CN114874922B - Method for leaching metal in environmental pollutants by acidophilic metal-tolerant bacteria - Google Patents
Method for leaching metal in environmental pollutants by acidophilic metal-tolerant bacteria Download PDFInfo
- Publication number
- CN114874922B CN114874922B CN202210685455.6A CN202210685455A CN114874922B CN 114874922 B CN114874922 B CN 114874922B CN 202210685455 A CN202210685455 A CN 202210685455A CN 114874922 B CN114874922 B CN 114874922B
- Authority
- CN
- China
- Prior art keywords
- calcium
- leaching
- strain
- barcinensis
- talaromyces
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000002386 leaching Methods 0.000 title claims abstract description 86
- 238000000034 method Methods 0.000 title claims abstract description 27
- 239000003344 environmental pollutant Substances 0.000 title claims abstract description 14
- 241000894006 Bacteria Species 0.000 title abstract description 14
- 229910052751 metal Inorganic materials 0.000 title abstract description 9
- 239000002184 metal Substances 0.000 title abstract description 9
- OYPRJOBELJOOCE-UHFFFAOYSA-N Calcium Chemical compound [Ca] OYPRJOBELJOOCE-UHFFFAOYSA-N 0.000 claims abstract description 68
- 239000011575 calcium Substances 0.000 claims abstract description 68
- 229910052791 calcium Inorganic materials 0.000 claims abstract description 68
- 239000007788 liquid Substances 0.000 claims abstract description 60
- BHPQYMZQTOCNFJ-UHFFFAOYSA-N Calcium cation Chemical group [Ca+2] BHPQYMZQTOCNFJ-UHFFFAOYSA-N 0.000 claims abstract description 49
- 239000010881 fly ash Substances 0.000 claims abstract description 36
- 238000006243 chemical reaction Methods 0.000 claims abstract description 9
- 231100000719 pollutant Toxicity 0.000 claims abstract description 8
- 230000001580 bacterial effect Effects 0.000 claims description 49
- 229910001424 calcium ion Inorganic materials 0.000 claims description 47
- 239000000203 mixture Substances 0.000 claims description 5
- 238000004321 preservation Methods 0.000 claims description 5
- 230000000813 microbial effect Effects 0.000 claims description 4
- 238000009629 microbiological culture Methods 0.000 claims description 4
- 238000009472 formulation Methods 0.000 claims description 2
- 241000639104 Talaromyces barcinensis Species 0.000 abstract description 36
- 230000002378 acidificating effect Effects 0.000 abstract description 26
- 239000007787 solid Substances 0.000 abstract description 15
- 239000010865 sewage Substances 0.000 abstract description 4
- 239000010802 sludge Substances 0.000 abstract description 4
- 239000003153 chemical reaction reagent Substances 0.000 abstract description 3
- 150000002739 metals Chemical class 0.000 abstract description 2
- 230000000694 effects Effects 0.000 description 29
- 239000002609 medium Substances 0.000 description 19
- 239000000243 solution Substances 0.000 description 19
- QAOWNCQODCNURD-UHFFFAOYSA-N Sulfuric acid Chemical compound OS(O)(=O)=O QAOWNCQODCNURD-UHFFFAOYSA-N 0.000 description 18
- 239000001963 growth medium Substances 0.000 description 17
- 238000012258 culturing Methods 0.000 description 15
- 239000000047 product Substances 0.000 description 10
- 239000006228 supernatant Substances 0.000 description 9
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 8
- 238000001914 filtration Methods 0.000 description 8
- 238000007865 diluting Methods 0.000 description 7
- 238000003756 stirring Methods 0.000 description 7
- 239000012880 LB liquid culture medium Substances 0.000 description 6
- 244000005700 microbiome Species 0.000 description 6
- 239000000843 powder Substances 0.000 description 6
- 239000000356 contaminant Substances 0.000 description 5
- 240000004808 Saccharomyces cerevisiae Species 0.000 description 4
- 230000003321 amplification Effects 0.000 description 4
- 238000010790 dilution Methods 0.000 description 4
- 239000012895 dilution Substances 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 239000011780 sodium chloride Substances 0.000 description 4
- 239000012137 tryptone Substances 0.000 description 4
- 241001052560 Thallis Species 0.000 description 3
- AXCZMVOFGPJBDE-UHFFFAOYSA-L calcium dihydroxide Chemical compound [OH-].[OH-].[Ca+2] AXCZMVOFGPJBDE-UHFFFAOYSA-L 0.000 description 3
- 239000000920 calcium hydroxide Substances 0.000 description 3
- 229910001861 calcium hydroxide Inorganic materials 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- 239000000463 material Substances 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 241000605272 Acidithiobacillus thiooxidans Species 0.000 description 2
- 229920001817 Agar Polymers 0.000 description 2
- NLXLAEXVIDQMFP-UHFFFAOYSA-N Ammonia chloride Chemical compound [NH4+].[Cl-] NLXLAEXVIDQMFP-UHFFFAOYSA-N 0.000 description 2
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- XEEYBQQBJWHFJM-UHFFFAOYSA-N Iron Chemical compound [Fe] XEEYBQQBJWHFJM-UHFFFAOYSA-N 0.000 description 2
- 241000589902 Leptospira Species 0.000 description 2
- 239000008272 agar Substances 0.000 description 2
- 239000003795 chemical substances by application Substances 0.000 description 2
- 230000000052 comparative effect Effects 0.000 description 2
- 150000001875 compounds Chemical class 0.000 description 2
- 230000006378 damage Effects 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 239000000428 dust Substances 0.000 description 2
- 239000000499 gel Substances 0.000 description 2
- 239000002054 inoculum Substances 0.000 description 2
- 230000035484 reaction time Effects 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 241000605222 Acidithiobacillus ferrooxidans Species 0.000 description 1
- 102000007469 Actins Human genes 0.000 description 1
- 108010085238 Actins Proteins 0.000 description 1
- 208000019901 Anxiety disease Diseases 0.000 description 1
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 description 1
- 235000008733 Citrus aurantifolia Nutrition 0.000 description 1
- 206010011224 Cough Diseases 0.000 description 1
- JPVYNHNXODAKFH-UHFFFAOYSA-N Cu2+ Chemical compound [Cu+2] JPVYNHNXODAKFH-UHFFFAOYSA-N 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 206010013954 Dysphoria Diseases 0.000 description 1
- 208000000059 Dyspnea Diseases 0.000 description 1
- 206010013975 Dyspnoeas Diseases 0.000 description 1
- 206010018276 Gingival bleeding Diseases 0.000 description 1
- 206010018999 Haemorrhage subcutaneous Diseases 0.000 description 1
- 208000032843 Hemorrhage Diseases 0.000 description 1
- 208000001953 Hypotension Diseases 0.000 description 1
- 108091023242 Internal transcribed spacer Proteins 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 102000003505 Myosin Human genes 0.000 description 1
- 108060008487 Myosin Proteins 0.000 description 1
- 206010061876 Obstruction Diseases 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 206010033799 Paralysis Diseases 0.000 description 1
- 206010035664 Pneumonia Diseases 0.000 description 1
- XUIMIQQOPSSXEZ-UHFFFAOYSA-N Silicon Chemical compound [Si] XUIMIQQOPSSXEZ-UHFFFAOYSA-N 0.000 description 1
- 235000011941 Tilia x europaea Nutrition 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 229910052782 aluminium Inorganic materials 0.000 description 1
- XAGFODPZIPBFFR-UHFFFAOYSA-N aluminium Chemical compound [Al] XAGFODPZIPBFFR-UHFFFAOYSA-N 0.000 description 1
- 235000019270 ammonium chloride Nutrition 0.000 description 1
- 230000036506 anxiety Effects 0.000 description 1
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000006065 biodegradation reaction Methods 0.000 description 1
- 239000012620 biological material Substances 0.000 description 1
- 230000000740 bleeding effect Effects 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 210000000988 bone and bone Anatomy 0.000 description 1
- 229910052799 carbon Inorganic materials 0.000 description 1
- 230000001413 cellular effect Effects 0.000 description 1
- 229910052729 chemical element Inorganic materials 0.000 description 1
- 239000002734 clay mineral Substances 0.000 description 1
- 230000015271 coagulation Effects 0.000 description 1
- 238000005345 coagulation Methods 0.000 description 1
- 239000011248 coating agent Substances 0.000 description 1
- 238000000576 coating method Methods 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 229910001431 copper ion Inorganic materials 0.000 description 1
- 239000013078 crystal Substances 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 230000002500 effect on skin Effects 0.000 description 1
- 230000008451 emotion Effects 0.000 description 1
- 239000004744 fabric Substances 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 238000004108 freeze drying Methods 0.000 description 1
- 229910001385 heavy metal Inorganic materials 0.000 description 1
- 230000036543 hypotension Effects 0.000 description 1
- 238000009776 industrial production Methods 0.000 description 1
- 229910052742 iron Inorganic materials 0.000 description 1
- 239000004571 lime Substances 0.000 description 1
- 230000004060 metabolic process Effects 0.000 description 1
- 230000002906 microbiologic effect Effects 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000036651 mood Effects 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 210000004400 mucous membrane Anatomy 0.000 description 1
- 210000003205 muscle Anatomy 0.000 description 1
- 230000007830 nerve conduction Effects 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 230000003287 optical effect Effects 0.000 description 1
- 229910052760 oxygen Inorganic materials 0.000 description 1
- 239000001301 oxygen Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000004064 recycling Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 229910052710 silicon Inorganic materials 0.000 description 1
- 239000010703 silicon Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 230000004936 stimulating effect Effects 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 239000000725 suspension Substances 0.000 description 1
- 239000011573 trace mineral Substances 0.000 description 1
- 235000013619 trace mineral Nutrition 0.000 description 1
- 210000001835 viscera Anatomy 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C22—METALLURGY; FERROUS OR NON-FERROUS ALLOYS; TREATMENT OF ALLOYS OR NON-FERROUS METALS
- C22B—PRODUCTION AND REFINING OF METALS; PRETREATMENT OF RAW MATERIALS
- C22B26/00—Obtaining alkali, alkaline earth metals or magnesium
- C22B26/20—Obtaining alkaline earth metals or magnesium
-
- C—CHEMISTRY; METALLURGY
- C22—METALLURGY; FERROUS OR NON-FERROUS ALLOYS; TREATMENT OF ALLOYS OR NON-FERROUS METALS
- C22B—PRODUCTION AND REFINING OF METALS; PRETREATMENT OF RAW MATERIALS
- C22B3/00—Extraction of metal compounds from ores or concentrates by wet processes
- C22B3/18—Extraction of metal compounds from ores or concentrates by wet processes with the aid of microorganisms or enzymes, e.g. bacteria or algae
-
- C—CHEMISTRY; METALLURGY
- C22—METALLURGY; FERROUS OR NON-FERROUS ALLOYS; TREATMENT OF ALLOYS OR NON-FERROUS METALS
- C22B—PRODUCTION AND REFINING OF METALS; PRETREATMENT OF RAW MATERIALS
- C22B7/00—Working up raw materials other than ores, e.g. scrap, to produce non-ferrous metals and compounds thereof; Methods of a general interest or applied to the winning of more than two metals
- C22B7/006—Wet processes
-
- C—CHEMISTRY; METALLURGY
- C22—METALLURGY; FERROUS OR NON-FERROUS ALLOYS; TREATMENT OF ALLOYS OR NON-FERROUS METALS
- C22B—PRODUCTION AND REFINING OF METALS; PRETREATMENT OF RAW MATERIALS
- C22B7/00—Working up raw materials other than ores, e.g. scrap, to produce non-ferrous metals and compounds thereof; Methods of a general interest or applied to the winning of more than two metals
- C22B7/02—Working-up flue dust
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P10/00—Technologies related to metal processing
- Y02P10/20—Recycling
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Life Sciences & Earth Sciences (AREA)
- Environmental & Geological Engineering (AREA)
- Zoology (AREA)
- Geology (AREA)
- Manufacturing & Machinery (AREA)
- Materials Engineering (AREA)
- Mechanical Engineering (AREA)
- Metallurgy (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Mycology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Geochemistry & Mineralogy (AREA)
- Manufacture And Refinement Of Metals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for leaching metals in environmental pollutants by acidophilic metal-tolerant bacteria, belonging to the technical field of bioleaching. According to the invention, talaromyces barcinensis is separated from sludge of a Changzhou sewage treatment plant, the strain can grow normally under an acidic condition, the strain is added into a pollutant containing metallic calcium for reaction for 0-8 h, calcium contained in a system can be leached out in a calcium ion form, calcium in solid or liquid pollutant can be effectively treated, and the leaching rate of the calcium can reach 81.6%. The method has the advantages of simple treatment process, low requirements on environment and technology, mild reaction conditions, no high-concentration chemical reagent, effective leaching of calcium in the fly ash, and certain practical significance for industrial leaching of calcium.
Description
Technical Field
The invention relates to a method for leaching metals in environmental pollutants by acidophilic metal-tolerant bacteria, belonging to the technical field of bioleaching.
Background
Calcium is a common metal element in environmental pollutants, the simple substance of calcium is a silvery white crystal, the content of calcium in the crust is higher and is 3 percent, and the calcium is next to oxygen, silicon, aluminum and iron and is in the fifth position and mostly exists in a free state or a compound state.
Calcium is an important element in organisms. Calcium is the fifth largest element required by human body and accounts for 1.5% -2% of all elements of human body, and for human body, calcium is not a trace element but a major element. Calcium is involved in cellular activity, coagulation and also in nerve conduction. If the human body lacks calcium, the above-mentioned activity process can not be completed, so that the children are bad in mood and easy to cry; the adults are dysphoria, anxiety and poor emotion; gingival bleeding, subcutaneous bleeding and other symptoms. Calcium in animals participates not only in the composition of bones and teeth, but also in metabolism.
Some compounds of calcium may cause harm to the human body or the surrounding environment. For example, calcium hydroxide, which is a strong base, has a corrosive effect on skin and fabrics. Calcium hydroxide dust or suspension droplets have a stimulating effect on mucous membranes, can cause sneeze and cough, and can cause pneumonia when inhaled with lime dust. Overfeeding and absorption of calcium hydroxide by the human body can lead to dangerous symptoms such as dyspnea, internal bleeding, muscle paralysis, hypotension, obstruction of the myosin and actin systems, increase of the pH of the blood, and damage of viscera.
The fly ash contains a large amount of heavy metal calcium, and if the fly ash is directly discarded without treatment, the fly ash can cause serious influence on the environment and serious waste of resources. The leaching of the metal calcium mainly adopts a high-temperature roasting method and a chlormine leaching method. The high-temperature roasting method has high cost and heavy pollution, and basically has no popularization and application value. The ammonium chloride leaching process has good selectivity, but requires a large amount of chemical reagent (leaching agent) to be consumed and further research and improvement in recycling are required.
At present, the microbial method for leaching calcium is related to the following steps: the clay mineral microorganism leaches calcium ions, but the biological leaching of metallic calcium is still in the exploring test stage at present, the leaching efficiency is further required to be researched, and the high-efficiency strain which can adapt to industrial production is cultivated.
Disclosure of Invention
The invention aims to solve the technical problems of overcoming the defects in the prior art, and extracting an acidophilic Talaromyces barcinensis strain from sludge of a Changzhou sewage treatment plant, wherein the strain can be used for leaching metal calcium and provides an effective biodegradation method for leaching the metal calcium.
The first object of the present invention is to provide a strain Talaromyces barcinensis which has been deposited in China general microbiological culture collection center (CGMCC) with the accession number of CGMCC No.22430 and the deposited address of China academy of sciences microbiological culture Collection center (China) for 5 and 25 days.
A second object of the present invention is to provide a product containing said Talaromyces barcinensis.
In one embodiment, the product includes, but is not limited to, a microbial formulation.
In one embodiment, the Talaromyces barcinensis content of the product is not less than 1.0X10 7 cfu/mL or 1.0X10 7 cfu/g。
In one embodiment, the product further comprises leptospira ferrooxidans, thiobacillus ferrooxidans, or thiobacillus thiooxidans.
A third object of the present invention is to provide a method for culturing said Talaromyces barcinensis by inoculating said Talaromyces barcinensis into a culture medium and culturing the culture medium in a constant temperature environment of 100-140 rpm and 30-70℃until the culture medium reaches an OD 600 The value is 0.8-1.2.
A fourth object of the present invention is to provide a method for leaching calcium using microorganisms by leaching metallic calcium using the Talaromyces barcinensis, or reaction of the product in a system containing metallic calcium.
In one embodiment, the calcium-containing system includes, but is not limited to, a calcium-containing solid contaminant or a calcium-containing liquid contaminant.
Preferably, the calcium-containing solid contaminants comprise fly ash.
In one embodiment, the Talaromyces barcinensis is cultured to OD 600 And (3) adding 10-100 mL of bacterial liquid into each gram or each milliliter of pollutant to react, and leaching calcium in the pollutant.
In one embodiment, the strain Talaromyces barcinensis is cultured to OD at a pH of 2.5-3.5, 100-250 rpm, 30-35 ℃ 600 0.4 to 1.5.
Preferably, the strain is cultured to OD 600 0.9.
In one embodiment, the reaction time is from 0 to 8 hours.
Preferably, the reaction time is 1 to 8 hours.
A fifth object of the invention is to provide the Talaromyces barcinensis, or use of the product in leaching calcium.
In one embodiment, the Talaromyces barcinensis or the product is used to treat calcium-containing solid or liquid contaminants.
In one embodiment, the solid contaminants comprise fly ash.
The invention has the beneficial effects that: according to the invention, the Talaromyces barcinensis strain is separated from sludge of a Changzhou sewage treatment plant, can grow normally under an acidic condition, is added into a pollutant containing metallic calcium, can leach calcium contained in a system in a calcium ion form, and can effectively treat calcium in solid or liquid pollutants. The method has the advantages of simple treatment process, low requirements on environment and technology, mild reaction conditions, no high-concentration chemical reagent, effective leaching of calcium in the fly ash, and good application value.
Preservation of biological materials
The Talaromyces barcinensis provided by the invention is classified and named Talaromyces barcinensis, and is preserved in China general microbiological culture Collection center (CCTCC) with the preservation number of CCTCC No:22430, the preservation address is China academy of sciences microbiological institute.
Drawings
FIG. 1 is a graph showing the morphology of Talaromyces barcinensis colonies and the morphology of cells.
FIG. 2 is a Talaromyces barcinensis electrophoretogram; a is a product gel diagram obtained by amplification of the ITS primer pair, and B is a product gel diagram obtained by amplification of the NS primer pair.
Detailed Description
The present invention will now be described in detail with reference to the embodiments thereof as illustrated in the accompanying drawings, wherein like numerals refer to like features throughout. While specific embodiments of the invention are shown in the drawings, it should be understood that the invention may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the suitable methods, examples of materials, are set forth below for purposes of illustration only and are not intended to be limiting.
The term "strain" as used herein refers to a microorganism of a particular species having common characteristics. The terms "strain" and "cell" are used interchangeably herein unless indicated to the contrary.
The term "plate" as used herein refers to a plate culture medium, which is the most commonly used form of solid medium used to obtain pure culture of microorganisms, and which is a solid plane of the medium formed by cooling solidified solid medium in a sterile petri dish, often referred to simply as a culture plate, or plate.
The term "medium" as used herein refers to a medium comprising the chemical elements necessary for the growth of the microorganism together with at least one carbon source and one nitrogen source.
The LB liquid medium used in the following examples had a composition of 5 g.L -1 Yeast powder, 10 g.L -1 Tryptone, 10 g.L -1 Sodium chloride.
LB solid medium used in the following examples: 5 g.L -1 Yeast powder, 10 g.L -1 Tryptone, 10 g.L -1 Sodium chloride, 20g of agar per liter of medium was added.
The acidic LB solid medium used in the following examples: 5 g.L -1 Yeast powder, 10 g.L -1 Tryptone, 10 g.L -1 Sodium chloride, pH was adjusted to 3.0.
Acidic LB liquid medium used in the following examples: 5 g.L -1 Yeast powder, 10 g.L -1 Tryptone, 10 g.L -1 Sodium chloride, pH 3.0, was adjusted and 20g of agar was added per liter of medium.
(5) Calculating the leaching rate of calcium:
leaching rate= (c×a×v)/m.
C: the concentration of calcium ions; a: dilution factor; v: the volume of the bacterial liquid; m: the initial mass of calcium in the fly ash.
The initial mass of calcium in the fly ash used in the examples described below was determined spectrophotometrically and contained 0.2g of calcium per gram of fly ash, i.e. the mass fraction of calcium was 20%.
Example 1: screening of strains
(1) Taking a density of 0.027 g.mL from a Changzhou sewage treatment plant -1 10mL of sludge is put into 90mL of LB liquid culture medium, and is cultivated for 4 to 6 days at the temperature of between 30 and 35 ℃ at the speed of between 100 and 140 rpm;
(2) Inoculating the bacterial liquid in the step (1) into fresh 100mL LB liquid culture medium with the inoculum size of 5-10% of the volume ratio, and culturing for 4-6d at the temperature of 30-35 ℃ at the speed of 100-140 rpm;
(3) Inoculating the bacterial liquid in the step (2) into fresh 100mL LB liquid culture medium with the inoculum size of 5-10% of the volume ratio, and culturing for 4-6d at the temperature of 30-35 ℃ at the speed of 100-140 rpm;
(4) Adding 5 mu L of the bacterial liquid in the step (3) into a sterilized LB liquid culture medium, culturing for 4-6d in a shaking table at the temperature of 30-40 ℃ at 100-180 rpm, sucking 100 mu L of liquid by using a gun head, and coating on an acidic LB solid culture medium (pH 3.0);
(5) Culturing the acidic LB solid culture medium in an incubator at 37 ℃ for 1-2 d, observing the form of colonies, picking a small amount of strain on each colony in the acidic LB liquid culture medium, culturing for 4-6d, and inoculating on the acidic LB solid culture medium;
(6) Repeating the step (5) for a plurality of times until a single strain is obtained in each acidic LB solid medium;
(7) Selecting single strain from culture medium with single strain, inoculating new 100mL of acidic (pH 3) LB liquid culture medium, culturing at 100-140 rpm and 30-35deg.C for 4-6d, and measuring OD of bacterial liquid 600 The value reaches 0.9, and the required bacterial liquid is obtained.
Example 2: identification of strains
(1) The morphological characteristics of the strain were observed by an optical microscope, and the results are shown in FIG. 1, wherein the strain has spherical bacterial cells, circular bacterial colonies and opaque bacterial colonies.
(2) The strain of the strain is identified by 18SrDNA and ITS method from Shanghai biological engineering Co.Ltd. After amplification using ITS universal primer, the primer and amplification system were as follows: and (5) carrying out electrophoresis detection on the amplified bands. The electrophoresis pattern is shown in lane 4 of FIG. 2 (band size around 930 bp). The bands were sent to sequencing, the sequencing results (nucleotide sequence obtained by sequencing is shown as SEQ ID NO. 1) were aligned on BLAST, and the sequence was aligned to have a similarity of 99.82% with Talaromyces barcinensis, identified as Talaromyces barcinensis, and sent to the strain collection for preservation.
(1) The primers used were:
ITS1：TCCGTAGGTGAACCTGCGG(SEQ ID NO:1)，
ITS4：TCCTCCGCTTATTGATATGC(SEQ ID NO:2)；
(2) PCR amplification reaction system:
(3) PCR reaction conditions:
example 3: application of Talaromyces barcinensis bacteria in calcium leaching
1. Influence of different times of treatment of 10mL bacterial liquid on calcium leaching effect
(1) Inoculating the strain to acidic LB culture medium (pH 3), culturing at 100-140 rpm and 30-35 deg.C until the bacterial liquid OD 600 A value of 0.9;
(2) Respectively adding 1g of fly ash into 10mL of the bacterial liquid obtained in the step 1, stirring at a speed of 800r/min on a magnetic stirrer, and sucking primary samples for 2 hours, 4 hours and 8 hours;
(3) Centrifuging the sample liquid, and filtering the supernatant obtained by the high-speed low-temperature centrifuge to obtain a required clear and transparent leaching solution;
(4) The concentration of calcium ions in 1g of fly ash when various amounts of bacterial liquids were added was measured by ICP after diluting the leachate in (3) 3000 times, and the leaching rate of calcium was calculated.
As shown in Table 1, the concentration of calcium ions in the leachate after Talaromyces barcinensis treatment is remarkably increased, and the leaching rate of calcium ions can reach 15.54% when the leachate is treated for 1h by using 10mL of bacterial liquid.
TABLE 1 Leaching effect of calcium ions at different times by adding 10mL Talaromyces barcinensis bacteria solution
2. Effect of 20mL bacterial liquid treatment for different times on calcium leaching effect
(1) Inoculating the strain to acidic LB culture medium (pH 3), culturing at 100-140 rpm and 30-35 deg.C until the bacterial liquid OD 600 A value of 0.9;
(2) Respectively adding 1g of fly ash into 20mL of the bacterial liquid obtained in the step 1, stirring at a speed of 800r/min on a magnetic stirrer, and sucking primary samples for 2 hours, 4 hours and 8 hours;
(3) Centrifuging the sample liquid, and filtering the supernatant obtained by the high-speed low-temperature centrifuge to obtain a required clear and transparent leaching solution;
(4) Measuring the concentration of calcium ions in 1g of fly ash when different amounts of bacterial solutions are added by utilizing ICP after diluting the leaching solution in the step (3) by 3000 times;
(5) Calculating the leaching rate of calcium:
leaching rate= (c×a×v)/m.
C: the concentration of calcium ions; a: dilution factor; v: the volume of the bacterial liquid; m: the initial mass of calcium in the fly ash.
The initial mass of calcium in the fly ash was determined spectrophotometrically to be 20% of the mass of the fly ash (i.e., 0.2 g).
The results are shown in Table 2, and the concentration of calcium ions in the leaching solution treated by Talaromyces barcinensis is remarkably increased, and the leaching rate of calcium ions can reach 36.44% when the leaching solution is treated by 20mL of bacterial liquid for 2 hours.
TABLE 2 calcium ion concentration at various times by adding 20mL Talaromyces barcinensis bacteria solution
3. Effect of different times of 30mL bacterial liquid treatment on calcium leaching effect
(1) Inoculating the strain to acidic LB culture medium (pH 3), culturing at 100-140 rpm and 30-35 deg.C until the bacterial liquid OD 600 A value of 0.9;
(2) Respectively adding 1g of fly ash into 30mL of the bacterial liquid obtained in the step 1, stirring at a speed of 800r/min on a magnetic stirrer, and sucking primary samples for 2 hours, 4 hours and 8 hours;
(3) Centrifuging the sample liquid, and filtering the supernatant obtained by the high-speed low-temperature centrifuge to obtain a required clear and transparent leaching solution;
(4) The concentration of calcium ions in 1g of fly ash when various amounts of bacterial liquids were added was measured by ICP after diluting the leachate in (3) 3000 times, and the leaching rate of calcium was calculated.
As shown in Table 3, the concentration of calcium ions in the leachate after Talaromyces barcinensis treatment was significantly increased, and the leaching rate of calcium ions was 32.34% when treated with 30mL of the bacterial liquid for 2 hours.
TABLE 3 leaching effect of calcium ions by adding 30mL Talaromyces barcinensis bacteria solution for different times
4. Effect of different times of treatment of 40mL of bacterial liquid on calcium leaching effect
(1) The above-mentioned materials are mixedInoculating the strain to acidic LB culture medium (pH 3), culturing at 100-140 rpm and 30-35 deg.C until the bacterial liquid OD 600 A value of 0.9;
(2) Respectively adding 1g of fly ash into 40mL of the bacterial liquid obtained in the step 1, stirring at a speed of 800r/min on a magnetic stirrer, and sucking primary samples for 2 hours, 4 hours and 8 hours;
(3) Centrifuging the sample liquid, and filtering the supernatant obtained by the high-speed low-temperature centrifuge to obtain a required clear and transparent leaching solution;
(4) The concentration of calcium ions in 1g of fly ash when various amounts of bacterial liquids were added was measured by ICP after diluting the leachate in (3) 3000 times, and the leaching rate of calcium was calculated.
As shown in Table 4, the concentration of calcium ions in the leachate after Talaromyces barcinensis treatment was significantly increased, and the leaching rate of calcium ions was 54.48% when treated with 40mL of the bacterial liquid for 2 hours.
TABLE 4 leaching effect of calcium ions by adding 40mL Talaromyces barcinensis bacteria solution for different times
5. Influence of different times of treatment of 50mL bacterial liquid on calcium leaching effect
(1) Inoculating the strain to acidic LB culture medium (pH 3), culturing at 100-140 rpm and 30-35 deg.C until the bacterial liquid OD 600 A value of 0.9;
(2) Respectively adding 1g of fly ash into 50mL of the bacterial liquid obtained in the step 1, stirring at a speed of 800r/min on a magnetic stirrer, and sucking primary samples for 2 hours, 4 hours and 8 hours;
(3) Centrifuging the sample liquid, and filtering the supernatant obtained by the high-speed low-temperature centrifuge to obtain a required clear and transparent leaching solution;
(4) The concentration of calcium ions in 1g of fly ash when various amounts of bacterial liquids were added was measured by ICP after diluting the leachate in (3) 3000 times, and the leaching rate of calcium was calculated.
As shown in Table 5, the concentration of calcium ions in the leachate after Talaromyces barcinensis treatment was significantly increased, and the leaching rate of calcium ions was 52.3% when treated with 50mL of the bacterial liquid for 2 hours.
TABLE 5 leaching effect of calcium ions by adding 50mL Talaromyces barcinensis bacteria solution for different times
6. Effect of 60mL of bacterial liquid treatment for different times on calcium leaching effect
(1) Inoculating the strain to acidic LB culture medium (pH 3), culturing at 100-140 rpm and 30-35 deg.C until the bacterial liquid OD 600 A value of 0.9;
(2) Respectively adding 1g of fly ash into 60mL of the bacterial liquid obtained in the step 1, stirring at a speed of 800r/min on a magnetic stirrer, and sucking primary samples for 2 hours, 4 hours and 8 hours;
(3) Centrifuging the sample liquid, and filtering the supernatant obtained by the high-speed low-temperature centrifuge to obtain a required clear and transparent leaching solution;
(4) The concentration of calcium ions in 1g of fly ash when various amounts of bacterial liquids were added was measured by ICP after diluting the leachate in (3) 3000 times, and the leaching rate of calcium was calculated.
As shown in Table 6, the concentration of calcium ions in the leachate after Talaromyces barcinensis treatment was significantly increased, and the leaching rate of calcium ions was 81.6% when treated with 60mL of the bacterial liquid for 2 hours.
TABLE 6 leaching effect of calcium ions by adding 100mLTalaromyces barcinensis bacteria solution for different times
Example 4: method for leaching calcium
Inoculating Talaromyces barcinensis bacteria into an acidic LB culture medium, culturing at 100-140 rpm and 30-35 ℃ until the bacterial liquid OD 600 A value of 0.9; OD is taken 600 10-100 mL of bacterial liquid with the concentration of 0.9 is added with 1g of fly ash, and the mixture is stirred for 0-8 h at the speed of 800r/min on a magnetic stirrer, and after the reaction is finished, the concentration of calcium ions in the leaching liquid can be 4.08X10 -2 The leaching rate of copper ions can reach 81.6 percent.
Example 5: preparation of a product containing Talaromyces barcinensis
200 to 600 mu L of Talaromyces barcinensis is inoculated into 10 to 30mL of acidic LB liquid medium, activated for 2 to 3 generations at 30 ℃ and kept until Talaromyces barcinensis reaches 10 8 And (3) centrifuging at 8000rpm for 15min when the number of the viable bacteria is more than cfu/mL, removing the supernatant, taking the thalli, freeze-drying the thalli, and mixing the thalli with other bacterial powders to prepare the mixed microbial agent, wherein the other bacterial powders comprise other microorganisms with leached calcium, such as leptospira ferrooxidans, thiobacillus thiooxidans and the like.
Comparative example 1: leaching calcium by acid leaching
The specific operation steps are as follows:
(1) Sulfuric acid 10 to 100mL (10 mL, 20mL, 30mL, 40mL, 50mL, 100mL, respectively) was added to 1g of fly ash, and stirred at a speed of 800r/min on a magnetic stirrer.
(2) And (3) sucking the liquid in the step (1) for centrifugal operation, and filtering the supernatant fluid obtained after the high-speed low-temperature centrifugal machine to obtain the required clear and transparent leaching liquid.
(3) The concentration of calcium ions in 1g of fly ash when sulfuric acid was added in various amounts was measured by ICP from the leachate in (2).
(4) And (3) measuring the concentration of calcium ions in the step (3) at 0-8 h respectively.
(5) Calculating the leaching rate of calcium:
leaching rate = (C x a x V)/m,
c: the concentration of calcium ions; a: dilution factor; v: the volume of sulfuric acid; m: the initial mass of calcium in the fly ash.
TABLE 7 Leaching effect of calcium ions at various times by adding 10mL of sulfuric acid
TABLE 8 Leaching effect of calcium ions at various times by adding 20mL of sulfuric acid
TABLE 9 Leaching effect of calcium ions at various times by adding 30mL of sulfuric acid
TABLE 10 Leaching effect of calcium ions at various times by adding 40mL of sulfuric acid
TABLE 11 Leaching effect of calcium ions at various times by adding 50mL of sulfuric acid
TABLE 12 Leaching effect of calcium ions at different times by adding 100mL of sulfuric acid
Comparative example 2: leaching calcium using acidic LB culture medium
(1) Respectively adding 1g of fly ash into 10mL, 20mL, 30mL, 40mL, 50mL and 100mL of acidic (pH 3) LB culture medium, stirring at a speed of 800r/min on a magnetic stirrer, and sucking a sample for 2h, 4h and 8 h;
(2) Centrifuging the sample liquid, and filtering the supernatant obtained by the high-speed low-temperature centrifuge to obtain a required clear and transparent leaching solution;
(3) Measuring the concentration of calcium ions in 1g of fly ash when different amounts of bacterial solutions are added by utilizing ICP after diluting the leaching solution in the step (2) by 3000 times;
(4) Calculating the leaching rate of calcium:
leaching rate= (c×a×v)/m.
C: the concentration of calcium ions; a: dilution factor; v: the volume of the bacterial liquid; m: the initial mass of calcium in the fly ash.
The initial mass of calcium in the fly ash was determined spectrophotometrically to be 20% of the mass of the fly ash (i.e., 0.2 g).
TABLE 13 Leaching effect of calcium ions at different times by adding 10mL of acidic LB Medium
TABLE 14 Leaching effect of calcium ions at different times by adding 20mL of acidic LB Medium
TABLE 15 Leaching effect of calcium ions at different times by adding 30mL of acidic LB Medium
TABLE 16 Leaching effect of calcium ions at various times by adding 40mL of acidic LB Medium
TABLE 17 Leaching effect of calcium ions at different times by adding 50mL of acidic LB Medium
TABLE 18 Leaching effect of calcium ions at different times by adding 100mL of acidic LB Medium
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> Jiangsu Su academy of engineering
<120> method for leaching metal in environmental pollutants by acidophilic metal-tolerant bacteria
<130> GBAA220563A
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 546
<212> DNA
<213> Talaromyces barcinensis
<400> 1
cttaagttca gcgggtaact cctacctgat ccgaggtcaa ccgtaaaaga tttggtggtg 60
accaaccccc gcaggtccct cccgagcgag tgacaaagcc ccatgcgctc gaggacccga 120
cgggcgtcgc cgctgccttt ggggcaggtc cccgggggga ccacacccaa cacacaagcc 180
gtgcttgagg gcagaaatga cgctcggaca ggcatgcccc ccggaatgcc agggggcgca 240
atgtgcgttc aaagattcga tgattcacgg aattctgcaa ttcacattac ttatcgcatt 300
tcgctgcgtt cttcatcgat gccggaacca agagatccat tgttgaaagt tttgacaatt 360
ttctaggtac tcagacagcc ctatcttctt cagagttcag ggggtgcttc ggcgggcgcg 420
ggcccgggga caggcgtccc ccagcgacca ggtgacccca gtgggcccgc caaagcaaca 480
ggtattataa cggcacgggt gggaggttga gcccagaggg ctcgcactcg gtaatgatcc 540
ttccgc 546
Claims (8)
1. StrainTalaromyces barcinensisThe strain is preserved in China general microbiological culture collection center (CGMCC) with the preservation number of 22430 in the 5 th month of 2021.
2. A product comprising the strain of claim 1.
3. The product of claim 2, wherein the product includes, but is not limited to, a microbial formulation.
4. The product according to claim 2, wherein the strain is present in the productTalaromyces barcinensisThe content of (2) is not less than 1.0X10) 7 cfu/mL or 1.0X10 7 cfu/g。
5. A method for leaching calcium, characterized in that the method uses the method according to claim 1Talaromyces barcinensisOr the product of any one of claims 2-4 reacts in a system containing fly ash to leach out calcium ions.
6. The method according to claim 5, wherein the strain according to claim 1 is cultivated to OD 600 And (3) performing reaction on the bacterial liquid with the concentration of 0.4-1.5, and leaching calcium in the pollutants according to the amount of 10-100 mL of bacterial liquid added into each gram or each milliliter of pollutants.
7. The method according to claim 5, wherein the reaction is carried out at 25 to 35 ℃ and 100 to 250 rpm.
8. The strain of claim 1Talaromyces barcinensisOr the use of the product of any one of claims 2-4 for leaching calcium ions in fly ash.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210685455.6A CN114874922B (en) | 2022-06-15 | 2022-06-15 | Method for leaching metal in environmental pollutants by acidophilic metal-tolerant bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210685455.6A CN114874922B (en) | 2022-06-15 | 2022-06-15 | Method for leaching metal in environmental pollutants by acidophilic metal-tolerant bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114874922A CN114874922A (en) | 2022-08-09 |
| CN114874922B true CN114874922B (en) | 2023-05-26 |
Family
ID=82682258
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210685455.6A Active CN114874922B (en) | 2022-06-15 | 2022-06-15 | Method for leaching metal in environmental pollutants by acidophilic metal-tolerant bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114874922B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021029828A1 (en) * | 2019-08-15 | 2021-02-18 | Ngee Ann Polytechnic | Talaromyces pinophilus strain for producing cellulolytic enzymes |
| CN114644985A (en) * | 2022-02-22 | 2022-06-21 | 南京农业大学 | Filamentous fungi and method for recovering phosphorus in sludge by using same |
-
2022
- 2022-06-15 CN CN202210685455.6A patent/CN114874922B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021029828A1 (en) * | 2019-08-15 | 2021-02-18 | Ngee Ann Polytechnic | Talaromyces pinophilus strain for producing cellulolytic enzymes |
| CN114644985A (en) * | 2022-02-22 | 2022-06-21 | 南京农业大学 | Filamentous fungi and method for recovering phosphorus in sludge by using same |
Non-Patent Citations (4)
| Title |
|---|
| Talaromyces barcinensis, new species a new soil ascomycete;Yaguchi等;Transactions of the Mycological Society of Japan;第34卷(第1期);15-19 * |
| 北宗黄酒麦曲微生物的分离鉴定;任清;侯昌;;食品科学(04);77-82 * |
| 稻曲病菌厚垣孢子壁多糖的提取方法优选;王娜;任佐华;邓林伟;毛莹;陈娟芳;刘二明;;微生物学通报(09);1412-1417 * |
| 篮状菌属二个中国新记录种;孙剑秋等;微生物学通报;1-12 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114874922A (en) | 2022-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109810923B (en) | Aerobic denitrifying bacterium SLY2-21 for sewage denitrification and application thereof | |
| CN109576187B (en) | Cyanide degradation strain and method for degrading cyanide by using same | |
| CN109182192B (en) | Aerobic denitrifying bacterium HY3-2 and application thereof in sewage denitrification | |
| CN114703095B (en) | Pseudomonas adulthood and application thereof in field of sewage and wastewater purification | |
| CN108977370B (en) | Yeast for degrading phenol compounds and application thereof | |
| CN113373072B (en) | Heterotrophic nitrification aerobic denitrification fungus strain and separation method and application thereof | |
| US20240060153A1 (en) | Acidomyces Acidothermus and Its Application in Leaching Copper-containing Pollutants from Waste Circuit Boards | |
| CN110106123B (en) | Klebsiella strain Z3 and application thereof in reduction of hexavalent chromium ions | |
| CN114874922B (en) | Method for leaching metal in environmental pollutants by acidophilic metal-tolerant bacteria | |
| CN113373068A (en) | Method for leaching cobalt in PTA (pure terephthalic acid) residue by using aspergillus fumigatus acidophilus | |
| CN105670965B (en) | Strain with iron reduction capacity and application thereof | |
| CN111662847B (en) | Enterobacter antimonoroxide and application thereof | |
| CN112226388B (en) | Novel enzyme-producing species of propionibacteriaceae and application thereof | |
| CN111378596B (en) | Acid-resistant and facultative anaerobic manganese oxidizing bacterium and application thereof | |
| CN116064240A (en) | Method for leaching metal in environmental pollutants by utilizing microorganisms | |
| CN111484939A (en) | Separation and application of Microbeiella macroscopia | |
| CN115975881B (en) | Selenium volatilized achromobacter R39 and application thereof | |
| CN114149940B (en) | Achromobacter, microbial inoculum containing same and application thereof | |
| CN115074272B (en) | Biological desulfurization bacillus aryabhattai and application thereof | |
| CN116286394B (en) | Penicillium chrysogenum, microbial agent and application thereof | |
| CN114058554B (en) | Composting pseudomonas strain and application thereof | |
| CN113800652B (en) | Salt-tolerant aerobic denitrifying bacterium and application of coupling activated carbon thereof in strengthening water body pollution treatment | |
| CN113005063B (en) | Pseudomonas putida GY13 and application thereof in sewage treatment | |
| CN105316263A (en) | Cyanogen compound degrading bacterium and application thereof | |
| CN1297656C (en) | Method for degradation of linear alkyl benzene sodium sulfonate agrobacterium conn and treatment of water |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230920 Address after: No. 18 Wangcai Road, Luoxi Town, Xinbei District, Changzhou City, Jiangsu Province, 213001 (Business premises: No. 28 Wangtian Road, Luoxi Town, Xinbei District, Changzhou City; No. 6 Chishui Road, Luoxi Town, Xinbei District, Changzhou City) Patentee after: CHANGZHOU HOUDE RENEWABLE RESOURCES TECHNOLOGY Co.,Ltd. Address before: 213001, No. 1801, Wu Cheng Road, bell tower, Changzhou, Jiangsu Patentee before: JIANGSU University OF TECHNOLOGY |