and the removal rate of the culture system are shown in FIGS. 3, 4 and 5, in which the removal rate of added heavy metals by the strain GXAS49-I gradually increases as the concentration of the corresponding metal ions in the culture solution initially decreases with the lapse of time in the culture system. At 48h, the removal rates of copper and lead reach 85% and 38%, respectively. In the culture solution system containing copper, the removal rate of copper reaches a peak value at 48h, and then the GXAS49-I strain shows slight desorption effect on copper, but the removal rate of copper is basically maintained to be more than 75%. In a culture solution system containing lead, the lead removal rate reaches about 40% at 48h, the lead removal rate of the strain GXAS49-I is increased by nearly 20% in the subsequent 24h, and the lead removal rate of the strain GXAS49-I is basically maintained at more than 55% at 120h of culture. In a culture solution system containing cadmium, the removal rate of the GXAS49-I strain to cadmium is gradually increased along with the increase of the culture time, but the increase amplitude is smaller than the removal rate of copper/lead, and finally the removal rate of the strain to cadmium reaches about 36 percent after 120 hours of culture.

The above experiment for measuring the removal rate of metal ions was carried out in a culture solution system containing exogenous nutrient components, and unlike example 2, the bacterial strain after the addition of the microbial inoculum can grow and propagate by using the nutrient substances in the system, thereby accumulating the amount of the bacteria subjected to the adsorption reaction. Meanwhile, the strain GXAS49-I can also utilize nutrients in the system to carry out biomineralization reaction to convert soluble heavy metal ions into metal salt precipitates, for example, as shown in FIG. 6(A-C) which is a result of SEM observation of bacteria in a culture solution system containing corresponding metal ions, a concentrated salt precipitation zone (a bright spot block) still exists in a bacteria sample which is shot in FIG. 6A, B, C and is washed by deionized water, which shows that the GXAS49-I strain generates insoluble precipitates through the biomineralization process. In the adsorption experiment of comparative example 2, the biomineralization effect greatly improves the removal rate of the strain GXAS49-I on copper ions, but the removal rate on cadmium ions is not obviously improved, and the removal rate on lead ions is lower than 90% in example 2, which shows that the mineralization efficiency is lower than the adsorption efficiency in the removal process of lead/cadmium ions by the strain GXAS 49-I. The results show that the Yokenella regensburg GXAS49-I strain has biomineralization effect on copper/lead/cadmium ions, can remove heavy metals in a solution by converting metals from ionic states into insoluble metal salts, and can improve the removal rate of the GXAS49-I strain on copper to be about 85%.

The Yorkshire strain claimed by the invention can efficiently adsorb and mineralize different types of heavy metals, and can be used for treating and repairing heavy metal polluted water and soil environments.

Example 4

Growth promoting properties of the strain Yokenella regensburgi GXAS49-I

The method for quantitatively detecting the ammonia produced by the strains comprises the following steps:

inoculating the strain into 1% peptone water solution, culturing for 72h, collecting 1mL supernatant, adding 1mL Na's reagent (7.5g KOH dissolved in 25mL ultrapure water, 2.5g KI dissolved in water, and adding HgCl ₂ To HgCl ₂ Insoluble, the solution was dark yellow, then KOH solution was slowly added and made up to 50mL) and 8mL sterile water, OD was measured at 450nm and ammonia production was calculated from the standard curve of ammonium chloride (fig. 7).

The method for quantitatively testing IAA yield of the strain comprises the following steps:

the strain was inoculated into PDB medium supplemented with 0.5% tryptophan and without tryptophan, cultured at the optimum temperature for 72 hours, centrifuged, and the supernatant was taken together with Salkowski reagent (51 mL of 0.5M FeCl was added) ₃ 49mL of 35% HClO solution) were mixed according to 1: after mixing in volume 1, the cells were dark-cultured for 30min, and OD at 530nm was measured to calculate the yield from the IAA standard curve (FIG. 8).

TABLE 1 IAA production of strains under different conditions

TABLE 2 Ammonia production by the strains

The results of the plant growth promotion test show that the strain Yokenella regensburgei GXAS49-I can produce 5.89 mu g/mL of IAA in the PDB medium added with tryptophan (Table 1) and the ammonia yield of the strain is up to 3.80mM/mL (Table 2), which indicates that the strain has weak capability of producing IAA but strong capability of producing ammonia.

Example 5

Heavy metal resistant property of johnsonia regensburgii GXAS49-I strain

The method comprises the following specific steps:

(1) the bacterial suspension was adjusted to OD 49-I based on the suspension of the bacterium Yokenella regensburgei strain GXAS49-I obtained in step 1 of example 2 ₆₀₀ The value was 0.7.

(2) Sucking 2 mu L of the bacterial suspension obtained in the step (1) to spot on a LB flat plate with set heavy metal (copper/cadmium/lead) concentration gradients, repeatedly spotting each concentration gradient for 6 times, and observing the growth condition after culturing at 28 ℃ for 48 hours.

The strain Yokenella regensburgi GXAS49-I is cultured on an LB plate of heavy metal (copper/cadmium/lead) for 48h to grow as shown in figure 9, and the maximum copper concentration of the strain GXAS49-I for normal growth is kept to be about 480mg/L (figure 9A); the maximum lead concentration was 1560mg/L (FIG. 9B); the maximum cadmium concentration was 142mg/L (FIG. 9C). Therefore, the resistance of the GXAS49-I strain to copper and lead is obviously better than that of the strain to cadmium, and meanwhile, the GXAS49-I strain can keep stable and normal growth at the concentration of heavy metal (copper/lead/cadmium) ions of 100mg/L, which proves that the strain can be widely applied to adsorption removal of the heavy metal (copper/lead/cadmium) ions in a wastewater environment.

The results show that the bacterial strain Yokenella regensburg GXAS49-I is adopted in the copper/cadmium/lead solution as the adsorbent and the microbial inoculum for use, and the adsorption and mineralization tests are respectively carried out for 48h and 120h, so that the bacterial strain can be finally proved to be capable of greatly reducing the content of soluble heavy metals in the solution, and the condition of secondary pollution in the heavy metal pollution wastewater treatment process is avoided. Meanwhile, the strain is found to have a certain plant growth promoting effect, which has positive significance for heavy metal pollution treatment and environmental remediation of soil.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Claims

1. Johnstonia reineckii (Yokenella regensburgei) strain GXAS49-I with deposit number GDMCC No.62497, deposit date: 30/5/2022, the preservation address is: the preservation unit of No. 59 building 5 of No. 100 college of the first Liehuo of Guangzhou city in China: guangdong province culture Collection of microorganisms (GDMCC).

2. A soil remediation agent characterised in that the active ingredient comprises the bacterium johnsonia reinhardsburgi (Yokenella regensburgii) strain GXAS49-I of claim 1.

3. A microbial agent comprising the johnsonia reineckii (Yokenella regensburgei) strain GXAS49-I of claim 1.

4. Use of the johnsonnera reinhardtii strain GXAS49-I according to claim 1 or the heavy metal pollution remediation agent according to claim 2 or the microbial inoculum according to claim 3 for adsorbing and/or removing mineralized heavy metals.

5. Use according to claim 4, wherein the heavy metal is copper and/or lead and/or cadmium.

6. The use of johnsonnera reinhardtii (Yokenella regensburgei) strain GXAS49-I for plant growth promotion according to claim 1, wherein said johnsonnera reinhardtii (Yokenella regensburgei) strain GXAS49-I can produce the growth hormone indoleacetic acid IAA and promote ammonia synthesis.

7. A microbial fertilizer comprising the johnsonella reinhardtii (Yokenella regensburgei) strain GXAS49-I of claim 1.

8. A method for adsorbing and/or removing heavy metals using the yokekuchikura reingensburgei (Yokenella regensburgei) strain GXAS49-I of claim 1, wherein the method comprises: inoculating the strain in LB liquid culture medium, and culturing to OD ₆₀₀ The value is 0.5-0.6, and culture solution containing thallus is obtained, and then centrifuged, supernatant removed, water resuspended, centrifuged again, supernatant removed, and OD adjusted ₆₀₀ The value is 0.9, and bacterial suspension is obtained; the bacterial suspension is then added to a solution containing heavy metals.