CN114874174B - Chromans with anti-hepatitis B virus and coronavirus effects - Google Patents

Chromans with anti-hepatitis B virus and coronavirus effects Download PDF

Info

Publication number
CN114874174B
CN114874174B CN202210181117.9A CN202210181117A CN114874174B CN 114874174 B CN114874174 B CN 114874174B CN 202210181117 A CN202210181117 A CN 202210181117A CN 114874174 B CN114874174 B CN 114874174B
Authority
CN
China
Prior art keywords
methoxychroman
heptyl
nmr
hydrochloride
cdcl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210181117.9A
Other languages
Chinese (zh)
Other versions
CN114874174A (en
Inventor
黄相中
白溪山
李育晓
李艳红
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yunnan Hengyi Biotechnology Co ltd
Yunnan Minzu University
Original Assignee
Yunnan Hengyi Biotechnology Co ltd
Yunnan Minzu University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yunnan Hengyi Biotechnology Co ltd, Yunnan Minzu University filed Critical Yunnan Hengyi Biotechnology Co ltd
Priority to CN202210181117.9A priority Critical patent/CN114874174B/en
Publication of CN114874174A publication Critical patent/CN114874174A/en
Priority to PCT/CN2023/077694 priority patent/WO2023160586A1/en
Application granted granted Critical
Publication of CN114874174B publication Critical patent/CN114874174B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/74—Benzo[b]pyrans, hydrogenated in the carbocyclic ring
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Abstract

The present invention relates to chroman compounds with anti-hepatitis B virus and coronavirus, especially SARS-CoV-2, and their preparation process and application. In particular, the invention provides a preparation method and application of a compound shown in a formula I, which is used for preventing, treating or relieving hepatitis B virus infectious diseases and coronavirus infectious diseases. The compound of the present invention has relatively high activity of resisting hepatitis B virus and coronavirus, especially SARS-CoV-2, and is used as active component and pharmaceutically acceptable carrier or supplementary material in preparing medicine or medicine composition for resisting hepatitis B virus or coronavirus.

Description

Chromans with anti-hepatitis B virus and coronavirus effects
Technical Field
The invention relates to a chroman compound with anti-hepatitis B virus and coronavirus, in particular to application of the chroman compound in preparing anti-hepatitis B virus or anti-SARS-CoV-2 drugs.
Background
A virus is a tiny, structurally simple, non-cellular organism that has to be parasitic and replicated in living cells using DNA or RNA as genetic material (Woolhouse M, scott F, hudson Z, et al human viruses: discovery and emergence [ J ]. Philos Trans R Soc Lond B Biol Sci,2012,367: 2864-2871). Viral infection is classified into acute viral infection caused by influenza virus, novel coronapneumovirus (SARS-CoV-2) and the like, and persistent viral infection caused by Human Immunodeficiency Virus (HIV), hepatitis B Virus (HBV) and the like, according to the time that the virus stays in the body. The life cycle of a virus can be broadly divided into stages of invasion, biosynthesis, assembly and release, and once a sufficient number of viruses have been replicated, progeny viruses can lyse or destroy host cells, thereby infecting other cells. The high variability of viruses and the appearance of various novel viruses make the cure of virus infectious diseases always face serious challenges, and are always serious public safety and health problems seriously threatening human health. The drug is a powerful weapon against viral infection diseases, and hundreds of Antiviral drugs have been developed for 9 virus families (De Clercq E, li G.applied Antiviral drugs over the past 50 yes [ J ] Clin Microbiol Rev,2016,29:695-747; chaudhuri S, symons JA, deval J.Innovation and trends in the development and approval of Antiviral medicines:1987-2017and beyond [ J ] anti Res,2018, 155:76-88). However, the chronic refractory virus infection patients are easy to generate drug resistance after taking the drug for a long time, so that the original antiviral drug is invalid. More seriously, the further development of drug resistance poses serious challenges to the global public health system. Therefore, the development of novel broad-spectrum drug-resistant antiviral drugs is a long felt clinical need.
HBV is a hepadnavirus that causes acute or chronic hepatitis b in the body, and is capable of continuously replicating in the human body to cause liver lesions. At present, about 3.5% of people worldwide are infected with chronic hepatitis B virus, and chronic hepatitis B is very easy to develop into liver cirrhosis, liver failure and even liver cancer if not treated in time, and seriously threatens the health of human beings, and about 100 thousands of patients die each year due to chronic hepatitis B related diseases (Yuen MF, chen DS, dusheiko GM, et al, heat B virus infection [ J ]. Nat Rev Dis Primers, 2018, 4:18035). The most serious influence is exerted on China, and the domestic hepatitis B virus infectious agent accounts for about 9000 ten thousand and accounts for 1/4 of the world. Although the current oral anti-hepatitis B virus drugs can inhibit viral load and reduce liver related complications, lifetime treatment, high cost and potential toxicity are still major problems in the treatment process. The common anti-hepatitis B virus drugs mainly have two main categories, namely interferon and nucleoside analogues. As a natural defense of host cells against external stimuli such as viral pathogens, interferon (IFN) is a group of cytokines released from host cells that effectively promote cccDNA clearance or silencing. However, IFN treatment varies significantly from genotype to genotype virus infection and only about 10% of patients can achieve a sustained viral response. Nucleoside analogs act directly on viral replication by inhibiting the reverse transcription process of the virus; the long-term nucleoside analogue treatment can effectively improve liver diseases and reduce liver cancer incidence and death rate, but the medicaments show very low clearance rate of hepatitis B surface antigen (HBsAg), can only functionally inhibit chronic hepatitis B, and cannot realize functional cure of hepatitis B virus.
Coronaviruses (CoV) belong to the order of the niporoviridae, the family coronaviridae, the genus coronaviridae, in classification, and have genome lengths of about 25000nt to 30000nt. The antiviral drugs currently used for the treatment of the COVID-19 mainly comprise small molecular drugs (such as protease inhibitors and polymerase inhibitors), biological macromolecular drugs (such as high-potency immunoglobulin, convalescence plasma and monoclonal antibodies) and the like. The small molecular medicine has the advantages of easy absorption, small molecular volume, capability of penetrating cell membranes, easy large-scale industrial production and the like, and is an important point in medicine research and development. In small molecule drugs with anti-SARS-CoV-2 action, breakthrough progress was made with protease inhibitors (e.g., paklovine) targeting viral protein cleavage steps and RNA polymerase inhibitors (e.g., monapir) that rely on ribonucleic acid (RNA) (Owen DR, allerton CMN, anderson AS, et al, animal SARS-CoV-2Mpro inhibitor clinical candidate for the treatment of COVID-19[ J ]. Science,2021 (10): eabl4784; gordon CJ, tchesnokov EP, schinazi RF, et al, monupiravir proteins SARS-CoV-2 mutagenesis via the RNA template[J ]. J Biol Chem, 2021,297 (1): 100770). At present, antiviral drugs available for resisting SARS-CoV-2 infection are limited, and under the background of current global pandemic of COVID-19 and continuous variation of SARS-CoV-2, effective and safe antiviral drugs are developed and widely popularized and applied to be an important measure for reducing disease hazard.
Disclosure of Invention
First, the technical problem to be solved
In order to solve the above problems in the prior art, the present invention provides a chroman compound, a method for preparing the chroman compound, use in preventing, treating or alleviating viral infectious diseases, a medicament or a pharmaceutical composition for anti-hepatitis b virus or anti-coronavirus, particularly SARS-CoV-2, and a method for preparing the same, and a method for preventing, treating or alleviating hepatitis b virus infectious diseases and coronavirus infectious diseases.
(II) technical scheme
In order to solve the technical problems, the invention provides a chroman compound shown in a formula I, an isomer or pharmaceutically acceptable salt thereof, wherein the formula I has the following structural formula:
wherein R1 and R2 are respectively and independently selected from H, OH, OMe and halogen; r3 is selected from H, C1-C11 alkyl, C3-C6 cycloalkyl, phenyl, benzyl, substituted phenyl; r4 is selected from C1-C11 alkyl; x is independently selected from O, S and NH;
the substituted benzyl is selected from any one of the following: benzyl containing one or more halogen atoms, benzyl containing one trifluoromethyl substituent, benzyl containing one trifluoromethyl and one halogen atom substituent, benzyl containing one cyano substituent;
The substituted phenyl is selected from any one of the following: phenyl substituted with one or more halogen atoms, phenyl substituted with one trifluoromethyl group and one halogen atom, phenyl substituted with one cyano group.
The invention also provides a chroman compound shown in the formula I, an isomer or a pharmaceutically acceptable salt thereof, which is characterized in that the compound is selected from the following components: 2-propyl-4-hydroxychroman, 2-butyl-4-hydroxychroman, 2-pentyl-4-hydroxychroman, 2-hexyl-4-hydroxychroman, 2-heptyl-4-hydroxychroman, 2-octyl-4-hydroxychroman, 2-nonyl-4-hydroxychroman, 2-undecyl-4-hydroxychroman, 2-propyl-4-hydroxy-7-methoxychroman, 2-butyl-4-hydroxy-7-methoxychroman, 2-pentyl-4-hydroxy-7-methoxychroman, 2-hexyl-4-hydroxy-7-methoxychroman, 2-heptyl-4-hydroxy-7-methoxychroman, 2-octyl-4-hydroxy-7-methoxychroman, 2-nonyl-4-hydroxy-7-methoxychroman, 2-undecyl-7-methoxychroman, 2-hexyl-4-hydroxy-7-methoxychroman, 2-heptyl-4-methoxychroman, 2-heptyl-4, 7-dihydroxychroman, 2-heptyl-4-isobutylamino-7-methoxychroman, 2-heptyl-4- (4-chlorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-fluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-chlorobenzylamino) -7-methoxychroman, 2-heptyl-4- (4-fluorobenzylamino) -7-methoxychroman, 2-heptyl-4-benzylamino-7-methoxychroman, 2-heptyl-4- (4-trifluoromethylbenzylamino) -7-methoxychroman, 2-heptyl-4- (2-chloro-4-fluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3, 4-difluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-chlorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (2, 4-difluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (2-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman, 2-heptyl-4- (3, 4, 5-trifluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman, 2-heptyl-4- (2, 4-dichlorobenzylamino) -7-methoxychroman, 2-pentyl-4-amino-7-methoxychroman, 2-hexyl-4-amino-7-methoxychroman, 2-heptyl-4-amino-7-methoxychroman.
The invention also provides a chroman compound shown in the formula I, an isomer or a pharmaceutically acceptable salt thereof, which is characterized in that the compound forms an addition salt with an acid, and the acid is respectively and independently selected from hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, lactic acid, acetic acid, tartaric acid, p-toluenesulfonic acid, maleic acid, salicylic acid, citric acid and succinic acid.
The invention also provides a chroman compound shown in the formula I, an isomer or a pharmaceutically acceptable salt thereof, which is characterized in that the pharmaceutically acceptable salt is selected from the following: 2-heptyl-4-isobutylamino-7-methoxychroman hydrochloride, 2-heptyl-4- (4-chlorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-fluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-chlorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (4-fluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4-benzylamino-7-methoxychroman hydrochloride, 2-heptyl-4- (4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (2-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3, 4-difluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (2, 4-difluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (2-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3, 4, 5-trifluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (2, 4-dichlorobenzylamino) -7-methoxychroman hydrochloride.
The invention also provides a preparation method of the chroman compound shown in the formula I, an isomer or a pharmaceutically acceptable salt thereof, which comprises a preparation method of a compound shown in the formula II or a compound shown in the formula III, and the preparation method of the compound shown in the formula II comprises the following steps: the method comprises the steps of taking a compound shown in a formula IV as a raw material, carrying out bromination reaction to obtain a brominated product shown in a formula V, then, firstly, reacting with triphenylphosphine and then reacting with sodium hydroxide to obtain a compound shown in a formula VI; reacting a compound shown in a formula VI with aldehyde to obtain a compound shown in a formula VII; closing a ring of the compound shown in the formula VII under alkaline conditions to obtain a compound shown in the formula VIII; the compound shown in the formula VIII and primary amine or hydroxylamine hydrochloride are subjected to reductive amination reaction to obtain a compound shown in the formula II, and the adopted synthetic reaction steps are as follows:
the preparation method of the compound shown in the formula III comprises the following steps: the compound shown in the formula VIII is taken as a raw material, reacts with a hydrogenation reagent to obtain a compound shown in the formula IX, and then reacts with a halogenated hydrocarbon compound to obtain a compound shown in the formula III, and the adopted synthetic reaction steps are as follows:
the invention also provides a pharmaceutical composition, which comprises the chroman compound shown in the formula I, an isomer or pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier or auxiliary material.
The pharmaceutical composition is characterized in that the pharmaceutical composition is selected from tablets, capsules, pills and injections; the pharmaceutical composition is selected from a sustained release preparation or a controlled release preparation.
The pharmaceutical composition of the invention is a human pharmaceutical composition or an animal pharmaceutical composition, wherein the animal comprises a porcine, bovine, canine, equine, ovine, feline, rodent, primate, e.g., human, bovine, porcine or equine.
The invention also provides application of the chroman compound shown in the formula I, an isomer or a pharmaceutically acceptable salt thereof, and a pharmaceutical composition comprising the chroman compound shown in the formula I, the isomer or the pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier or auxiliary material in preparing medicines for preventing, treating or relieving hepatitis B virus infectious diseases and coronavirus infectious diseases.
The use of the compound or the pharmaceutical composition of the present invention for preventing, treating or alleviating a novel coronavirus (SARS-CoV-2) infectious disease.
(III) beneficial effects
The technical scheme of the invention has the following advantages:
1. the compound of the formula I of the invention has good inhibition effect on hepatitis B virus and coronavirus, especially SARS-CoV-2, which indicates that the compound has good antiviral activity, can be used as antiviral active ingredient or lead compound, and has good application prospect.
2. The synthesis method of the compound of the formula I has few steps, easily obtained raw materials, low cost, mild reaction conditions and easy realization of subsequent industrial production.
3. The compound of the formula I is a small molecular compound, can be obtained by crystallization or a conventional column chromatography preparation method in the preparation process, has simple preparation operation flow, and has high purity.
4. The invention discovers that the salt of the compound shown in the formula I has better inhibition effect on hepatitis B virus and coronavirus, especially SARS-CoV-2, and indicates that the salt has good antiviral activity.
5. The preparation method of the salt of the compound of the formula I can adopt a conventional acid-base neutralization preparation method, the preparation operation flow of the compound is simple, and the purity of the obtained compound is high.
Drawings
FIG. 1 is a graph showing the effect of compound 50a on sheldrake weight before and after administration;
FIG. 2 is a graph of the dose-response of 2-heptyl-4- (3-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride (43), 2-heptyl-4- (3, 4-difluorobenzylamino) -7-methoxychroman hydrochloride (48), cis-2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride (50 a) and 2-heptyl-4- (2, 4-difluorobenzylamino) -7-methoxychroman hydrochloride (51) to inhibit SARS-CoV-2.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments of the present invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The chroman compound shown in the formula I, isomer or pharmaceutically acceptable salt thereof has the following structural formula:
wherein R1 and R2 are respectively and independently selected from H, OH, OMe and halogen; r3 is selected from H, C1-C11 alkyl, C3-C6 cycloalkyl, phenyl, benzyl, substituted phenyl; r4 is selected from C1-C11 alkyl; x is independently selected from O, S and NH;
the substituted benzyl is selected from any one of the following: benzyl containing one or more halogen atoms, benzyl containing one trifluoromethyl substituent, benzyl containing one trifluoromethyl and one halogen atom substituent, benzyl containing one cyano substituent;
The substituted phenyl is selected from any one of the following: phenyl substituted with one or more halogen atoms, phenyl substituted with one trifluoromethyl group and one halogen atom, phenyl substituted with one cyano group.
The C1-C11 alkyl groups include, but are not limited to: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, 1-methylbutyl, 2-methylbutyl, neopentyl, 1-ethylpropyl, n-hexyl, isohexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 1-dimethylbutyl, 2-dimethylbutyl, 3-dimethylbutyl, n-heptyl, isoheptyl, n-octyl, 6-methylheptyl, n-nonyl, 7-methyloctyl, n-decyl, 8-methylnonyl, n-undecyl, 9-methyldecyl.
The C3-C6 cycloalkyl includes, but is not limited to: cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and isomers thereof, wherein the cycloalkyl group may contain heteroatoms (O, S, N, etc.).
The R3 is preferably any one of the following groups: hydrogen, propyl, n-butyl, isobutyl, n-pentyl, isopentyl, n-heptyl, cyclopentyl, cyclohexyl, phenyl, 4-fluorophenyl, 4-chlorophenyl, 4-bromophenyl, 3, 4-difluorophenyl, 3-chloro-4-fluorophenyl, 4-trifluoromethylphenyl, 3-trifluoromethylphenyl, 2-chloro-4-fluorophenyl, 2, 4-dichlorophenyl, 3,4, 5-trifluorophenyl, benzyl, 2-fluorobenzyl, 2-chlorobenzyl, 2-trifluoromethylbenzyl, 3-fluorobenzyl, 3-chlorobenzyl, 3-trifluoromethylbenzyl, 4-fluorobenzyl, 4-chlorobenzyl, 4-trifluoromethylbenzyl, 2, 4-difluorobenzyl, 3, 4-difluorobenzyl, 2, 4-dichlorobenzyl, 3, 4-dichlorobenzyl, 2-chloro-4-fluorobenzyl, 3-chloro-4-fluorobenzyl, 2-trifluoromethyl-4-fluorobenzyl, 2-trifluorobenzyl, 3-trifluoromethyl-4-chlorobenzyl, 3-trifluoromethyl-3-fluorobenzyl, 3-trifluoromethyl-3, 4-cyano, cyano.
The R4 is preferably any one of the following groups: methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl.
The preparation method of the compound shown in the formula I comprises, but is not limited to, a preparation method of a compound shown in the formula II and a preparation method of a compound shown in the formula III, wherein the preparation method of the compound shown in the formula II comprises the following steps: the compound shown in the formula IV is used as a raw material, ethyl acetate is used as a solvent to react with copper bromide under a reflux condition, and a brominated product shown in the formula V is obtained. Then, dissolving a brominated product shown in a formula V and triphenylphosphine in ethyl acetate, and reacting at room temperature to obtain a white solid; sodium hydroxide solution (2N) was added to a dichloromethane solution in which a white solid was dissolved, and the pH was adjusted to 12. Stirring at room temperature for 30min to obtain the compound shown in the formula VI. The compound shown in the formula VI and aldehyde are dissolved in dichloromethane, reflux reaction is carried out for 30 hours, and the compound shown in the formula VII is obtained after the reaction and purification by silica gel chromatography. The compound shown in the formula VII is reacted with sodium acetate in ethanol solution to obtain the compound shown in the formula VIII. The compound shown in the formula VIII and primary amine or hydroxylamine hydrochloride are dissolved in toluene, and then titanium tetrachloride is added dropwise, and the oily product is obtained after reaction for 24 hours at room temperature. Dissolving the oily product in methanol, adding a corresponding reducing agent (sodium borohydride or Pd/C and H2), purifying the product after room-temperature reaction by silica gel chromatography to obtain a compound shown in a formula II, wherein the adopted synthetic reaction steps are as follows:
The preparation method of the compound shown in the formula III comprises the following steps: the compound shown in the formula VIII is taken as a raw material to react with sodium borohydride in methanol to obtain a compound shown in the formula IX; in the presence of sodium hydride, the compound shown in the formula IX reacts with halogenated hydrocarbon compounds to obtain the compound shown in the formula III, and the adopted synthetic reaction steps are as follows:
the chromans of the present invention include, but are not limited to
The term "pharmaceutically acceptable salt" as used herein refers to salts of basic functional groups (e.g., -NH 2, —nhr, etc.) present in the compound with suitable inorganic or organic anions (acids), including but not limited to: hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, lactic acid, acetic acid, tartaric acid, p-toluenesulfonic acid, maleic acid, salicylic acid, citric acid, succinic acid and the like. Salts formed thereof include, but are not limited to: hydrochloride, hydrobromide, sulfate, phosphate, lactate, acetate, tartrate, p-toluenesulfonate, maleate, salicylate, citrate, succinate and the like.
Pharmaceutically acceptable salts described herein include, but are not limited to:
/>
/>
the invention adopts a currently accepted HepG2.2.15 cell model transfected by HBV DNA at home and abroad to test the anti-HBV activity of the chroman compound shown in the formula I, the isomer or the pharmaceutically acceptable salt thereof, and calculates half effective concentration of the compound for inhibiting the HepG2.2.15 cell transfected by HBV DNA. The calculation results show that the compounds 2,3,5,8, 11-13, 13a,13b,14-25, 27-29, 30a,30b, 31-49, 50a,50b and 51-55 have inhibitory effects on HBeAg, and IC with the inhibitory effects 50 Between 28.76 and 498.64. Mu.M, wherein Compounds 2 and 36 are more active, IC 50 41.89.+ -. 3.72 and 28.76.+ -. 3.55. Mu.M, respectively, and the Selectivity Index (SI) is respectively>19.10 4.56; compounds 3-5,8, 11-13, 13a,13b,14-29, 30a,30b,31-49, 50a,50b and 51-55 have inhibitory effect on HBsAg, and IC thereof 50 Between 0.48 and 136.20. Mu.M, wherein the compounds 5, 18, 31 and 40 are more active, IC 50 1.13+/-0.49,1.17 +/-0.58,2.08 +/-0.98 and 0.48+/-0.15 mu M respectively, SI 143.74 and 104.68 respectively,>1923.08 and 7032.58. Compounds 1-13, 13a,13b,14-29, 30a,30b,31-49, 50a,50b and 51-55 all have inhibitory effect on HBV DNA, and IC for inhibition thereof 50 Between 0.029 and 47.99. Mu.M, wherein the compounds 12, 13a,13b,18, 20, 30a,30b,31, 34, 39, 40, 43-45, 48, 50a,50b,51, 52, 54 and 55 are more active, IC 50 Are smaller than 1.00 mu M, are respectively 0.26+/-0.13,0.083 +/-0.027,0.093 +/-0.061,0.10 +/-0.03,0.78 +/-0.25,0.92 +/-0.24, 0.36+/-0.14,0.51 +/-0.19,0.59 +/-0.27,0.36 +/-0.11,0.70 +/-0.24,0.44 +/-0.18, 0.10+/-0.05,0.15 +/-0.06,0.47 +/-0.11,0.12 +/-0.03,0.029 +/-0.011,0.047 +/-0.028, 0.12+/-0.02,0.24 +/-0.13,0.72 +/-0.28,0.59 +/-0.21 mu M and SI is between 500.60 and 36282.80. The above results indicate that the tested compounds show better anti-hepatitis B virus effect, wherein the compounds 50a and 50b have the strongest anti-hepatitis B virus effect, and the IC50 of the compound on replication of hepatitis B DNA virus is similar to that of lamivudine (0.043 mu mol/L) which is a clinical drug, however, the inhibition effect on secretion of HBsAg and HBeAg is stronger than that of lamivudine.
The invention adopts the currently accepted duck hepatitis B animal model at home and abroad to test the in vivo duck hepatitis B treatment effect of the compound 50a in the compound of the formula I. The test result shows that the compound 50a has better inhibition effect on the replication of DHBV DNA at low, medium and high doses (10 mg/kg,20mg/kg,40 mg/kg). Compound 50a low dose group T14, T21 and T28 duck serum DHBV DNA content was significantly reduced (P < 0.01) during intragastric administration compared to group T0; the dose group T7 duck serum DHBV DNA content in the compound 50a is obviously reduced (P < 0.05), the T14, T21 and T28 duck serum DHBV DNA content is obviously reduced (P < 0.01), and the dose group T7, T14, T21 and T28 duck serum DHBV DNA content in the compound 50a is obviously reduced (P < 0.01). The low, medium and high dose groups P7, P14 of compound 50a still showed a very significant decrease in DHBV DNA content (P < 0.01) during the withdrawal period compared to the same group T0, with a trend to continuously inhibit viral replication. Anatomical after stopping the medicine, the viscera of the duck are not damaged.
The invention adopts a currently accepted SARS-CoV-2 induced Vero-E6 cell model at home and abroad to test the activity of the chromans compound shown in the formula I, isomers or pharmaceutically acceptable salts thereof against SARS-CoV-2, and calculates half inhibition concentration of the compound against SARS-CoV-2. The calculation results show that the compounds 43, 48, 50a and 51 have obvious inhibition effect on SARS-CoV-2 isolate nCoV-2019 BetaCoV/Wuhan/WIV/2019, and half inhibition concentration (EC) when MOI of virus infection is 0.05 50 ) 3.28,2.27,2.98 and 5.93 μmol/L respectively, the corresponding Selection Indices (SI) are greater than 122.0, 176.2, 134.2 and 67.5 respectively. The above results indicate that the compounds tested show a better anti-SARS-CoV-2 effect.
The anti-hepatitis B virus and SARS-CoV-2 medicine or medicine composition can be administered in unit dosage form, and the administration route can be intestinal tract, or parenteral tract, such as oral administration, muscle, nasal cavity, oral mucosa, skin, transdermal, subcutaneous, intradermal, peritoneal, rectal, intravenous, intramuscular, epidural, intraocular, intracranial, vaginal administration and the like;
the administration route of the anti-hepatitis B virus and SARS-CoV-2 drug or pharmaceutical composition of the invention can be injection administration. Injections include intravenous injection, intramuscular injection, subcutaneous injection, intradermal injection, acupoint injection, intrathecal injection, and intraperitoneal injection.
The administration dosage form may be liquid dosage form or solid dosage form. The solution properties of the liquid dosage form can be true solutions, colloids, microparticles, emulsions, and suspensions. The liquid dosage form may be in the form of a syrup, injectable solution, nonaqueous solution, suspension or emulsion; solid dosage forms such as tablets, troches, capsules, drops, pills, granules, powders, creams, solutions, suppositories, dispersible powders such as lyophilized powders for injection, aerosols, and the like.
The medicine or the medicine composition for resisting hepatitis B virus and SARS-CoV-2 can be prepared into common preparation, slow release preparation, controlled release preparation, targeting preparation and various microparticle administration systems.
The pharmaceutically acceptable carrier or auxiliary materials comprise auxiliary materials of oral preparations, auxiliary materials of parenteral administration or external administration. The adjuvants include excipient such as lactose, calcium carbonate, calcium phosphate, and sodium phosphate; diluents and absorbents such as starch, cyclodextrin, lactose, sucrose, mannitol, microcrystalline cellulose sodium, calcium sulfate, and the like; humectants and binders such as water, ethanol, propanol, glycerol, propylene glycol, isopropanol, syrup, honey, dextrose, gelatin syrup, sodium carboxymethyl cellulose, potassium phosphate, and the like; disintegrants such as dry starch, agar powder, calcium carbonate, sodium bicarbonate, sodium dodecyl sulfate, methylcellulose, etc.; disintegration inhibitors such as sucrose, glyceryl tristearate, cocoa butter, hydrogenated oil, etc.; absorption promoters such as quaternary ammonium salts, sodium lauryl sulfate, and the like; lubricants such as talc, magnesium triethylamine stearate, silica, corn starch, stearate, boric acid, liquid paraffin, and the like. Tablets may be further prepared as coated tablets, such as sugar coated tablets, film coated tablets, enteric coated tablets, or bi-and multi-layered tablets, to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
The "halogen" as used herein means substituted with "halogen atom" which means fluorine atom, chlorine atom, bromine atom or iodine atom.
"isomers" as used herein include both structural isomers and stereoisomers. The structural isomers are in turn divided into (carbon) chain isomers, positional isomers and functional group isomers. Stereoisomers are classified into conformational isomers and configurational isomers, while configurational isomers are also classified into cis-trans isomers and optical isomers (enantiomers). Enantiomers, diastereomers, racemates, meso, cis-trans isomers, tautomers, geometric isomers, epimers, mixtures thereof and the like of the compounds of the present invention are included within the scope of the present invention.
The invention discloses an isomer of chroman compound shown in formula I, wherein the optical isomer (enantiomer) is a compound shown in formula X-XIII,
for a better understanding of the present invention, the following examples are set forth to further illustrate or describe the invention, but are not to be construed as limiting its scope.
The methods described in the examples below, unless otherwise specified, are all conventional; the reagents and materials, unless otherwise specified, are commercially available.
Example 1: preparation of intermediate I-1
2, 4-dihydroxyacetophenone (15.21 g,0.1 mol) was dissolved in 1L of acetone, and potassium carbonate (55.2 g,0.4 mol) was added. Dimethyl sulfate (0.11 mol) was added under ice bath, and after the completion of the dropwise addition, the temperature was returned to room temperature, and the oil bath was heated and refluxed for 5 hours. After the reaction, 500mL of ice water was added, and the mixture was extracted three times with ethyl acetate. The organic phases were combined and washed three times with saturated NaCl and then dried over anhydrous magnesium sulfate. After concentration by distillation under reduced pressure, the intermediate I-1 was purified by silica gel chromatography in a yield of 90%.
1 H-NMR(400MHz,CDCl 3 ),δ12.75(s,1H),7.63(d,J＝8.7Hz,1H), 6.44(dd,J＝8.7,2.5Hz,1H),6.42(d,J＝2.4Hz,1H),3.84(s,3H),2.56 (s,3H). 13 C-NMR(100MHz,CDCl 3 )δ202.5,166.0,165.2,132.3,113.8, 107.5,100.8,55.5,26.1.
Example 2: preparation of intermediate I-2
Intermediate I-1 (16.62 g,0.1 mol) was dissolved in ethyl acetate (1500 mL), copper bromide was added at room temperature, and heated to reflux for 12h. After cooling to room temperature, the mixture was filtered and neutralized with saturated aqueous sodium bicarbonate. After extraction three times with ethyl acetate and combination of the organic phases, the mixture was washed three times with saturated NaCl, dried over anhydrous magnesium sulfate, and concentrated by distillation under reduced pressure to give the crude product. Then, after purification by silica gel chromatography and recrystallization, the intermediate I-2 was obtained in a yield of 90%.
1 H NMR(400MHz,CDCl 3 )δ12.22(s,1H),7.65(d,J＝8.9Hz,1H), 6.48(dd,J＝8.9,2.5Hz,1H),6.45(d,J＝2.5Hz,1H),4.36(s,2H),3.86 (s,3H). 13 C-NMR(100MHz,CDCl 3 )δ195.3,167.1,166.4,132.1,111.3, 108.5,101.3,55.8,29.8.
Example 3: preparation of intermediate I-3
2-hydroxyacetophenone (13.6 g,0.1 mol) was dissolved in ethyl acetate (1500 mL) and prepared in the same manner as in example 2 to give intermediate I-3 in a yield of 90%.
1 H NMR(400MHz,CDCl 3 )δ11.75(s,1H),7.75(dd,J＝8.1,1.6Hz, 1H),7.53(ddd,J＝8.6,7.2,1.6Hz,1H),7.02(dd,J＝8.5,0.9Hz,1H), 6.94(ddd,J＝8.2,7.3,1.1Hz,1H),4.46(s,2H). 13 C-NMR(100MHz, CDCl 3 )δ197.1,163.3,137.6,130.5,119.4,119.0,117.1,30.2.
Example 4: preparation of intermediate I-4
Triphenylphosphine (10 g,40.8 mmol) was dissolved in ethyl acetate (40.8 mL), intermediate I-2 (10.7 g,40.8 mmol) was added slowly at room temperature and stirred overnight at room temperature. The white solid was filtered and dissolved in dichloromethane solvent (20.4 mL). Sodium hydroxide solution (2N) was slowly added to the dichloromethane solution at room temperature to adjust the pH to 12. After stirring for 30 minutes, the extract was separated and washed with saturated aqueous sodium bicarbonate. The organic phases are combined, dried, filtered and concentrated to obtain crude product. The crude product is recrystallized to obtain intermediate I-4 with the yield of 74%.
1 H NMR(400MHz,CDCl 3 )δ7.75–7.66(m,7H),7.63–7.55(m, 4H),7.51–7.47(m,6H),6.39(d,J＝2.5Hz,1H),6.32(dd,J＝8.7,2.6Hz, 1H),3.78(s,3H). 13 C-NMR(100MHz,CDCl 3 )δ187.1,164.2,162.9, 133.3(3×CH),133.2(3×CH),132.5(4×CH),129.2(4×CH),129.1(3×CH), 127.1,126.2,114.4,114.2,105.5,101.3,55.4.
Example 5: preparation of intermediate I-5
Triphenylphosphine (10 g,40.8 mmol) was dissolved in ethyl acetate (40.8 mL), intermediate I-3 (8.73 g,40.8 mmol) was added slowly at room temperature and stirred overnight at room temperature. The preparation method is the same as in example 4 to obtain intermediate I-5 with a yield of 98%.
1 H NMR(400MHz,CDCl 3 )δ7.74–7.69(m,7H),7.62–7.57(m, 3H),7.52–7.48(m,7H),7.24(ddd,J＝8.5,7.2,1.6Hz,1H),6.88(dd,J ＝8.3,1.2Hz,1H),6.75(ddd,J＝8.2,7.2,1.3Hz,1H). 13 C NMR(100 MHz,CDCl 3 )δ187.6,162.0,133.2(3×CH),133.1(CH×3),132.6(4×CH), 132.2,129.2(3×CH),129.1(3×CH),128.0,126.4,125.5,120.9,120.8, 118.0,117.6.
Example 6: preparation of intermediate I-6
Intermediate I-5 (7.92 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and butyraldehyde (1.44 g,0.02 mol) was added and heated to reflux for 30h after the addition. After the reaction is finished, crude products are obtained through filtration and reduced pressure distillation, and the intermediate I-6 is obtained after purification by silica gel chromatography, wherein the yield is 60%.
1 H NMR(400MHz,CDCl 3 )δ12.71(s,1H),7.73(dd,J＝8.0,1.2Hz, 1H),7.39(ddd,J＝8.4,7.2,1.3Hz,1H),7.13(dt,J＝15.2,6.9Hz,1H), 6.97–6.90(m,2H),6.82(ddd,J＝8.0,7.2,1.0Hz,1H),2.24(qd,J＝7.0, 1.1,2H),1.55–1.44(m,2H),0.90(t,J＝7.4Hz,3H). 13 C NMR(100MHz, CDCl 3 )δ194.3,163.7,150.9,136.4,130.0,124.1,119.7,118.9,118.6,35.1, 21.5,13.9.
Example 7: preparation of intermediate I-7
Intermediate I-5 (7.92 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and valeraldehyde (1.72 g,0.02 mol) was added to prepare intermediate I-7 in 65% yield in the same manner as in example 6.
1 H NMR(400MHz,CDCl 3 )δ12.71(s,1H),7.74(d,J＝7.8Hz,1H), 7.40(t,J＝7.4Hz,1H),7.14(m,1H),6.98–6.91(m,2H),6.83(t,J＝7.6 Hz,1H),2.28(q,J＝7.0Hz,2H),1.49–1.40(m,2H),1.36–1.27(m,2H), 0.87(t,J＝7.2Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ194.3,163.7,151.2, 136.4,130.0,123.9,119.7,118.9,118.6,32.8,30.3,22.5,14.0.
Example 8: preparation of intermediate I-8
Intermediate I-5 (7.92 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and hexanal (2.00 g,0.02 mol) was added to prepare intermediate I-8 in 75% yield in the same manner as in example 6.
1 H NMR(400MHz,CDCl 3 )δ12.68(s,1H),7.74(dd,J＝8.1,1.6Hz, 1H),7.40(ddd,J＝8.6,7.3,1.6Hz,1H),7.14(dt,J＝15.1,6.9Hz,1H), 6.98–6.91(m,2H),6.83(ddd,J＝8.2,7.2,1.2Hz,1H),2.28(qd,J＝7.2, 1.4,2H),1.51–1.44(m,2H),1.30–1.5(m,4H),0.84(t,J＝7.0Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ194.3,163.7,151.2,136.4,130.0,124.0, 119.7,118.9,118.6,33.1,31.6,28.0,22.6,14.1.
Example 9: preparation of intermediate I-9
Intermediate I-5 (7.92 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and heptanal (2.28 g,0.02 mol) was added to prepare intermediate I-9 in 70% yield in the same manner as in example 6.
1 H NMR(400MHz,CDCl 3 )δ12.79(s,1H),7.81(dd,J＝8.1,1.6Hz, 1H),7.47(ddd,J＝8.4,7.2,1.5Hz,1H),7.21(dt,J＝15.2,6.9Hz,1H), 7.06–6.99(m,2H),6.90(ddd,J＝8.2,7.2,1.1Hz,1H),2.35(q,J＝7.2 Hz,2H),1.57–1.50(m,2H),1.39–1.28(m,6H),0.90(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ194.3,163.6,151.3,136.4,130.0,123.8, 119.7,118.9,118.6,33.1,31.7,29.1,28.2,22.7,14.2.
Example 10: preparation of intermediate I-10
Intermediate I-5 (7.92 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and octanal (2.56 g,0.02 mol) was added and heated under reflux for 30h after the addition. The preparation method is the same as in example 6, and intermediate I-10 is obtained with a yield of 70%.
1 H NMR(400MHz,CDCl 3 )δ12.79(s,1H),7.81(d,J＝8.1Hz,1H), 7.47(t,J＝8.2Hz,1H),7.20(dt,J＝15.1,6.9Hz,1H),7.05–6.98(m,2H), 6.90(t,J＝7.6Hz,1H),2.34(q,J＝7.2Hz,2H),1.57–1.49(m,2H),1.34 –1.28(m,8H),0.88(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ 194.3,163.6,151.3,136.4,130.0,123.8,119.6,118.9,118.6,33.1,31.9, 29.4,29.2,28.2,22.8,14.2.
Example 11: preparation of intermediate I-11
Intermediate I-5 (7.92 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and nonanal (2.84 g,0.02 mol) was added and heated under reflux for 30h. The preparation method is the same as in example 6, and intermediate I-11 is obtained in a yield of 60%.
1 H NMR(400MHz,CDCl 3 )δ12.72(s,1H),7.74(d,J＝8.0Hz,1H), 7.40(t,J＝7.7Hz,1H),7.14(dt,J＝15.1,6.9Hz,1H),6.98–6.91(m,2H), 6.83(t,J＝7.6Hz,1H),2.27(q,J＝7.2Hz,2H),1.49–1.42(m,2H),1.31 –1.11(m,10H),0.81(t,J＝6.9Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ 194.3,163.6,151.3,136.4,130.0,123.8,119.6,118.9,118.6,33.1,32.0, 29.5,29.4,29.3,28.2,22.8,14.3.
Example 12: preparation of intermediate I-12
Intermediate I-5 (7.92 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and decanal (3.12 g,0.02 mol) was added and heated under reflux for 30h. The preparation method is the same as in example 6, and intermediate I-12 is obtained with a yield of 55%.
1 H NMR(400MHz,CDCl 3 )δ12.78(s,1H),7.81(dd,J＝8.1,1.2Hz, 1H),7.47(ddd,J＝8.5,7.3,1.5Hz,1H),7.21(dt,J＝15.1,7.0Hz,1H), 7.05–6.98(m,2H),6.90(ddd,J＝8.1,7.3,1.1Hz,1H),2.34(q,J＝7.2 Hz,2H),1.55–1.49(m,2H),1.41–1.20(m,12H),0.88(t,J＝7.0Hz, 3H). 13 C NMR(100MHz,CDCl 3 )δ194.3,163.6,151.3,136.4,130.0, 123.9,119.7,118.9,118.6,33.1,32.0,29.6,29.6,29.4,29.4,28.3,22.8, 14.3.
Example 13: preparation of intermediate I-13
Intermediate I-5 (7.92 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and nonanal (3.68 g,0.02 mol) was added and heated under reflux for 30h. The preparation method is the same as in example 6, and intermediate I-13 is obtained in 62% yield.
1 H NMR(400MHz,CDCl 3 )δ12.77(s,1H),7.82(dd,J＝8.1,1.6Hz, 1H),7.48(ddd,J＝8.6,7.3,1.6Hz,1H),7.21(dt,J＝15.0,6.9Hz,1H), 7.05–6.99(m,2H),6.91(ddd,J＝8.2,7.3,1.1Hz,1H),2.35(qd,J＝7.2, 1.3Hz,2H),1.55–1.50(m,2H),1.31–1.25(m,16H),0.88(t,J＝6.8Hz, 3H). 13 C NMR(100MHz,CDCl 3 )δ194.3,163.7,151.3,136.4,130.0, 123.9,119.7,118.9,118.6,33.1,32.1,29.8,29.8,29.7,29.6,29.5,29.4, 28.3,22.8,14.3.
Example 14: preparation of intermediate I-14
Intermediate I-4 (8.52 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and butyraldehyde (1.44 g,0.02 mol) was added and heated to reflux for 30h after the addition. The preparation method is the same as in example 6, and intermediate I-14 is obtained in 65% yield.
1 H NMR(400MHz,CDCl 3 )δ13.39(s,1H),7.72(d,J＝9.6Hz,1H), 7.15(m,1H),6.95(d,J＝15.2Hz,1H),6.46–6.44(m,2H),3.84(s,3H), 2.31(q,J＝7.2Hz,2H),1.61–1.52(m,2H),0.97(t,J＝7.2Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.5,166.7,166.2,149.7,131.5,124.1,113.7, 107.7,101.1,55.7,35.1,21.6,13.9.
Example 15: preparation of intermediate I-15
Intermediate I-4 (8.52 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and valeraldehyde (1.72 g,0.02 mol) was added and heated under reflux for 30h after the addition. The preparation method is the same as in example 6, and intermediate I-15 is obtained in a yield of 68%.
1 H NMR(400MHz,CDCl 3 )δ13.38(s,1H),7.71(d,J＝9.6Hz,1H), 7.16(m,1H),6.94(d,J＝15.1Hz,1H),6.46–6.43(m,2H),3.84(s,3H), 2.33(q,J＝7.2Hz,2H),1.55–1.47(m,2H),1.42–1.33(m,2H),0.93(t, J＝7.3Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.5,166.7,166.1,150.0, 131.5,123.9,113.7,107.7,101.1,55.7,32.8,30.4,22.5,14.0.
Example 16: preparation of intermediates I-16 and I-17
Intermediate I-16 and I-17 can be obtained by reacting intermediate I-4 (8.52 g,20 mmol) with hexanal and heptanal in sequence according to the procedure of example 15.
Example 17: preparation of intermediate I-18
Intermediate I-4 (8.52 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and octanal (2.56 g,0.02 mol) was added and heated under reflux for 30h after the addition. The preparation method is the same as in example 6, and intermediate I-18 is obtained with a yield of 70%.
1 H NMR(400MHz,CDCl 3 )δ13.38(s,1H),7.80(d,J＝9.6Hz,1H), 7.15(m,1H),6.93(d,J＝15.1Hz,1H),6.45–6.40(m,2H),3.83(s,3H), 2.25(q,J＝7.3Hz,2H),1.53–1.48(m,2H),1.34–1.27(m,8H),0.88(t, J＝6.6Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.4,166.6,166.0,149.9, 131.4,123.8,113.6,107.6,101.0,55.6,33.0,31.8,29.3,29.1,28.2,22.7, 14.1.
Example 18: preparation of intermediate I-19
Intermediate I-19 was obtained by reacting intermediate I-4 (8.52 g,20 mmol) with nonanal according to the method of example 17.
Example 19: preparation of intermediate I-20
Intermediate I-4 (8.52 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and decanal (3.12 g,0.02 mol) was added and heated under reflux for 30h. The preparation method is the same as in example 6, and intermediate I-20 is obtained with a yield of 66%.
1 H NMR(400MHz,CDCl 3 )δ13.38(s,1H),7.71(d,J＝9.3Hz,1H), 7.15(m,1H),6.94(d,J＝15.1Hz,1H),6.44–6.41(m,2H),3.83(s,3H), 2.31(q,J＝7.3Hz,2H),1.55–1.48(m,2H),1.35–1.26(m,12H),0.87(t, J＝6.6Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.4,166.7,166.1,150.0, 131.5,123.9,113.7,107.7,101.1,55.7,33.1,32.0,29.6,29.6,29.4,29.4, 28.3,22.8,14.3.
Example 20: preparation of intermediate I-21
Intermediate I-4 (8.52 g,20 mmol) was dissolved in dry dichloromethane (60 mL) and dodecanal (3.68 g,0.02 mol) was added and heated to reflux for 30h after the addition. The preparation method is the same as in example 6 to obtain intermediate I-21 with a yield of 72%.
1 H NMR(400MHz,CDCl 3 )δ13.38(s,1H),7.71(d,J＝9.6Hz,1H), 7.16(m,1H),6.94(d,J＝15.1Hz,1H),6.45–6.40(m,2H),3.84(s,3H), 2.32(q,J＝7.3Hz,2H),1.55–1.48(m,2H),1.36–1.25(m,16H),0.87(t, J＝6.6Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.5,166.7,166.1,150.0, 131.5,123.9,113.7,107.7,101.1,55.7,33.1,32.0,29.8,29.7,29.7,29.6, 29.5,29.4,28.3,22.8,14.3.
Example 21: preparation of intermediate I-22
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-6 (3.80 g,20 mmol) was added to the solution and heated to reflux for 7h after addition. After the reaction, cooling to room temperature, removing the ethanol solvent by distillation under reduced pressure, adding distilled water (200 mL), extracting by ethyl acetate, washing by saturated NaCl, drying by anhydrous magnesium sulfate and concentrating under reduced pressure to obtain a crude product. The crude product is purified by silica gel chromatography to obtain an intermediate I-22 with the yield of 95%.
1 H NMR(400MHz,CDCl 3 )δ7.86(dd,J＝7.8,1.8Hz,1H),7.45(t,J ＝7.8Hz,1H),7.00–6.94(m,2H),4.44(m,1H),2.67(d,J＝8.2Hz,2H), 1.86(m,1H),1.66(m,1H),1.59–1.45(m,2H),0.98(t,J＝7.4Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.9,161.8,136.1,127.0,121.2,121.1, 118.0,77.7,43.0,37.1,18.3,14.0.
Example 22: preparation of intermediate I-23
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-7 (4.08 g,20 mmol) was added to the solution and heated to reflux 7h. The work-up procedure was as in example 21 to give intermediate I-23 in 90% yield.
1 H NMR(400MHz,CDCl 3 )δ7.85(d,J＝7.8Hz,1H),7.44(m,1H), 7.00–6.94(m,2H),4.41(m,1H),2.68–2.65(m,2H),1.86(m,1H),1.70 (m,1H),1.52(m,1H),1.42–1.34(m,3H),0.93(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.8,161.7,136.0,127.0,121.2,121.0,118.0, 78.0,43.0,34.7,27.1,22.6,14.1.
Example 23: preparation of intermediate I-24
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-8 (4.36 g,20 mmol) was added to the solution and heated to reflux for 7h after addition. The work-up procedure was as in example 21 to give intermediate I-24 in 97% yield.
1 H NMR(400MHz,CDCl 3 )δ7.85(dt,J＝7.8,1.6Hz,1H),7.44(t,J ＝7.8Hz,1H),6.99–6.93(m,2H),4.41(m,1H),2.66(d,J＝7.8Hz,2H), 1.88(m,1H),1.70(m,1H),1.55(m,1H),1.46(m,1H),1.38–1.32(m, 4H),0.91(t,J＝6.7Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.7,161.7, 136.0,127.0,121.2,121.1,118.0,78.0,43.0,35.0,31.6,24.6,22.6,14.1.
Example 24: preparation of intermediate I-25
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-9 (4.64 g,20 mmol) was added to the solution and heated to reflux for 7h after addition. The work-up procedure was as in example 21 to give intermediate I-25 in 97% yield.
1 H NMR(400MHz,CDCl 3 )δ7.85(d,J＝7.8Hz,1H),7.45(t,J＝7.7 Hz,1H),6.99–6.94(m,2H),4.42(m,1H),2.67(d,J＝8.0Hz,2H),1.86 (m,1H),1.68(m,1H),1.53(m,1H),1.42(m,1H),1.36–1.27(m,6H), 0.88(t,J＝6.7Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ192.8,161.8,136.0, 127.0,121.2,121.0,118.0,78.0,43.0,35.0,31.8,29.1,24.9,22.7,14.2.
Example 25: preparation of intermediate I-26
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-10 (4.92 g,20 mmol) was added to the solution and heated to reflux for 7h after addition. The work-up procedure was as in example 21 to give intermediate I-26 in 90% yield.
1 H NMR(400MHz,CD 3 OD)δ7.86(dd,J＝7.8,1.8Hz,1H),7.46(t, J＝7.8Hz,1H),7.00–6.95(m,2H),4.43(m,1H),2.67(d,J＝8.1Hz, 2H),1.87(m,1H),1.69(m,1H),1.53(m,1H),1.43(m,1H),1.33–1.24 (m,8H),0.88(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CD 3 OD)δ194.7, 163.3,137.3,127.6,122.2,122.1,119.1,79.3,43.8,36.0,33.0,30.6,30.4, 26.0,23.7,14.5.
Example 26: preparation of intermediate I-27
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-11 (5.2 g,20 mmol) was added to the solution and heated to reflux 7 h. The work-up procedure was as in example 21 to give intermediate I-27 in 97% yield.
1 H NMR(400MHz,CDCl 3 )δ7.87(d,J＝7.4Hz,1H),7.47(t,J＝7.0 Hz,1H),7.01–6.96(m,2H),4.44(m,1H),2.68(d,J＝7.3Hz,2H),1.87 (m,1H),1.66(m,1H),1.51(m,1H),1.43(m,1H),1.35–1.25(m,10H), 0.87(t,J＝6.4Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ193.0,161.8,136.1, 127.0,121.3,121.1,118.0,78.0,43.1,35.1,32.0,29.6,29.5,29.4,25.0, 22.8,14.3.
Example 27: preparation of intermediate I-28
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-12 (5.48 g,20 mmol) was added to the solution and heated to reflux 7 h. The work-up procedure was as in example 21 to give intermediate I-28 in 96% yield.
1 H NMR(400MHz,CD 3 OD)δ7.86(dd,J＝7.8,1.7Hz,1H),7.46 (ddd,J＝8.4,7.2,1.8Hz,1H),7.00–6.95(m,2H),4.42(m,1H),2.68(d, J＝7.7Hz,2H),1.87(m,1H),1.68(m,1H),1.53(m,1H),1.43(m,1H), 1.32–1.26(m,12H),0.87(t,J＝6.9Hz,3H). 13 C NMR(100MHz, CD 3 OD)δ194.7,163.3,137.4,127.7,122.2,122.1,119.1,79.3,43.8,36.0, 33.1,30.7,30.7,30.6,30.5,26.1,23.8,14.5.
Example 28: preparation of intermediate I-29
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-13 (6.04 g,20 mmol) was added to the solution and heated to reflux 7 h. The work-up procedure was as in example 21 to give intermediate I-29 in 89% yield.
1 H NMR(400MHz,CD 3 OD)δ7.73(dd,J＝7.8,1.6Hz,1H),7.44 (ddd,J＝8.6,7.3,1.7Hz,1H),6.95–6.90(m,2H),4.38(m,1H),2.61(m, 2H),1.78(m,1H),1.63(m,1H),1.50(m,1H),1.40(m,1H),1.27–1.22(m, 16H),0.82(t,J＝6.9Hz,3H). 13 C NMR(100MHz,CD 3 OD)δ194.8, 163.3,137.4,127.6,122.2,122.1,119.1,79.3,43.8,36.0,33.1,30.8,30.8, 30.7,30.7,30.6,30.5,26.0,23.8,14.5.
Example 29: preparation of intermediate I-30
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-14 (4.40 g,20 mmol) was added to the solution and heated to reflux 7 h. The work-up procedure was as in example 21 to give intermediate I-30 in 93% yield.
1 H NMR(400MHz,CDCl 3 )δ7.80(d,J＝8.8Hz,1H),6.56(dd,J＝ 8.8,2.4Hz,1H),6.41(d,J＝2.4Hz,1H),4.44(m,1H),3.83(s,3H),2.63 –2.60(m,2H),1.85(m,1H),1.66(m,1H),1.59–1.47(m,2H),0.98(t,J ＝7.3Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ191.5,166.1,163.8,128.8, 115.0,109.9,100.8,78.2,55.7,42.8,37.1,18.3,14.0.
Example 30: preparation of intermediate I-31
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-15 (4.68 g,20 mmol) was added to the solution and heated to reflux 7h. The work-up procedure was as in example 21 to give intermediate I-31 in 94% yield.
1 H NMR(400MHz,CDCl 3 )δ7.78(d,J＝8.8Hz,1H),6.53(dd,J＝ 8.8,2.0Hz,1H),6.39(d,J＝2.1Hz,1H),4.39(m,1H),3.80(s,3H),2.61 –2.59(m,2H),1.84(m,1H),1.67(m,1H),1.50(m,1H),1.45–1.31(m, 3H),0.92(t,J＝7.0Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ:191.4,166.1, 163.7,128.7,115.0,109.9,100.7,78.4,55.6,42.7,34.7,27.1,22.6,14.1.
Example 31: preparation of intermediate I-32
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-16 (4.96 g,20 mmol) was added to the solution and heated to reflux 7h. The work-up procedure was as in example 21 to give intermediate I-32 in 92% yield.
1 H NMR(400MHz,CDCl 3 )δ7.79(d,J＝8.7Hz,1H),6.54(dd,J＝ 8.8,2.4Hz,1H),6.39(d,J＝2.3Hz,1H),4.41(m,1H),3.81(s,3H),2.66 –2.53(m,2H),1.84(m,1H),1.67(m,1H),1.53(m,1H),1.44(m,1H), 1.37–1.30(m,4H),0.89(t,J＝6.7Hz 3H). 13 C NMR(100MHz,CDCl 3 ) δ191.4,166.1,163.8,128.7,115.0,109.9,100.7,78.4,55.7,42.7,35.0, 31.7,24.7,22.6,14.1.
Example 32: preparation of intermediate I-33
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-17 (5.24 g,20 mmol) was added to the solution and heated to reflux 7h. The work-up procedure was as in example 21 to give intermediate I-33 in 92% yield.
1 H NMR(400MHz,CDCl 3 )δ7.78(d,J＝8.8Hz,1H),6.53(dd,J＝ 8.8,2.2Hz,1H),6.39(d,J＝2.2Hz,1H),4.40(m,1H),3.81(s,3H),2.61 –2.59(m,2H),1.84(m,1H),1.67(m,1H),1.51(m,1H),1.43(m,1H), 1.39–1.23(m,6H),0.87(t,J＝6.7Hz,3H). 13 C NMR(100MHz,CDCl 3 ) δ191.4,166.1,163.8,128.7,115.0,109.9,100.7,78.4,55.7,42.7,35.1, 31.8,29.2,25.0,22.7,14.2.
Example 33: preparation of intermediate I-34
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-18 (5.52 g,20 mmol) was added to the solution and heated to reflux for 7h after addition. The work-up procedure was as in example 21 to give intermediate I-34 in 95% yield.
1 H NMR(400MHz,CDCl 3 )δ7.79(d,J＝8.8Hz,1H),6.55(dd,J＝ 8.8,2.4Hz,1H),6.40(d,J＝2.4Hz,1H),4.41(m,1H),3.82(s,3H),2.62 –2.60(m,2H),1.85(m,1H),1.68(m,1H),1.53(m,1H),1.43(m,1H), 1.36–1.24(m,8H),0.88(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 ) δ191.4,166.1,163.8,128.7,115.0,109.9,100.7,78.4,55.7,42.8,35.1, 31.9,29.5,29.3,25.0,22.8,14.2.
Example 34: preparation of intermediate I-35
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-19 (5.80 g,20 mmol) was added to the solution and heated to reflux 7 h. The work-up procedure was as in example 21 to give intermediate I-35 in 90% yield.
1 H NMR(400MHz,CDCl 3 )δ7.80(d,J＝8.8Hz,1H),6.55(dd,J＝ 8.8,2.4Hz,1H),6.40(d,J＝2.4Hz,1H),4.41(m,1H),3.82(s,3H),2.63 –2.60(m,2H),1.85(m,1H),1.67(m,1H),1.53(m,1H),1.44(m,1H), 1.34–1.24(m,10H),0.88(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 ) δ191.5 166.1,163.8,128.7,115.0,109.9,100.8,78.4,55.7,42.8,35.1, 32.0,29.6,29.5,29.3,25.0,22.8,14.2.
Example 35: preparation of intermediate I-36
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-20 (6.08 g,20 mmol) was added to the solution and heated to reflux 7 h. The work-up procedure was as in example 21 to give intermediate I-36 in 94% yield.
1 H NMR(400MHz,CDCl 3 )δ7.79(d,J＝8.8Hz,1H),6.59(dd,J＝ 8.4,2.4Hz,1H),6.40(d,J＝2.4Hz,1H),4.41(m,1H),3.81(s,3H),2.63 –2.58(m,2H),1.85(m,1H),1.67(m,1H),1.51(m,1H),1.43(m,1H), 1.34–1.26(m,12H),0.87(t,J＝6.6Hz,3H). 13 C NMR(100MHz,CDCl 3 ) δ191.7,160.6,134.9,125.9,120.1,119.9,116.9,76.9,41.9,33.9,30.9, 28.5,28.5,28.4,28.3,23.9,21.7,13.1.
Example 36: preparation of intermediate I-37
Anhydrous sodium acetate (16.40 g,200 mmol) was dissolved in dry ethanol (700 mL), intermediate I-21 (6.64 g,20 mmol) was added to the solution and heated to reflux 7 h. The work-up procedure was as in example 21 to give intermediate I-37 in 29% yield.
1 H NMR(400MHz,CDCl 3 )δ7.79(d,J＝8.8Hz,1H),6.54(dd,J＝ 8.8,2.4Hz,1H),6.40(d,J＝2.4Hz,1H),4.41(m,1H),3.82(s,3H),2.62 –2.60(m,2H),1.85(m,1H),1.67(m,1H),1.52(m,1H),1.43(m,1H), 1.38–1.25(m,16H),0.87(t,J＝6.7Hz,3H). 13 C NMR(100MHz,CDCl 3 ) δ191.4,166.1,163.8,128.7,115.0,109.9,100.7,78.4,55.7,42.7,35.1, 32.0,29.7(3×CH 2 ),29.6,29.5,29.5,25.0,22.8,14.2.
Example 37: preparation of intermediate I-38
Intermediate I-33 (5.24 g,20 mmol) was dissolved in 200mL anhydrous dichloromethane and 4mmol of boron tribromide was added and after the addition was completed, the reaction was carried out at room temperature for 18h. After the reaction, a certain amount of saturated sodium bicarbonate solution is added to adjust the pH to 8-9. Then extracting by ethyl acetate, washing by saturated NaCl, drying by anhydrous magnesium sulfate and concentrating under reduced pressure to obtain crude products. The crude product is purified by silica gel chromatography to obtain the intermediate I-38 with the yield of 65%.
1 H NMR(400MHz,CDCl 3 )δ7.66(d,J＝8.8Hz,1H),6.44(dd,J＝ 8.8,2.4Hz,1H),6.29(d,J＝2.4Hz,1H),4.41(m,1H),2.63–2.50(m, 2H),1.84–1.28(m,10H),0.92(t,J＝6.4Hz,3H). 13 C NMR(100MHz, CDCl 3 )δ193.8,166.6,165.5,129.8,115.0,111.5,103.8,79.4,43.4,36.0, 32.9,30.3,26.0,23.7,14.5.
Example 38: preparation of intermediate I-39
Intermediate I-34 (5.52 g,20 mmol) was dissolved in 200mL anhydrous dichloromethane and 4mmol of boron tribromide was added and after the addition was completed, the reaction was carried out at room temperature for 18h. The work-up procedure was as in example 37 to give intermediate I-39 in 63% yield.
1 H NMR(400MHz,CDCl 3 )δ7.67(d,J＝8.8Hz,1H),6.44(dd,J＝ 8.8,2.0Hz,1H),6.30(d,J＝2.0Hz,1H),4.42(m,1H),2.65–2.53(m, 2H),1.86–1.31(m,12H),0.91(t,J＝6.8Hz,3H). 13 C NMR(100MHz, CDCl 3 )δ193.6,166.6,165.5,129.8,115.0,111.5,103.6,79.4,43.4,36.0, 33.0,30.6,30.4,26.1,23.8,14.5.
Example 39: preparation of intermediate I-40
Intermediate I-32 (4.96 g,20 mmol) was dissolved in 200mL absolute ethanol, 28mmol hydroxylamine hydrochloride and 30mmol sodium acetate were added, and after the addition was completed, the mixture was refluxed with heating to 6 h. After the completion of the reaction, the solvent was distilled off under reduced pressure, distilled water (200 mL) was added, followed by extraction with ethyl acetate, washing with saturated NaCl, drying over anhydrous magnesium sulfate and concentration under reduced pressure to obtain a crude product. The crude product is purified by silica gel chromatography to obtain the intermediate I-40 with the yield of 95%.
1 H NMR(400MHz,CDCl 3 )δ7.69(d,J＝8.8Hz,1H),6.53(d,J＝ 8.8Hz,1H),6.41(s,1H),4.07(br.s,1H),3.79(s,3H),3.28(m,1H),2.41 (m,1H),1.85–1.21(m,8H),0.90(t,J＝6.8Hz,3H). 13 C NMR(100MHz, CDCl 3 )δ162.2,158.0,150.4,125.0,110.9,109.4,101.4,75.6,55.4,35.1, 31.7,28.3,24.8,22.6,14.0.
Example 40: preparation of intermediate I-41
Intermediate I-33 (5.24 g,20 mmol) was dissolved in 200mL absolute ethanol, 28mmol hydroxylamine hydrochloride and 30mmol sodium acetate were added, and after the addition was completed, the mixture was refluxed with heating of 6 h. The work-up procedure was as in example 39 to give intermediate I-41 in 95% yield.
1 H NMR(400MHz,CDCl 3 )δ7.69(d,J＝8.8Hz,1H),6.52(d,J＝ 8.8Hz,1H),6.41(s,1H),4.10(br.s,1H),3.79(s,3H),3.27(m,1H),2.39 (m,1H),1.81(m,1H),1.66(m,1H),1.57–1.45(m,2H),1.82–1.24(m, 6H),0.88(t,J＝6.0Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ162.2,158.0, 150.5,125.0,111.0,109.4,101.4,75.6,55.4,35.1,31.7,29.2,28.2,25.1, 22.6,14.1.
Example 41: preparation of intermediate I-42
Intermediate I-34 (5.52 g,20 mmol) was dissolved in 200mL absolute ethanol, 28mmol hydroxylamine hydrochloride and 30mmol sodium acetate were added, and after the addition was completed, the mixture was refluxed with heating for 6 h. The work-up procedure was as in example 39 to give intermediate I-42 in 95% yield.
1 H NMR(400MHz,CDCl 3 )δ7.69(d,J＝8.8Hz,1H),6.53(d,J＝ 8.8Hz,1H),6.41(s,1H),4.07(br.s,1H),3.80(s,3H),3.28(m,1H),2.40 (m,1H),1.83–1.20(m,12H),0.89(t,J＝6.8Hz,3H). 13 C NMR(100 MHz,CDCl 3 )δ162.2,158.0,150.4,125.0,111.0,109.4,101.4,75.6,55.4, 35.1,31.9,29.5,29.3,28.3,25.1,22.7,14.1.
EXAMPLE 42 preparation of 2-propyl-4-hydroxychroman (1)
Intermediate I-22 (3.80 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. After the completion of the reaction, the solvent was distilled off under reduced pressure, distilled water (200 mL) was added thereto, followed by extraction with ethyl acetate, washing with saturated NaCl, drying over anhydrous magnesium sulfate and concentration under reduced pressure to obtain a crude product. The crude product was purified by silica gel chromatography to give compound 1 in 63% yield.
1 H NMR(400MHz,CD 3 OD)δ7.34(d,J＝7.7Hz,1H),7.01(ddd,J ＝8.3,7.7,1.1Hz,1H),6.79(td,J＝7.6,1.0Hz,1H),6.63(dd,J＝8.2,0.8 Hz,1H),4.79(dd,J＝10.7,6.3Hz,1H),4.02(m,1H),2.14(ddd,J＝12.8, 6.3,1.5Hz,1H),1.71–1.37(m,5H),0.92(t,J＝7.1Hz,3H). 13 C NMR (100MHz,CD 3 OD)δ156.0,129.4,128.2,127.7,121.2,117.1,75.9,66.0, 39.0,38.7,19.4,14.4.
EXAMPLE 43 preparation of 2-butyl-4-hydroxychroman (2)
Intermediate I-23 (4.08 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 2 in 66% yield.
1 H NMR(400MHz,CD 3 OD)δ7.33(d,J＝7.7Hz,1H),7.00(ddd,J ＝8.2,7.6,0.9Hz,1H),6.78(td,J＝7.5,0.9Hz,1H),6.62(dd,J＝8.2,1.0 Hz,1H),4.78(m,1H),3.99(m,1H),2.13(m,1H),1.65–1.28(m,7H), 0.88(t,J＝7.1Hz,3H). 13 C NMR(100MHz,CD 3 OD)δ156.0,129.5, 128.2,127.7,121.2,117.2,76.2,66.0,38.7,36.5,28.5,23.8,14.5.
EXAMPLE 44 preparation of 2-pentyl-4-hydroxychroman (3)
Intermediate I-24 (4.36 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The working up procedure was as in example 42 to give compound 3 in 66% yield.
1 H NMR(400MHz,CD 3 OD)δ7.34(d,J＝7.7Hz,1H),7.01(ddd,J ＝8.3,7.7,1.1Hz,1H),6.79(td,J＝7.6,1.1Hz,1H),6.63(dd,J＝8.2,1.0 Hz,1H),4.79(dd,J＝10.7,6.3Hz,1H),4.00(m,1H),2.14(ddd,J＝12.8, 6.3,1.6Hz,1H),1.66–1.27(m,9H),0.86(t,J＝6.9Hz,3H). 13 C NMR (100MHz,CD 3 OD)δ156.0,129.5,128.2,127.7,121.2,117.1,76.2,66.0, 38.7,36.8,33.0,25.9,23.7,14.4.
EXAMPLE 45 preparation of 2-hexyl-4-hydroxybenzodihydropyran (4)
Intermediate I-25 (4.64 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 4 in 64% yield.
1 H NMR(400MHz,CDCl 3 )δ7.45(d,J＝7.7Hz,1H),7.16(ddd,J ＝8.3,7.7,1.2Hz,1H),6.93(td,J＝7.6,0.8Hz,1H),6.79(dd,J＝8.2,1.0 Hz,1H),4.90(dd,J＝10.6,6.3Hz,1H),4.09(m,1H),2.28(ddt,J＝12.9, 6.4,1.6Hz,1H),1.82–1.32(m,11H),0.91(t,J＝6.8Hz,3H). 13 C NMR (100MHz,CDCl 3 )δ154.7,129.1,127.0,126.1,120.6,116.6,75.1,65.8, 38.1,35.6,31.9,29.3,25.2,22.7,14.2.
EXAMPLE 46 preparation of 2-heptyl-4-hydroxychroman (5)
Intermediate I-26 (4.92 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 5 in 65% yield.
1 H NMR(400MHz,CDCl 3 )δ7.45(d,J＝7.6Hz,1H),7.16(ddd,J＝ 8.2,7.7,1.1Hz,1H),6.92(t,J＝7.4Hz,1H),6.79(d,J＝8.2Hz,1H), 4.90(m,1H),4.08(m,1H),2.28(m,1H),1.80–1.3(m,13H),0.91(t,J＝ 6.9Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ154.7,129.1,127.1,126.1, 120.6,116.6,75.1,65.8,38.1,35.6,32.0,29.7,29.4,25.2,22.8,14.3.
EXAMPLE 47 preparation of 2-octyl-4-hydroxychroman (6)
Intermediate I-27 (5.20 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 6 in 68% yield.
1 H NMR(400MHz,CDCl 3 )δ7.46(d,J＝7.6Hz,1H),7.16(m,1H), 6.93(t,J＝7.4Hz,1H),6.79(d,J＝8.2Hz,1H),4.90(m,1H),4.09(m, 1H),2.30(m,1H),1.82–1.72(m,2H),1.67–1.9(m,1H),1.55–1.42(m, 2H),1.38–1.29(m,10H),0.90(t,J＝6.7Hz,3H). 13 C NMR(100MHz, CDCl 3 )δ154.7,129.1,127.0,126.1,120.6,116.6,75.1,65.8,38.1,35.7, 32.0,29.7,29.7,29.4,25.2,22.8,14.3.
EXAMPLE 48 preparation of 2-nonyl-4-hydroxybenzodihydropyran (7)
Intermediate I-28 (5.48 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The working up procedure was as in example 42 to give compound 7 in 67% yield.
1 H NMR(400MHz,CDCl 3 )δ7.45(d,J＝7.6Hz,1H),7.16(m,1H), 6.92(td,J＝7.6,1.2Hz,1H),6.79(dd,J＝8.4,1.2Hz,1H),4.91(dd,J＝ 10.4,6.4Hz,1H),2.29(ddd,J＝12.9,6.3,0.9Hz,1H),1.85(m,1H),1.82 –1.71(m,2H),1.63(m,1H),1.55–1.41(m,2H),1.37–1.26(m,12H), 0.90(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ154.7,129.1,127.0, 126.1,120.6,116.6,75.1,65.8,38.1,35.7,32.0,29.7,29.7,29.5,29.4,25.2, 22.8,14.3.
EXAMPLE 49 preparation of 2-undecyl-4-hydroxybenzodihydropyran (8)
Intermediate I-29 (6.04 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 8 in 65% yield.
1 H NMR(400MHz,CD 3 OD)δ7.34(d,J＝7.7Hz,1H),7.01(ddd,J ＝8.3,7.8,1.1Hz,1H),6.79(td,J＝7.6,1.1Hz,1H),6.63(dd,J＝8.2,1.0 Hz,1H),4.79(dd,J＝10.7,6.3Hz,1H),4.00(m,1H),2.14(ddd,J＝12.8, 6.3,1.6Hz,1H),1.66–1.23(m,21H),0.83(t,J＝6.8Hz,3H). 13 C NMR (100MHz,CD 3 OD)δ156.0,129.4,128.2,127.7,121.2,117.2,76.2,66.0, 38.7,36.8,33.1,30.8(5×CH 2 ),30.5,26.2,23.8,14.5.
EXAMPLE 50 preparation of 2-propyl-4-hydroxy-7-methoxychroman (9)
Intermediate I-30 (4.40 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The working up procedure was as in example 42 to give compound 9 in 63% yield.
1 H NMR(400MHz,CDCl 3 )δ7.33(dd,J＝8.4,0.8Hz,1H),6.51(dd, J＝8.4,2.4Hz,1H),6.33(d,J＝2.4Hz,1H),4.86(dd,J＝10.4,6.4Hz, 1H),4.08(m,1H),3.76(s,3H),2.26(m,1H),1.76(m,1H),1.77-1.30(m, 4H),0.97(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ160.4,155.8, 128.0,118.6,107.8,101.0,75.1,65.5,55.4,38.3,37.7,18.5,14.1.
EXAMPLE 51 preparation of 2-butyl-4-hydroxy-7-methoxychroman (10)
Intermediate I-31 (4.68 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 10 in 68% yield.
1 H NMR(400MHz,CDCl 3 )δ7.32(d,J＝8.4Hz,1H),6.50(dd,J＝ 8.4,2.4Hz,1H),6.33(d,J＝2.4Hz,1H),4.84(m,1H),4.06(m,1H),3.75 (s,3H),2.25(m,1H),1.77-1.33(m,7H),0.94(t,J＝6.8Hz,3H). 13 C NMR (100MHz,CDCl 3 )δ160.4,155.7,127.9,118.6,107.7,100.9,75.4,65.4, 55.4,38.2,35.3,27.4,22.8,14.2.
Example 52 preparation of 2-pentyl-4-hydroxy-7-methoxychroman (11)
Intermediate I-32 (4.96 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 11 in 69% yield.
1 H NMR(400MHz,CDCl 3 )δ7.33(dd,J＝8.4,0.8Hz,1H),6.51(dd, J＝8.4,2.4Hz,1H),6.34(d,J＝2.4Hz,1H),4.86(dd,J＝10.4,6.4Hz, 1H),4.07(m,1H),3.76(s,3H),2.27(m,1H),1.77–1.32(m,9H),0.91(t, J＝7.2Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ:160.4,155.8,127.9,118.6, 107.8,101.0,75.4,65.5,55.4,38.3,35.6,31.9,24.9,22.7,14.2.
EXAMPLE 53 preparation of 2-hexyl-4-hydroxy-7-methoxychroman (12)
Intermediate I-33 (5.24 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. Working up procedure was as in example 42 to give compound 12 in 67% yield.
1 H NMR(400MHz,CDCl 3 )δ7.33(dd,J＝8.4,0.8Hz,1H),6.51(dd, J＝8.4,2.4Hz,1H),6.34(d,J＝2.4Hz,1H),4.86(dd,J＝10.4,6.4Hz, 1H),4.07(m,1H),3.76(s,3H),2.27(m,1H),1.80–1.29(m,11H),0.90(t, J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ160.4,155.8,127.9,118.6, 107.8,101.0,75.4,65.5,55.4,38.3,35.6,31.9,29.3,25.2,22.8,14.2.
EXAMPLE 54 preparation of 2-heptyl-4-hydroxy-7-methoxychroman (13)
Intermediate I-34 (5.52 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 13 in 66% yield.
1 H NMR(400MHz,CDCl 3 )δ7.33(d,J＝8.4Hz,1H),6.51(dd,J＝ 8.4,2.4Hz,1H),6.34(d,J＝2.4Hz,1H),4.86(dd,J＝10.4,6.4Hz,1H), 4.07(m,1H),3.76(s,3H),2.26(m,1H),1.77–1.26(m,13H),0.89(t,J＝ 6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ160.4,155.8,127.9,118.6, 107.8,101.0,75.4,65.5,55.4,38.3,35.6,32.0,29.6,29.4,25.2,22.8,14.2.
Chiral resolution of compound 13 can be achieved by HPLC chiral resolution under the following conditions: chiral column: chiralpak AD-RH (4.6 x 150 mm); separation conditions: flow rate: 0.3 mL/min; mobile phase: acetonitrile/water (90:10); λ=254 nm; t is t 13a ＝24.80min,t 13b ＝ 48.41min.
(2S, 4R) -2-heptyl-4-hydroxy-7-methoxychroman (13 a):(c ＝0.03,CHCl 3 ) The method comprises the steps of carrying out a first treatment on the surface of the (2R, 4S) -2-heptyl-4-hydroxy-7-methoxychroman (13 b):>(c＝0.03,CHCl 3 ). According to known literature reports (MaY, li J, ye J, et al Synthesis of chiral chromanols via a RuPHOX-Ru catalyzed asymmetric hydrogenation of chromanes. Chem. Commun. 2018,54:13571-13574;Kuninobu K,Yoriko K,Shozo Y,et al.The synthesis and the stereochemistry of 4-chromanes and 4-chromanols with bulky subunits. Bull. Chem. Soc. Jpn.1973, 46:1839-1844), the absolute configuration of a compound is determined by comparing the specific optical rotation of the compound and the coupling constants of the hydrogen at positions 2 and 4 with the hydrogen at position 3 of the compound.
Example 55 preparation of 2-octyl-4-hydroxy-7-methoxychroman (14)
Intermediate I-35 (5.80 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. Working up procedure was as in example 42 to give compound 14 in 65% yield.
1 H NMR(400MHz,CDCl 3 )δ7.33(t,J＝8.8,Hz,1H),6.51(m,1H), 6.34(t,J＝2.8,Hz,1H),4.86(m,1H),4.07(m,1H),3.75(s,3H),2.26(m, 1H),1.77–1.26(m,15H),0.89(t,J＝6.8Hz,3H). 13 C NMR(100MHz, CDCl 3 )δ160.4,155.8,128.0,118.6,107.8,101.0,75.4,65.6,55.5,38.3, 35.6,32.0,29.8,29.7,29.4,25.2,22.8,14.3.
EXAMPLE 56 preparation of 2-nonyl-4-hydroxy-7-methoxychroman (15)
Intermediate I-36 (6.08 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 15 in 66% yield.
1 H NMR(400MHz,CDCl 3 )δ7.34(d,J＝8.4Hz,1H),6.51(dd,J＝ 8.4,2.4Hz,1H),6.35(d,J＝2.4Hz,1H),4.86(dd,J＝10.4,2.4Hz,1H), 4.08(m,1H),3.76(s,3H),2.28(m,1H),1.79–1.27(m,17H),0.88(t,J＝ 6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ160.4,155.8,127.9,118.6, 107.8,101.0,75.4,65.5,55.4,38.3,35.6,32.0,29.8,29.8,29.7,29.5,25.3, 22.8,14.3.
Example 57 preparation of 2-undecyl-4-hydroxy-7-methoxychroman (16)
Intermediate I-37 (6.64 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. Working up procedure was as in example 42 to give compound 16 in 66% yield.
1 H NMR(400MHz,CDCl 3 )δ7.33(dd,J＝8.4,1.2Hz,1H),6.51(dd, J＝8.4,2.4Hz,1H),6.34(br.s,1H),4.86(t,J＝7.6Hz,1H),4.08(m,1H), 3.76(s,3H),2.27(m,1H),1.76–1.27(m,21H),0.89(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ160.4,155.8,127.9,118.6,107.8,101.0, 75.4,65.5,55.4,38.4,35.6,32.0,5×29.7,29.5,25.3,22.8,14.3.
EXAMPLE 58 preparation of 2-hexyl-4, 7-dihydroxychroman (17)
Intermediate I-38 (4.96 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. The work-up procedure was as in example 42 to give compound 17 in 45% yield.
1 H NMR(400MHz,CDCl 3 )δ7.28(d,J＝8.4Hz,1H),6.41(dd,J＝ 8.4,2.4Hz,1H),6.27(d,J＝2.4Hz,1H),4.88(br.s,1H),4.06(m,1H), 2.28(m,1H),1.77–1.31(m,11H),0.89(t,J＝6.4Hz,3H). 13 C NMR(100 MHz,CDCl 3 )δ156.3,155.8,128.1,118.5,108.3,102.9,75.3,65.5,38.1, 35.4,31.8,29.2,25.1,22.6,14.1.
EXAMPLE 59 preparation of 2-heptyl-4, 7-dihydroxychroman (18)
Intermediate I-41 (5.24 g,20 mmol) was dissolved in methanol (400 mL) and then 0.02mol of sodium borohydride was added and reacted at room temperature for 2h. Working up procedure was as in example 42 gave compound 18 in 47% yield.
1 H NMR(400MHz,CDCl 3 )δ7.21(d,J＝8.4Hz,1H),6.30(m,1H), 6.27(d,J＝2.4Hz,1H),4.80(m,1H),4.00(m,1H),2.20(m,1H),1.75– 1.20(m,13H),0.81(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ 156.5,155.9,128.3,118.6,108.4,103.1,75.4,65.6,38.3,35.6,32.0,29.7, 29.4,25.2,22.8,14.3.
EXAMPLE 60 preparation of 2-heptyl-4-isobutylamino-7-methoxychroman (19)
Intermediate I-34 (5.52 g,20 mmol) and isobutyl amine (120 mmol) were dissolved in toluene (110 mL) and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. After the reaction, the solvent was distilled off under reduced pressure, distilled water (100 mL) was added thereto, followed by extraction with ethyl acetate, washing with saturated NaCl, drying over anhydrous magnesium sulfate and concentration under reduced pressure to obtain a crude product. The crude product was purified by silica gel chromatography to give compound 19 in 40% yield.
1 H NMR(400MHz,CDCl 3 )δ7.41(d,J＝8.4Hz,1H),6.48(dd,J＝ 8.4,2.8Hz,1H),6.35(d,J＝2.8Hz,1H),4.03(m,1H),3.94(dd,J＝10.8, 5.6Hz,1H),3.76(s,3H),2.52(dd,J＝11.2,6.8Hz,1H),2.41(dd,J＝11.2, 6.4Hz,1H),2.26(ddd,J＝11.6,5.6,1.2Hz,1H),1.81–1.67(m,2H), 1.65–1.42(m,2H),1.38–1.24(m,10H),0.95(t,J＝7.2,6.8Hz,6H), 0.90(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ159.7,156.5,128.2, 118.1,107.4,101.1,76.1,55.4,53.7,52.6,36.0,35.3,32.0,29.7,29.4,29.3, 25.3,22.8,21.0,20.8,14.2.HRESIMS:m/z 356.2554[M+Na] + ,calcd.for C 21 H 35 NO 2 Na:356.2560.
EXAMPLE 61 preparation of 2-heptyl-4- (4-chlorobenzylamino) -7-methoxychroman (20)
Intermediate I-34 (5.52 g,20 mmol) and 4-chlorobenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 20 in 47% yield.
1 H NMR(400MHz,CDCl 3 )δ7.48(d,J＝8.4Hz,1H),7.36(d,J＝ 8.4Hz,2H),7.30(d,J＝8.4Hz,2H),6.51(dd,J＝8.8,2.4Hz,1H),6.36 (d,J＝2.4Hz,1H),4.05–3.95(m,2H),3.90(d,J＝13.2Hz,1H),3.78(d, J＝13.2Hz,1H),3.77(s,3H),2.32(m,1H),1.76(m,1H),1.66–1.44(m, 4H),1.39–1.26(m,8H),0.89(t,J＝6.4Hz,3H). 13 C NMR(100MHz, CDCl 3 )δ159.8,156.5,139.3,132.7,2×129.4,2×128.6,128.2,117.7,107.5, 101.1,76.0,55.4,51.8,49.0,36.0,35.2,32.0,29.7,29.4,25.3,22.8,14.3. HRESIMS:m/z 424.2010[M+Na] + ,calcd.for C 24 H 32 ClNO 2 Na:424.2014.
EXAMPLE 62 preparation of 2-heptyl-4- (3-fluorobenzylamino) -7-methoxychroman (21)
Intermediate I-34 (5.52 g,20 mmol) and 3-fluorobenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 21 in 56% yield.
1 H NMR(400MHz,CDCl 3 )δ7.51(d,J＝8.4Hz,1H),7.29(m,1H), 7.18(d,J＝8.4Hz,2H),6.95(m,1H),6.52(dd,J＝8.4,2.4Hz,1H),6.37 (d,J＝2.4Hz,1H),4.06–3.98(m,2H),3.94(d,J＝14.0Hz,1H),3.79(d, J＝14.0Hz,1H),3.77(s,3H),2.33(m,1H),1.76(m,1H),1.64(m,1H), 1.55(m,1H),1.45(m,2H),1.33(m,8H),0.91(t,J＝7.2Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ163.1(d,J＝243.9Hz),159.8,156.5,143.7(d, J＝7.0Hz),129.9(d,J＝8.3Hz),128.2,123.5(d,J＝2.7Hz),117.7,114.9 (d,J＝21.3Hz),113.9(d,J＝21.1Hz),107.5,101.1,76.0,55.4,51.8,49.2 (d,J＝1.6Hz),36.0,35.2,32.0,29.7,29.4,25.3,22.8,14.3. 19 F NMR(376 MHz,CDCl 3 )δ-113.55.HRESIMS:m/z 408.2307[M+Na] + ,calcd.for C 24 H 32 FNO 2 Na:408.2309.
EXAMPLE 63 preparation of 2-heptyl-4- (3-chlorobenzylamino) -7-methoxychroman (22)
Intermediate I-34 (5.52 g,20 mmol) and 3-chlorobenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 22 in 51% yield.
1 H NMR(400MHz,CDCl 3 )δ7.49(dd,J＝8.4,1.2Hz,1H),7.43(br.s, 1H),7.29(m,1H),7.26(br.s,1H),7.24(m,1H),6.51(dd,J＝8.4,2.8Hz, 1H),6.36(d,J＝2.8Hz,1H),4.06–3.96(m,2H),3.91(d,J＝13.6Hz, 1H),3.79(d,J＝13.7Hz,1H),3.76(s,3H),2.32(m,1H),1.74(m,1H), 1.67–1.43(m,4H),1.37–1.27(m,8H),0.91(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ159.8,156.6,143.1,134.4,129.7,128.2,128.2, 127.2,126.2,117.7,107.5,101.2,76.0,55.4,51.9,49.2,36.0,35.2,32.0, 29.7,29.4,25.3,22.8,14.3.HRESIMS:m/z 424.2016[M+Na] + ,calcd.for C 24 H 32 ClNO 2 Na:424.2014.
EXAMPLE 64 preparation of 2-heptyl-4- (3-trifluoromethylbenzylamino) -7-methoxychroman (23)
Intermediate I-34 (5.52 g,20 mmol) and 3-trifluoromethylbenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 23 in 49% yield.
1 H NMR(400MHz,CDCl 3 )δ7.70(br.s,1H),7.63(d,J＝7.6Hz,1H), 7.53–7.43(m,3H),6.52(dd,J＝8.4,2.4Hz,1H),6.37(d,J＝2.4Hz,1H), 4.10–3.96(m,3H),3.87(d,J＝13.6Hz,1H),3.77(s,3H),2.34(m,1H), 1.76(m,1H),1.69–1.44(m,4H),1.37–1.25(m,8H),0.91(t,J＝6.8Hz, 3H). 13 C NMR(100MHz,CDCl 3 )δ159.9,156.6,141.9,131.5,130.8(d,J ＝31.9Hz),128.9,128.2,124.8(q,J＝3.8Hz),123.9(q,J＝3.8Hz),123.0, 117.5,107.5,101.2,76.0,55.4,52.0,49.2,36.0,35.2,32.0,29.7,29.4,25.3, 22.8,14.3. 19 F NMR(376MHz,CDCl 3 )δ3×(-62.54).HRESI MS:m/z 434.2308[M-H] - ,calcd.for C 25 H 31 F 3 NO 2 :434.2312.
EXAMPLE 65 preparation of 2-heptyl-4- (4-fluorobenzylamino) -7-methoxychroman (24)
Intermediate I-34 (5.52 g,20 mmol) and 4-fluorobenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 24 in 39% yield.
1 H NMR(400MHz,CDCl 3 )δ7.47(d,J＝8.8Hz,1H),7.40-7.33(m, 2H),7.02(t,J＝8.4Hz,2H),6.50(dd,J＝8.4,2.4Hz,1H),6.35(d,J＝2.4 Hz,1H),4.11–3.95(m,2H),3.89(d,J＝13.2Hz,1H),3.78(d,J＝13.2 Hz,1H),3.76(s,3H),2.32(m,1H),1.75(m,1H),1.68–1.48(m,4H), 1.39–1.23(m,8H),0.90(t,J＝7.2Hz,3H). 13 C NMR(100MHz,CDCl 3 ) δ162.1(d,J＝243.2Hz),159.9,156.6,2×129.6(d,J＝7.8Hz),128.2, 128.2,117.8,2×115.3(d,J＝21.2Hz),107.5,101.2,76.1,55.4,51.9,49.1, 36.0,35.3,32.0,29.7,29.4,25.3,22.8,14.2. 19 F NMR(376MHz,CDCl 3 )δ -116.14.HRESIMS:m/z 408.2305[M+Na] + ,calcd.for C 24 H 32 FNO 2 Na: 408.2309.
EXAMPLE 66 preparation of 2-heptyl-4-benzylamino-7-methoxychroman (25)
Intermediate I-34 (5.52 g,20 mmol) and benzylamine (120 mmol) were dissolved in toluene (110 mL) and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 25 in 54% yield.
1 H NMR(400MHz,CDCl 3 )δ7.50(dd,J＝8.4,1.2Hz,1H),7.44– 7.42(m,2H),7.39–7.33(m,2H),7.30–7.25(m,1H),6.51(dd,J＝8.4, 2.4Hz,1H),6.37(d,J＝2.4Hz,1H),4.05–3.99(m,2H),3.95(d,J＝13.2 Hz,1H),3.83(d,J＝13.2Hz,1H),3.77(s,3H),2.35(m,1H),1.77(m, 1H),1.70–1.43(m,4H),1.41–1.28(m,8H),0.91(t,J＝7.2Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ159.8,156.5,140.8,128.5,128.2,128.2,128.1, 128.1,127.1,117.9,107.5,101.1,76.1,55.4,51.8,49.8,36.0,35.2,32.0, 29.7,29.4,25.3,22.8,14.3.HRESIMS:m/z 366.2437[M-H] - ,calcd.for C 24 H 32 NO 2 :366.2439.
EXAMPLE 67 preparation of 2-heptyl-4- (4-trifluoromethylbenzylamino) -7-methoxychroman (26)
Intermediate I-34 (5.52 g,20 mmol) and 4-trifluoromethylbenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. Working up procedure was as in example 60 to give compound 26 in 41% yield.
1 H NMR(400MHz,CDCl 3 )δ7.60(d,J＝8.4Hz,2H),7.55(d,J＝ 8.0Hz,2H),7.51(d,J＝8.8Hz,1H),6.52(dd,J＝8.8,2.4Hz,1H),6.37 (d,J＝2.4Hz,1H),4.06–3.97(m,3H),3.88(d,J＝14.0Hz,1H),3.77(s, 3H),2.33(m,1H),1.77(m,1H),1.69–1.53(m,4H),1.46–1.23(m,8H), 0.91(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ159.8,156.5,145.0, 129.3(q,J＝32.0Hz),128.3,2×128.2,2×125.4(d,J＝3.8Hz),124.4(d,J ＝270.5Hz),117.5,107.5,101.1,76.0,55.4,51.9,49.2,36.0,35.2,32.0, 29.7,29.4,25.3,22.8,14.3. 19 F NMR(376MHz,CDCl 3 )δ3×(-62.38). HRESIMS:m/z 458.2275[M+Na] + ,calcd.for C 25 H 32 F 3 NO 2 Na:458.2277.
EXAMPLE 68 preparation of 2-heptyl-4- (2-chloro-4-fluorobenzylamino) -7-methoxychroman (27)
Intermediate I-34 (5.52 g,20 mmol) and 2-chloro-4-fluorobenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 27 in 36% yield.
1 H NMR(400MHz,CDCl 3 )δ7.53(dd,J＝8.4,6.4Hz,1H),7.47(d, J＝8.8Hz,1H),7.12(dd,J＝8.4,2.4Hz,1H),6.99(td,J＝8.4,2.4Hz, 1H),6.50(dd,J＝8.4,2.4Hz,1H),6.36(d,J＝2.4Hz,1H),4.09–3.98(m, 2H),3.96(d,J＝13.6Hz,1H),3.86(d,J＝13.6Hz,1H),3.76(s,3H),2.35 (m,1H),1.78(m,1H),1.70–1.53(m,4H),1.43–1.20(m,8H),0.90(t,J ＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ162.8,160.4,159.8,156.5, 134.1(d,J＝10.4Hz),130.9(d,J＝8.6Hz),128.2,117.5,116.8(d,J＝ 24.5Hz),114.1(d,J＝20.6Hz),107.5,101.1,76.0,55.4,52.2,46.7,36.0, 35.3,32.0,29.7,29.4,25.3,22.8,14.3. 19 F NMR(376MHz,CDCl 3 )δ -113.94.HRESIMS:m/z 442.1916[M+Na] + ,calcd.for C 24 H 31 ClFNO 2 Na: 4442.1920.
Example 69 preparation of 2-heptyl-4- (3, 4-difluorobenzylamino) -7-methoxychroman (28)
Intermediate I-34 (5.52 g,20 mmol) and 3, 4-difluorobenzylamine (120 mmol) were dissolved in toluene (110 mL) and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 28 in 31% yield.
1 H NMR(400MHz,CDCl 3 )δ7.49(dd,J＝8.4,1.2Hz,1H),7.30(dd, J＝8.4,2.0Hz,1H),7.15–7.06(m,2H),6.51(dd,J＝8.4,2.4Hz,1H), 6.36(d,J＝2.4Hz,1H),4.09–3.94(m,2H),3.89(d,J＝14.0Hz,1H), 3.77(d,J＝13.6Hz,1H),3.76(s,3H),2.31(m,1H),1.76(m,1H),1.68– 1.41(m,4H),1.38–1.26(m,8H),0.90(t,J＝6.8Hz,3H). 13 C NMR(100 MHz,CDCl 3 )δ159.8,156.5,151.2(dd,J＝102.7,12.6Hz),148.7(dd,J＝ 101.6,12.5Hz),138.0,128.2,123.5(dd,J＝6.1,3.4Hz),117.5,117.0(d,J ＝16.8Hz),116.8(d,J＝17.0Hz),107.5,101.1,76.0,55.4,51.8,48.7,36.0, 35.2,32.0,29.7,29.4,25.3,22.8,14.3. 19 F NMR(376MHz,CDCl 3 )δ -138.17(d,J＝21.1Hz),-140.73(d,J＝21.3Hz).HRESIMS:m/z 426.2211[M+Na] + ,calcd.for C 24 H 31 F 2 NO 2 Na:426.2215.
EXAMPLE 70 preparation of 2-heptyl-4- (3, 4-dichlorobenzylamino) -7-methoxychroman (29)
Intermediate I-34 (5.52 g,20 mmol) and 3, 4-dichlorobenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. Working up procedure was as in example 60 to give compound 29 in 41% yield.
1 H NMR(400MHz,CDCl 3 )δ7.54(d,J＝1.6Hz,1H),7.48(d,J＝ 8.4Hz,1H),7.39(d,J＝8.4Hz,1H),7.26(dd,J＝8.0,2.0Hz,1H),6.51 (dd,J＝8.4,2.4Hz,1H),6.36(d,J＝2.4Hz,1H),4.07–3.94(m,2H), 3.88(d,J＝14.0Hz,1H),3.77(d,J＝14.0Hz,1H),3.77(s,3H),2.30(m, 1H),1.75(m,1H),1.69–1.49(m,4H),1.41–1.23(m,8H),0.90(t,J＝ 6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ159.9,156.5,141.3,132.4, 130.8,130.4,129.9,128.2,127.4,117.5,107.5,101.1,76.0,55.4,51.8, 48.5,36.0,35.2,32.0,29.7,29.4,25.3,22.8,14.3.HRESIMS:m/z 458.1624[M+Na] + ,calcd.for C 24 H 31 Cl 2 NO 2 Na:458.1624.
Example 71 preparation of 2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman (30)
Intermediate I-34 (5.52 g,20 mmol) and 3-chloro-4-fluorobenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compounds 30a and 30b in 56% yield.
Cis-2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman (30 a): 1 H NMR(400MHz,CDCl 3 )δ7.49(d,J＝2.0Hz,1H),7.47(d,J＝3.6Hz, 1H),7.28(m,1H),7.09(t,J＝8.4Hz,1H),6.51(dd,J＝8.4,2.4Hz,1H), 6.36(d,J＝2.4Hz,1H),4.07–3.94(m,2H),3.88(d,J＝13.6Hz,1H), 3.77(s,3H),3.76(d,J＝13.6Hz,1H),2.31(m,1H),1.76(m,1H),1.67– 1.50(m,4H),1.40–1.24(m,8H),0.90(t,J＝6.8Hz,3H). 13 C NMR(100 MHz,CDCl 3 )δ159.8,157.2(d,J＝245.8Hz),156.5,138.0(d,J＝3.6Hz), 130.1,128.2,127.6(d,J＝6.9Hz),120.8(d,J＝17.6Hz),117.5,116.4(d, J＝20.9Hz),107.5,101.1,76.0,55.4,51.8,48.5,36.0,35.2,32.0,29.7, 29.4,25.3,22.8,14.3. 19 F NMR(376MHz,CDCl 3 )δ-118.39.HRESIMS: m/z 442.1917[M+Na] + ,calcd.for C 24 H 31 ClFNO 2 Na:442.1920.
trans-2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman (30 b): 1 H NMR(400MHz,CDCl 3 )δ7.44(dd,J＝7.2,2.4Hz,1H),7.23(m,1H), 7.09(t,J＝8.8Hz,1H),7.01(d,J＝8.4Hz,1H),6.46(dd,J＝8.4,2.4Hz, 1H),6.39(d,J＝2.4Hz,1H),4.25(m,1H),3.85(br.s,2H),3.76(s,3H), 3.70(dd,J＝3.6,2.0Hz,1H),1.95(dt,J＝13.6,2.0Hz,1H),1.76(m,1H), 1.66–1.41(m,4H),1.39–1.25(m,8H),0.89(t,J＝7.2Hz,1H). 13 C NMR(100MHz,CDCl 3 )δ160.2,157.2(d,J＝246.0Hz),156.2,138.0(d, J＝3.8Hz),130.6,130.2,127.7(d,J＝6.9Hz),120.9(d,J＝17.7Hz), 116.5(d,J＝20.8Hz),116.4,107.5,101.2,71.5,55.4,51.0,50.4,35.6, 32.6,32.0,29.8,29.4,25.4,22.8,14.3.
EXAMPLE 72 preparation of 2-heptyl-4- (2, 4-difluorobenzylamino) -7-methoxychroman (31)
Intermediate I-34 (5.52 g,20 mmol) and 2, 4-difluorobenzylamine (120 mmol) were dissolved in toluene (110 mL) and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 31 in 45% yield.
1 H NMR(400MHz,CDCl 3 )δ7.49(d,J＝8.4Hz,1H),7.45(d,J＝ 8.4Hz,1H),7.44(d,J＝8.8Hz,1H),6.87(ddd,J＝8.4,2.0,1.6Hz,1H), 6.80(m,1H),6.50(dd,J＝8.4,2.4Hz,1H),6.36(d,J＝2.4Hz,1H),4.06 –3.97(m,2H),3.91(d,J＝13.6Hz,1H),3.82(d,J＝13.6Hz,1H),3.76(s, 3H),2.33(m,1H),1.77(m,1H),1.69–1.54(m,4H),1.45–1.23(m,8H), 0.90(t,J＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ162.8(dd,J＝ 105.7,12.1Hz),161.3(dd,J＝141.1,12.0Hz),159.8,156.5,130.9(dd,J ＝9.5,6.2Hz),128.1,123.7(dd,J＝14.4,3.4Hz),117.5,111.3(dd,J＝ 20.8,3.7Hz),107.5,103.8(t,J＝25.4Hz),101.1,76.0,55.4,52.0,42.6(d, J＝2.9Hz),36.0,35.2,32.0,29.7,29.4,25.3,22.8,14.3. 19 F NMR(376 MHz,CDCl 3 )δ-112.34,-115.42.HRESIMS:m/z 426.2211[M+Na] + ,calcd. for C 24 H 31 F 2 NO 2 Na:426.2215.
EXAMPLE 73 preparation of 2-heptyl-4- (2-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman (32)
Intermediate I-34 (5.52 g,20 mmol) and 2-fluoro-4-trifluoromethylbenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 32 in 41% yield.
1 H NMR(400MHz,CDCl 3 )δ7.69(t,J＝7.6Hz,1H),7.46(d,J＝8.4 Hz,1H),7.42(d,J＝8.0Hz,1H),7.31(d,J＝10.0Hz,1H),6.50(dd,J＝ 8.4,2.4Hz,1H),6.37(d,J＝2.4Hz,1H),4.07–3.99(m,3H),3.92(d,J＝ 14.4Hz,1H),3.77(s,3H),2.34(m,1H),1.78(m,1H),1.68–1.52(m,4H), 1.45–1.24(m,8H),0.91(t,J＝7.2Hz,3H). 13 C NMR(100MHz,CDCl 3 ) δ160.6(d,J＝246.4Hz),160.0,156.6,132.2(d,J＝14.1Hz),131.0(dd,J ＝41.2,8.2Hz),130.6(d,J＝5.0Hz),128.2,123.6(dd,J＝270.6,2.6 Hz),121.2(q,J＝3.8Hz),117.4,112.8(m),107.6,101.2,76.0,55.4,52.2, 42.7(d,J＝3.2Hz),36.0,35.3,32.0,29.7,29.4,25.3,22.8,14.2. 19 F NMR (376MHz,CDCl 3 )δ3×(-62.58),-117.09.HRESIMS:m/z 476.2181 [M+Na] + ,calcd.for C 25 H 31 F 4 NO 2 Na:476.2183.
EXAMPLE 74 preparation of 2-heptyl-4- (3, 4, 5-trifluorobenzylamino) -7-methoxychroman (33)
Intermediate I-34 (5.52 g,20 mmol) and 3,4, 5-trifluorobenzylamine (120 mmol) were dissolved in toluene (110 mL) and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The working up procedure was as in example 60 to give compound 33 in 73% yield.
1 H NMR(400MHz,CDCl 3 )δ7.48(d,J＝8.8Hz,1H),7.14–7.02(m, 2H),6.52(dd,J＝8.4,2.4Hz,1H),6.36(d,J＝2.4Hz,1H),4.09–3.92(m, 2H),3.87(d,J＝14.4Hz,1H),3.77(s,3H),3.76(d,J＝14.0Hz,1H),2.29 (m,1H),1.77(m,1H),1.82–1.41(m,4H),1.40–1.27(m,8H),0.91(t,J ＝6.8Hz,3H). 13 C NMR(100MHz,CDCl 3 )δ160.0,156.6,152.5(dd,J＝9.9,3.9Hz),150.0(dd,J＝9.8,3.9Hz),139.9(t,J＝15.4Hz),137.5(m), 128.1,117.4,111.6(d,J＝5.5Hz),111.5(d,J＝5.5Hz),107.5,101.2,76.0, 55.4,51.9,48.5,36.0,35.3,32.0,29.7,29.4,25.3,22.8,14.2. 19 F NMR (376MHz,CDCl 3 )δ2×(-134.79)(d,J＝20.7Hz),-162.99(t,J＝20.7Hz). HRESIMS:m/z 444.2118[M+Na] + ,calcd.for C 24 H 30 F 3 NO 2 Na:444.2121.
Example 75 preparation of 2-heptyl-4- (3-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman (34)
Intermediate I-34 (5.52 g,20 mmol) and 3-fluoro-4-trifluoromethylbenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 34 in 44% yield.
1 H NMR(400MHz,CDCl 3 )δ7.55(t,J＝7.6Hz,1H),7.49(d,J＝8.8 Hz,1H),7.33(d,J＝11.2Hz,1H),7.28(d,J＝8.0Hz,1H),6.51(dd,J＝ 8.4,2.4Hz,1H),6.36(d,J＝2.4Hz,1H),4.07–3.94(m,3H),3.87(d,J＝ 14.4Hz,1H),3.77(s,3H),2.31(m,1H),1.76(m,1H),1.66–1.42(m,4H), 1.40–1.23(m,8H),0.90(t,J＝7.2Hz,3H). 13 C NMR(100MHz,CDCl 3 ) δ160.1(dd,J＝254.4,2.4Hz),160.0,156.6,148.5(d,J＝8.2Hz),128.2, 127.1(m),123.3(d,J＝3.4Hz),122.9(d,J＝269.2Hz),117.4,116.2(d,J ＝20.7Hz),107.6,101.3,76.0,55.4,52.0,48.8,36.0,35.3,32.0,29.6,29.4, 25.3,22.8,14.2. 19 F NMR(376MHz,CDCl 3 )δ3×(-61.11)(d,J＝12.6Hz), -114.81(q,J＝12.4Hz).HRESIMS:m/z 476.2180[M+Na] + ,calcd.for C 25 H 31 F 4 NO 2 Na:476.2183.
EXAMPLE 76 preparation of 2-heptyl-4- (2, 4-dichlorobenzylamino) -7-methoxychroman (35)
Intermediate I-34 (5.52 g,20 mmol) and 2, 4-dichlorobenzylamine (120 mmol) were dissolved in toluene (110 mL), and a toluene solution of titanium tetrachloride was added dropwise to the reaction solution under an ice bath. And (5) recovering to room temperature after the dripping is finished, and reacting for 24 hours. And after the reaction is finished, filtering and distilling under reduced pressure to obtain an oily product. The oily product was dissolved in methanol (110 mL) and sodium borohydride (24 mmol) was added and stirred at room temperature for 2h. The work-up procedure was as in example 60 to give compound 35 in 63% yield.
1 H NMR(400MHz,CDCl 3 )δ7.42(d,J＝8.4Hz,1H),7.38(d,J＝ 8.4Hz,1H),7.28(d,J＝2.0Hz,1H),7.15(m,1H),6.40(dd,J＝8.8,2.0 Hz,1H),6.27(m,1H),3.99–3.88(m,2H),3.86(d,J＝14.0Hz,1H),3.76 (d,J＝14.0Hz,1H),3.67(s,3H),2.24(m,1H),1.68(m,1H),1.58–1.34 (m,4H),1.36–1.14(m,8H),0.81(d,J＝7.2Hz,3H). 13 C NMR(100MHz, CDCl 3 )δ159.8,156.5,137.0,134.2,133.2,130.6,129.2,128.2,127.3, 117.5,107.5,101.1,76.0,55.4,52.2,46.7,36.0,35.3,32.0,29.7,29.4,25.3, 22.8,14.3.HRESIMS:m/z 458.1625[M+Na] + ,calcd.for C 24 H 31 Cl 2 NO 2 Na: 458.1624.
EXAMPLE 77 preparation of 2-pentyl-4-amino-7-methoxychroman (36)
Intermediate I-40 (5.26 g,20 mmol) was dissolved in methanol (100 mL), palladium on carbon (0.53 g) was added, and the glass tube containing the solution was placed in an autoclave, and hydrogen was introduced to bring the pressure to 0.5Mp, and the reaction was carried out at room temperature for 24 hours. Filtering and decompressing to concentrate after reaction to obtain crude product. The crude product was purified by silica gel chromatography to give compound 36 in 96% yield.
1 H NMR(400MHz,CDCl 3 )δ7.31(d,J＝8.4Hz,1H),6.51(d,J＝ 8.4,1H),6.35(s,1H),4.10–4.01(m,2H),3.76(s,3H),2.18(dd,J＝13.2, 5.6Hz,1H),1.75–1.33(m,9H),0.91(t,J＝6.4Hz,3H). 13 C NMR(100 MHz,CDCl 3 )δ159.8,155.8,127.6,120.2,107.5,101.1,76.1,55.5,46.9, 39.8,35.8,31.9,24.9,22.8,14.2.
EXAMPLE 78 preparation of 2-hexyl-4-amino-7-methoxychroman (37)
Intermediate I-41 (5.54 g,20 mmol) was dissolved in methanol (100 mL), palladium on carbon (0.55 g) was added, and a glass tube containing the solution was placed in an autoclave, and hydrogen was introduced to bring the pressure to 0.5Mp, and the reaction was carried out at room temperature for 24 hours. Filtering and decompressing to concentrate after reaction to obtain crude product. The crude product obtained was purified by chromatography on silica gel to give compound 37 in 93% yield.
1 H NMR(400MHz,CDCl 3 )δ7.31(d,J＝8.4Hz,1H),6.51(d,J＝ 8.4,1H),6.34(s,1H),4.08–4.00(m,2H),3.76(s,3H),2.17(dd,J＝12.8, 5.6Hz,1H),1.75–1.31(m,11H),0.88(t,J＝6.8Hz,3H). 13 C NMR(100 MHz,CDCl 3 )δ159.8,155.8,127.6,120.2,107.5,101.1,76.1,55.4,46.9, 39.8,35.8,31.9,29.4,25.2,22.8,14.2.
Example 79 preparation of 2-heptyl-4-amino-7-methoxychroman (38)
Intermediate I-42 (5.82 g,20 mmol) was dissolved in methanol (100 mL), palladium on carbon (0.58 g) was added, and the glass tube containing the solution was placed in an autoclave, and hydrogen was introduced to bring the pressure to 0.5Mp, and reacted at room temperature for 24 hours. Filtering and decompressing to concentrate after reaction to obtain crude product. The crude product was purified by silica gel chromatography to give compound 38 in 90% yield.
1 H NMR(400MHz,CDCl 3 )δ7.31(d,J＝8.4Hz,1H),6.51(d,J＝ 8.8,1H),6.34(s,1H),4.08–4.02(m,2H),3.76(s,3H),2.18(dd,J＝12.4, 5.6Hz,1H),1.74–1.29(m,13H),0.89(t,J＝6.8Hz,3H). 13 C NMR(100 MHz,CDCl 3 )δ159.7,155.7,127.4,119.9,107.4,101.0,75.9,55.3,46.7, 39.6,35.7,31.8,29.6,29.2,25.0,22.7,14.1.
EXAMPLE 80 preparation of chromans of formula I and their isomer hydrochlorides
The chromans of formula I and its isomer (17.93 mmol) are dissolved in ethyl acetate (54 mL) and then HCl in ethyl acetate (46 mL,3.9 mol/L) is added dropwise and reacted for 1.5h at room temperature. Concentrating under reduced pressure and recrystallizing to obtain hydrochloride of the corresponding compound after reaction, wherein the hydrochloride is respectively as follows: 2-heptyl-4-isobutylamino-7-methoxychroman hydrochloride (39), 2-heptyl-4- (4-chlorobenzylamino) -7-methoxychroman hydrochloride (40), 2-heptyl-4- (3-fluorobenzylamino) -7-methoxychroman hydrochloride (41), 2-heptyl-4- (3-chlorobenzylamino) -7-methoxychroman hydrochloride (42), 2-heptyl-4- (3-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride (43), 2-heptyl-4- (4-fluorobenzylamino) -7-methoxychroman hydrochloride (44), 2-heptyl-4-benzylamino-7-methoxychroman hydrochloride (45), 2-heptyl-4- (4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride (46), 2-heptyl-4- (2-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride (47), 2-heptyl-4- (4-fluorobenzylamino) -7-methoxychroman hydrochloride (47), 2-heptyl-4- (3, 4-dichlorobenzylamino) -7-methoxychroman hydrochloride (49), cis-2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride (50 a), trans-2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride (50 b), 2-heptyl-4- (2, 4-difluorobenzylamino) -7-methoxychroman hydrochloride (51), 2-heptyl-4- (2-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride (52), 2-heptyl-4- (3, 4, 5-trifluorobenzylamino) -7-methoxychroman hydrochloride (53), 2-heptyl-4- (3-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride (54), 2-heptyl-4- (2, 4-dichlorobenzylamino) -7-methoxychroman hydrochloride (55).
Detection of anti-hepatitis B Virus Activity of chromans, isomers and pharmaceutically acceptable salts thereof of formula I described in example 81
The anti-HBV activity of examples 42-80 (compounds 1-55) was tested using the HepG2.2.15 cell model transfected with HBV DNA (Sells MA, chen ML, acs G.production of hepatitis B virus particles in HepG2 cells transfected with cloned hepatitis B virus DNA. Proc. Natl. Acad. Sci. U.S.A. 1987, 84:1005-1009). The experimental method is as follows:
(1) HepG2.2.15 cell origin and culture
HepG2.2.15 cells transfected by Hepatitis B Virus (HBV) DNA were purchased from Shanghai Fuhe Biotech Co., ltd, and were self-subcultured for use after purchase. Cells were cultured in MEM medium (i.e., complete medium: 10% fetal bovine serum, 400. Mu.g/mL G418, 100. Mu.g/mL penicillin, 100. Mu.g/mL streptomycin) at 37℃with 5% CO 2 Culturing in an incubator. The culture solution is replaced once every other day, and cells grow around 3 d.
(2) Toxicity test of drugs on cells
HepG2.2.15 cells were prepared as a cell suspension according to the literature (Mosmann T.Rapid colorimetric assay for cellular growth and survival: application to proliferation in cytoxicity assay.J.Immunol. Meth.1983,65,55-65) and the cell density was adjusted to 5X 10 5 mu.L/well of 100. Mu.L/well of cells were inoculated into 96-well cell culture plates at 37℃and 5% CO 2 Is cultured in an incubator for 24 hours. Drug-containing culture solutions (dosing group) with different concentrations, drug-free culture solution (cell control group) with 1%o DMSO, complete culture solution (blank control group, no cells), 3 duplicate wells per group were added. After 72h of incubation, 20. Mu.L of MTT solution (5 mg/mL) was added to each well and incubation was continued for 4h. The supernatant from each well was aspirated, 150. Mu.L of DMSO solution was added, and the plate was placed on an shaker and shaken for 15min in the absence of light to allow the crystals to dissolve well. Measuring OD value of each well on an enzyme labeling instrument, measuring wavelength of 490nm, recording result, calculating cell survival rate of the medicine according to formula (1) under different concentrations, and calculating half Cytotoxicity Concentration (CC) 50) 。
Cell storageActivity (%) = (a) Administration group -A Blank group )/(A Cell control group -A Blank group )×100％ (1)
Wherein: a is that Administration group Absorbance for the drug experimental group of different mass concentrations; a is that Blank group Absorbance for the blank control group; a is that Cell control group The absorbance of the cell control group was 1% of the culture medium containing DMSO.
(3) Detection of HBsAg and HBeAg
HepG2.2.15 cells were made into cell suspensions, and the cell densities were adjusted to 5X 10 5 mu.L/well of 100. Mu.L/well of cells were inoculated into 96-well cell culture plates at 37℃and 5% CO 2 Is cultured in an incubator for 24 hours. Cells and cell control groups (1% DMSO in drug-free medium) were treated with 200 μl of complete medium of different concentrations of drug per well in the dosing group, with 3 duplicate wells per group. Fresh medium containing different concentrations of compound was changed every 3 days. At 37℃with 5% CO 2 After 12 days of culture in an incubator, the supernatant was collected. Cell supernatants were collected, and OD values of each well were measured on an ELISA apparatus using 450nm as a detection wavelength, according to the procedures described in the kit for detecting hepatitis B surface s antigen (HBsAg) and e antigen (HBeAg). The inhibition ratios of the different concentrations of the drugs to HBsAg and HBeAg were calculated according to formula (2), and the median Inhibition Concentration (IC) 50 ). Inhibition ratio (%) of HBsAg (or HBeAg) =1- (a) Administration group -A Blank group )/(A Cell control group -A Blank group )×100％ (2)
Wherein: a is that Administration group Absorbance for the drug experimental group of different mass concentrations; a is that Blank group Absorbance for a control group operated in parallel without enzyme-binding substrate was measured for the kit; a is that Cell control group Absorbance was measured for the control group of cells without drug treatment.
(4) Determination of HBV DNA content
HepG2.2.15 cells were made into cell suspensions, and the cell densities were adjusted to 5X 10 5 mu.L/well of the cells were inoculated into 24-well cell culture plates at 37℃and 5% CO 2 Is cultured in an incubator for 24 hours. Each well in the dosing groupCells and cell control groups (1% DMSO in drug-free medium) were treated with 500 μl of complete culture medium with different concentrations of drug, with lamivudine (3-TC) as positive control, with 3 duplicate wells per group. Fresh medium containing different concentrations of compound was changed every 3 days. At 37℃with 5% CO 2 After 12 days of culture in the incubator of (a) the supernatant and cells in the 24-well plate were collected, and DNA was extracted from the supernatant and cells in the 24-well plate according to the instructions of the blood/tissue/cell genomic DNA extraction kit (Tiangen Biochemical-Beijing Co., ltd.).
HBV DNA content determination was performed using Real-time PCR (ABI Step One), the upper primer: 5'-ACCAATCGCCAGTCAGGAAG-3', the following primers: 5'-ACCAGCA GGGAAATACAGGC-3' (from Beijing Optimago Corp.) 10. Mu. L UltraSYBR Mixture fluorescent dye, 1. Mu.L upper primer, 1. Mu.L lower primer, 2. Mu.L sample DNA or positive control DNA, 6. Mu.L sterile water were added to the reaction tube, the cycling program was run at 95℃for 10min, then at 95℃for 15s,60℃for 1min, cycled 40 times, 72℃for 10s, and then melting curve analysis was set up: 15s at 95℃for 1min at 60℃for 15s at 95℃for 15s at 60 ℃. And (3) taking the amplification result of the positive control as a y axis and the logarithm of the copy number of the positive control as an x axis to prepare a linear standard curve, and calculating the HBV DNA content of the medicine. The inhibition ratio of HBV DNA by different concentrations of the drug was calculated according to the formula (3), and the half inhibition concentration (IC 50 )。
HBV DNA inhibition (%) = (1-C) Administration group /C Cell control group )×100％ (3)
Wherein: c (C) Administration group HBV DNA copy number for drug experimental groups of different mass concentrations; c (C) Cell control group HBV DNA copy number for the non-drug treated cell control group.
The test results of the inhibition of HBeAg and HBsAg secretion by hepg2.2.15 cells by the compounds tested are shown in table 1. Experimental results show that compounds 2,3,5,8, 11-13, 13a,13b,14-25, 27-29, 30a,30b,31-49, 50a,50b and 51-55 have inhibitory effects on HBeAg, and IC with the inhibitory effects 50 Between 28.76 and 498.64. Mu.M, wherein Compounds 2 and 36 are more active, IC 50 41.89.+ -. 3.72 and 28.76.+ -. 3.55. Mu.M, respectively, and the Selectivity Index (SI) is respectively>19.10,4.56; compounds 3-5,8, 11-13, 13a,13b,14-29, 30a,30b,31-49, 50a,50b and 51-55 have inhibitory effect on HBsAg, and IC thereof 50 Between 0.48 and 136.20. Mu.M, wherein the compounds 5, 18, 31 and 40 are more active, IC 50 1.13+/-0.49,1.17 +/-0.58, 2.08+/-0.98 and 0.48+/-0.15 mu M respectively, 143.74 and 104.68 of SI respectively,>1923.08 and 7032.58.
The test results of the inhibition of HBV DNA secretion by HepG2.2.15 cells by the compounds tested are shown in Table 2. The experimental results show that the tested compounds (1-13, 13a,13b,14-29, 30a,30b,31-49, 50a,50b and 51-55) all have inhibitory effects on HBV DNA, and their inhibitory effects are IC 50 Between 0.029 and 47.99. Mu.M, wherein the compounds 12, 13a,13b,18, 20, 30a,30b,31, 34, 39, 40, 43-45, 48, 50a,50b,51, 52, 54 and 55 are more active, IC 50 Are smaller than 1.00 mu M, are respectively 0.26+/-0.13,0.083 +/-0.027,0.093 +/-0.061,0.10 +/-0.03,0.78 +/-0.25,0.92 +/-0.24, 0.36+/-0.14,0.51 +/-0.19,0.59 +/-0.27,0.36 +/-0.11,0.70 +/-0.24,0.44 +/-0.18, 0.10+/-0.05,0.15 +/-0.06,0.47 +/-0.11,0.12 +/-0.03,0.029 +/-0.011,0.047 +/-0.028, 0.12+/-0.02,0.24 +/-0.13,0.72 +/-0.28,0.59 +/-0.21 mu M and SI is between 500.60 and 36282.80.
TABLE 1 Effect of chromans on secretion of HBeAg, HBsAg by HepG2.2.15 cells
/>
n＝3。
TABLE 2 in vitro Effect of chromans on HBV DNA
n＝3。
EXAMPLE 82 in vivo anti-DHBV DNA Activity assay of cis-2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride (50 a)
The therapeutic effect of cis-2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride (50 a) on hepatitis B virus sheldrake was tested using an animal model of congenital duck hepatitis B (Niu J, wang Y, dixon R, et al use of ampligen alone and in combination with ganciclovir and coumermycin A1 for the treatment of ducks congenitally-infected with duck hepatitis B virus. Anti Res.1993,21 (2): 155-71). The experimental method is as follows:
(1) Screening of hepatitis B virus sheldrake
Purchasing 1-day-old sheldrake (purchased from Kangyuan Living poultry warrior of Kunming, tongyuan) and adaptively feeding for one week, taking blood from duck foot veins, separating serum, extracting DNA according to the instruction of a blood/tissue/cell genome DNA extraction kit (Tiangen Biochemical-Beijing Co., ltd.), detecting according to the instruction of a duck hepatitis B virus dye method fluorescence quantitative PCR kit (purchased from Shanghai-associated Michaelis Biotechnology Co., ltd.) once a week, continuously detecting for 2 weeks, and screening out the sheldrake which stably infects DHBV DNA for later use.
(2) Grouping and administration
The selected sheldrake was randomly divided into 5 groups, 6 groups each, namely, a model group (physiological saline group), a lamivudine group (20 mg/kg), a drug low-dose group (10 mg/kg), a medium-dose group (20 mg/kg) and a high-dose group (40 mg/kg), and the drug was administered by intragastric administration once daily for 28 days. The medication is then stopped for 14 days. Blood was taken from the duck foot vein during the administration period, blood was taken once a week, serum was centrifuged, stored in a refrigerator at-80 ℃, examined, and body weight was weighed once a week.
(3) Duck serum DHBV DNA level detection
Taking the duck serum to be detected, extracting DNA in the serum according to the description of a blood/tissue/cell genome DNA extraction kit (Tiangen biochemistry-Beijing Co., ltd.), carrying out DHBV DNA content detection according to the description of a duck hepatitis B virus dye method fluorescent quantitative PCR kit (purchased from Shanghai-Haimai biotechnology Co., ltd.), and preparing a linear standard curve by taking the amplification result of a positive control as a y axis and the logarithm of the copy number of the positive control as an x axis, thus calculating the DHBV DNA content of a sample.
(4) Statistical method
Experimental results are all shown asAnd (3) representing. Statistical analysis using GraphPad prism 6 software, analysis of serum DHBV DNA level changes in animals at various time points before and after drug treatment using t-test, p compared to model group<The 0.05 has significant difference and has statistical significance.
The results of the inhibition test of compound 50a on the serum DHBV DNA of the congenital hepatitis b virus sheldrake are shown in fig. 1 and table 3. The experimental results showed that the low, medium and high dose groups of compound 50a had no effect on DHBV sheldrake weight gain compared to the blank group (see fig. 1). The test result shows that the compound 50a has better inhibition effect on the replication of DHBV DNA at low, medium and high doses (10 mg/kg,20mg/kg, 40 mg/kg). Compound 50a low dose group T14, T21 and T28 duck serum DHBV DNA content was significantly reduced (P < 0.01) during intragastric administration compared to group T0; the dose group T7 duck serum DHBV DNA content in the compound 50a is obviously reduced (P < 0.05), the T14, T21 and T28 duck serum DHBV DNA content is obviously reduced (P < 0.01), and the dose group T7, T14, T21 and T28 duck serum DHBV DNA content in the compound 50a is obviously reduced (P < 0.01). The low, medium and high dose groups P7, P14 of compound 50a still showed a very significant decrease in DHBV DNA content (P < 0.01) during withdrawal compared to the same group T0, with a trend to continuously inhibit viral replication (see table 3).
TABLE 3 Effect of Compound 50a on Duck serum DHBV DNA content before and after administration
/>
Effect of Table 3 Compounds 50a on Duck serum DHBV DNA content before and after administration
Note that: ## p compared with blank group<0.01; * P compared with the model group<0.05, P compared to model group<0.01。
Detection of anti-SARS-CoV-2 Activity of chromans, isomers, pharmaceutically acceptable salts thereof of formula I described in example 83
anti-CoV-2 activity of 2-heptyl-4- (3, 4-difluorobenzylamino) -7-methoxychroman hydrochloride (43), 2-heptyl-4- (3, 4-difluorobenzylamino) -7-methoxychroman hydrochloride (48), cis-2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride (50 a), 2-heptyl-4- (2, 4-difluorobenzylamino) -7-methoxychroman hydrochloride (51) was tested using a SARS-CoV-2-induced Vero-E6 cell model (Wang ML, cao RY, zhang LK, et al Remdeivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro. Cell Res. 2020, 30:269-271). The experimental method is as follows:
sources and cultures of Vero-E6 cells
Vero-E6 cells were purchased from the American Type Culture Collection (ATCC), and SARS-CoV-2 (nCoV-2019 BetaCoV/Wuhan/WIV/2019 isolate, GISAID accession number EPI_ISL_ 402124) was isolated and subcultured by the institute of Marfan virus, national academy of sciences. Cells were cultured in MEM medium (10% for every 100mL fetal bovine serum, 100U/mL penicillin, streptomycin, kanamycin, naHCO) 3 5%) at 37℃in 5% CO 2 Culturing the cells in an incubator for about 3 days.
2. Cytotoxicity test of drugs
Detection of cytotoxicity of the drug was determined using CCK8 kit (bi yun). The method comprises the following specific steps: at 9Inoculating 1×10 cells in 6-well cell culture plate 4 The Vero-E6 cells were cultured at 37℃for 16 hours; the drug was diluted with DMSO to the appropriate stock concentration, then diluted with MEM medium containing 2% fbs to the desired concentration, the original medium was discarded from the 96-well plate, 100 μl of the drug-containing MEM medium was added to the corresponding wells, and three wells were made for each concentration. Negative controls (PBS and MEM medium with 2% fbs, no drug added to the cell wells) and blank controls (MEM medium without cells, DMSO and 2% fbs) were set simultaneously. After the drug addition is finished, the cells are placed in a 5% CO2 incubator at 37 ℃ for 24 hours; then adding 10 mu L of CCK8 solution into the holes to be detected, placing the holes in a 37 ℃ incubator for 2 hours, measuring the OD value of each hole on an enzyme-labeled instrument, measuring the wavelength to be 450nm, recording the result, calculating the cell survival rate of the medicine at different concentrations according to a formula (4), and calculating the cell activity:
cell activity (%) = (a) Drug treatment group –A Blank control ))/(A Negative control –A Blank control )×100％ (4)
Wherein A is the absorbance value measured by the enzyme label instrument.
3. Experiment of drug against New coronavirus
Vero E6 cells were seeded into 48-well cell culture plates at about 1X 10 per well 5 Cells were tested the next day. mu.L of medium containing the drug at the corresponding concentration was added to the cell culture plate, the cells were pretreated for 1 hour, then 20. Mu.L of diluted virus (MOI=0.05) was added, and incubated in an incubator for 1 hour. Then the virus culture solution is discarded, the uninfected residual virus is washed off by PBS, then the medicine culture medium with corresponding concentration is added, the control group is added with the DMSO culture medium with 0.1 percent, and then the mixture is put into 37 ℃ and 5 percent CO 2 Culturing in incubator for 48 hr.
RNA extraction: the procedure was as follows using the kit (TaKaRa MiniBEST Viral RNA/DNA Extraction Kit) from TaKaRa: (1) 100. Mu.L of the supernatant of the test plate was added to the nuclease-free EP tube, and then 321. Mu.L of lysate (100. Mu.L of PBS, 200. Mu.L of buffer VGB, 2. Mu.L of protease K, 1. Mu.L of carrier RNA) was added to each well, and the mixture was digested at 56℃for 15 minutes; (2) Adding 200 mu L of absolute ethyl alcohol into the mixed solution obtained in the step (1), and uniformly mixing; (3) Transferring the mixed solution obtained in the step (2) into a centrifugal column without RNase, centrifuging at 12000rpm for 15s, and discarding the waste liquid; (4) Adding 500 mu L Buffer RW1,12000rpm for centrifugation for 15s, and discarding the waste liquid; (5) Adding 650 mu L Buffer RW2, centrifuging at 12000rpm for 15s, and discarding the waste liquid; (6) Adding 650 mu L Buffer RW2, centrifuging at 12000rpm for 2min, and discarding the waste liquid; (7) Transferring the whole of the centrifugal column in (6) to a new RNase-free 2ml collecting tube, and centrifuging at 12000rpm for 1min; 8) The whole of the column (7) was transferred to a fresh 1.5ml collection tube, 30. Mu.l of RNase-free water was added to each column, and the column was centrifuged at 12000rpm for 2min, and the eluate contained the corresponding RNA.
RNA reverse transcription, the steps are as follows: the experiment was carried out using a reverse transcription kit (PrimeScript, manufactured by TaKaRa Co., ltd TM RT reagent Kit with gDNA Eraser) reverse transcription of the RNA. (1) gDNA removal: RNA samples from each experimental group were collected and 3. Mu.L of RNA was subjected to reverse transcription, respectively. Firstly, adding 2 mu L of 5 multiplied by gDNA Eraser Buffer and 1 mu L of gDNA Eraser into each experimental group of RNA, then supplementing the reaction system to 10 mu L by RNase Free water, fully and uniformly mixing, and removing g DNA possibly existing in a sample in a water bath at 42 ℃ for 2 min; (2) reverse transcription: adding proper amount of enzyme, primer Mix and reaction buffer solution into the sample obtained in the step (1), supplementing the volume to 20 μl with RNase Free water, reacting for 15min at 37 ℃, and then treating for 15 s at 85 ℃, thus obtaining cDNA through transcription.
Real-time PCR detection: the fluorescent quantitative PCR was performed by mixing the reaction system with TB Green Premix (Takara, cat#RR820A) and performing amplification reaction and reading on a StepOne Plus Real-time PCR instrument. The copy number of the original virus liquid per milliliter is calculated. The method comprises the following steps: (1) establishing a standard substance: plasmid pMT-RBD was diluted to 5X 10 8 copies/μL,5×10 7 copies/μL,5×10 6 copies/μL,5×10 5 copies/μL,5×10 4 copies/μL,5×10 3 copies/μL,5×10 2 COPies/. Mu.L. Taking 2 mu L of standard substance or cDNA template for qPCR reaction; (2) The primer sequences used during the experiment are as follows (all expressed in 5 '-3') direction: RBD-qF: CAATGGTTTAACAGGCACAGG; RBD-qR CTCAAGTGTCTGTGGA TCACG; the reaction procedure of (3) is as follows: pre-denaturation: 95 ℃ for 5 minutes; cycle parameters: 95℃for 15 seconds, 54℃for 15 seconds, 72℃for 30 seconds. For a total of 40 cycles. According to Equation (5) the half maximal inhibitory concentration (EC 50 ) And half-maximal toxic concentration (CC 50 )。
Inhibition ratio (%) = (1-a) Drug treatment group )/A Blank control )×100％(5)
The experimental results show that the compounds 43, 48, 50a and 51 have obvious inhibition effect on SARS-CoV-2 isolate nCoV-2019BetaCoV/Wuhan/WIV04/2019, and when the complex of viral infection (MOI) is 0.05, half inhibition concentrations are 3.28,2.27,2.98 and 5.93 mu mol/L respectively, and corresponding Selection Indexes (SI) are greater than 122.0, 176.2, 134.2 and 67.5 respectively.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims (9)

1. The application of the chroman compound shown in the formula I or pharmaceutically acceptable salt thereof in preparing medicaments for preventing, treating or relieving hepatitis B virus infectious diseases and coronavirus infectious diseases is characterized in that the structural formula of the formula I is as follows:
Wherein R1 and R2 are respectively and independently selected from H, OH, OMe and halogen; r3 is selected from H, C1-C11 alkyl, C3-C6 cycloalkyl, phenyl, benzyl, substituted phenyl; r4 is selected from C1-C11 alkyl; x is independently selected from O, S and NH;
the substituted benzyl is selected from any one of the following: benzyl containing one or more halogen atoms, benzyl containing one trifluoromethyl substituent, benzyl containing one trifluoromethyl and one halogen atom substituent, benzyl containing one cyano substituent;
the substituted phenyl is selected from any one of the following: phenyl substituted with one or more halogen atoms, phenyl substituted with one trifluoromethyl group and one halogen atom, phenyl substituted with one cyano group.
2. Use according to claim 1, characterized in that said compound is selected from: 2-propyl-4-hydroxychroman, 2-butyl-4-hydroxychroman, 2-pentyl-4-hydroxychroman, 2-hexyl-4-hydroxychroman, 2-heptyl-4-hydroxychroman, 2-octyl-4-hydroxychroman, 2-nonyl-4-hydroxychroman, 2-undecyl-4-hydroxychroman, 2-propyl-4-hydroxy-7-methoxychroman, 2-butyl-4-hydroxy-7-methoxychroman, 2-pentyl-4-hydroxy-7-methoxychroman, 2-hexyl-4-hydroxy-7-methoxychroman, 2-heptyl-4-hydroxy-7-methoxychroman, 2-octyl-4-hydroxy-7-methoxychroman, 2-nonyl-4-hydroxy-7-methoxychroman, 2-undecyl-4-hydroxy-7-methoxychroman, 2-hexyl-4-hydroxy-7-methoxychroman, 2-heptyl-4-hydroxy-7-methoxychroman, 2-heptyl-4-isobutylamino-7-methoxychroman, 2-heptyl-4- (4-chlorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-fluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-chlorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-trifluoromethylbenzylamino) -7-methoxychroman, 2-heptyl-4- (4-fluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (4-chlorobenzylamino) -7-methoxychroman, 2-heptyl-4- (4-trifluoromethylbenzylamino) -7-methoxychroman, 2-heptyl-4- (2-chloro-4-fluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3, 4-difluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3, 4-chlorobenzylamino) -7-methoxychroman, 2-heptyl-4- (4-trifluoromethylbenzylamino) -7-methoxychroman, 2-heptyl-4- (2, 4-difluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (2-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman, 2-heptyl-4- (3, 4, 5-trifluorobenzylamino) -7-methoxychroman, 2-heptyl-4- (3-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman, 2-heptyl-4- (2, 4-dichlorobenzylamino) -7-methoxychroman, 2-pentyl-4-amino-7-methoxychroman, 2-hexyl-4-amino-7-methoxychroman, 2-heptyl-4-amino-7-methoxychroman.
3. The use according to claim 1, wherein the pharmaceutically acceptable salt is an addition salt of the compound with an acid selected independently from the group consisting of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, lactic acid, acetic acid, tartaric acid, p-toluenesulfonic acid, maleic acid, salicylic acid, citric acid, succinic acid.
4. The use according to claim 1, wherein the pharmaceutically acceptable salt is selected from the group consisting of: 2-heptyl-4-isobutylamino-7-methoxychroman hydrochloride, 2-heptyl-4- (4-chlorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-fluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-chlorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (4-fluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4-benzylamino-7-methoxychroman hydrochloride, 2-heptyl-4- (4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (2-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3, 4-difluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-chloro-4-fluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (2, 4-difluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (2-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3, 4, 5-trifluorobenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (3-fluoro-4-trifluoromethylbenzylamino) -7-methoxychroman hydrochloride, 2-heptyl-4- (2, 4-dichlorobenzylamino) -7-methoxychroman hydrochloride.
5. The use according to claim 1, wherein a pharmaceutical composition is prepared comprising a chroman compound of formula I according to claim 1 or a pharmaceutically acceptable salt and a pharmaceutically acceptable carrier or adjuvant.
6. The use according to claim 5, wherein the pharmaceutical composition is selected from the group consisting of tablets, capsules, pills, injections.
7. The use according to claim 5, wherein the pharmaceutical composition is selected from a slow release formulation or a controlled release formulation.
8. The use according to claim 5, wherein the pharmaceutical composition is a human pharmaceutical composition or an animal pharmaceutical composition, wherein the animal comprises a porcine, bovine, canine, equine, ovine, feline, rodent, primate.
9. The use according to any one of claims 1 to 8, characterized in that a medicament for preventing, treating or alleviating a novel coronavirus infectious disease is prepared.
CN202210181117.9A 2022-02-25 2022-02-25 Chromans with anti-hepatitis B virus and coronavirus effects Active CN114874174B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202210181117.9A CN114874174B (en) 2022-02-25 2022-02-25 Chromans with anti-hepatitis B virus and coronavirus effects
PCT/CN2023/077694 WO2023160586A1 (en) 2022-02-25 2023-02-22 Benzodihydropyran compound having anti-hepatitis b virus and anti-coronavirus effects

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210181117.9A CN114874174B (en) 2022-02-25 2022-02-25 Chromans with anti-hepatitis B virus and coronavirus effects

Publications (2)

Publication Number Publication Date
CN114874174A CN114874174A (en) 2022-08-09
CN114874174B true CN114874174B (en) 2023-09-22

Family

ID=82668345

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210181117.9A Active CN114874174B (en) 2022-02-25 2022-02-25 Chromans with anti-hepatitis B virus and coronavirus effects

Country Status (2)

Country Link
CN (1) CN114874174B (en)
WO (1) WO2023160586A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114874174B (en) * 2022-02-25 2023-09-22 云南民族大学 Chromans with anti-hepatitis B virus and coronavirus effects

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007045876A1 (en) * 2005-10-21 2007-04-26 Merz Pharma Gmbh & Co. Kgaa Chromenones and their use as modulators of metabotropic glutamate receptors
CN112996566A (en) * 2018-12-14 2021-06-18 豪夫迈·罗氏有限公司 Chroman-4-one derivatives for the treatment and prevention of hepatitis B virus infection

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE2745305A1 (en) * 1977-10-07 1979-04-19 Bayer Ag INSECTICIDES AND ACARICIDAL AGENTS
EP1223928A2 (en) * 1999-07-08 2002-07-24 Patrick Thomas Prendergast Use of flavones, coumarins and related compounds to treat infections
WO2011001258A1 (en) * 2009-07-01 2011-01-06 Evita Life Science Pte. Ltd Compositions, methods, and kits for treating viral and bacterial infections by tocotrienols, tocomonoenols, tocodienols, tocopherols, and their derivates
FR3057773B1 (en) * 2016-10-21 2020-06-19 Universite Claude Bernard Lyon 1 NOVEL ANTIVIRAL COMPOSITIONS FOR THE TREATMENT OF CORONAVIRUS-RELATED INFECTIONS
CN114874174B (en) * 2022-02-25 2023-09-22 云南民族大学 Chromans with anti-hepatitis B virus and coronavirus effects

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007045876A1 (en) * 2005-10-21 2007-04-26 Merz Pharma Gmbh & Co. Kgaa Chromenones and their use as modulators of metabotropic glutamate receptors
CN112996566A (en) * 2018-12-14 2021-06-18 豪夫迈·罗氏有限公司 Chroman-4-one derivatives for the treatment and prevention of hepatitis B virus infection

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Synthesis, Structure−Activity Relationship Studies, and Antibacterial Evaluation of 4‑Chromanones and Chalcones, as Well as Olympicin A and Derivatives;Li Feng等;J. Med. Chem.;第57卷;8398−8420 *

Also Published As

Publication number Publication date
CN114874174A (en) 2022-08-09
WO2023160586A1 (en) 2023-08-31

Similar Documents

Publication Publication Date Title
TWI721016B (en) Hepatitis b core protein modulators
CN110582500B (en) Bicyclic nucleocapsid inhibitors and their use as medicaments for the treatment of hepatitis b
US20220112177A1 (en) Ketoamide compound and preparation method, pharmaceutical composition, and use thereof
CN108250122B (en) Sulfonamide-aryl amide compounds and pharmaceutical use thereof for treating hepatitis B
JP2024503755A (en) Nucleoside compounds for the treatment of viral infections and their uses
CN104031104B (en) New nucleoside phosphoramidate compound and its application
JP5815746B2 (en) Hepatitis C virus inhibitor
EP1045841B1 (en) Novel genipin derivative having liver protection activity
EP0956285B1 (en) Novel genipin derivative having anti hepatitis b virus activity
TW201141488A (en) Antiviral nucleosides
CN114874174B (en) Chromans with anti-hepatitis B virus and coronavirus effects
CN111247131B (en) anti-HBV (hepatitis B virus) tetrahydroisoxazolo [4,3-c ] pyridine compounds
JP2021523160A (en) Dihydropyrimidine derivatives and their use in the treatment of HBV infections or HBV-induced diseases
CN111434665B (en) Ensultamidenamide-arylamide compounds and their use for treating hepatitis B
JP2023145644A (en) Dihydroisoquinoline compounds
CN114901639B (en) HBV inhibitors and uses thereof
CN110437232B (en) Bicyclourea nucleocapsid inhibitor and pharmaceutical use thereof
CN110590660B (en) Quinoline carboxamide compound, preparation method thereof and application of quinoline carboxamide compound in resisting enterovirus 71
CN108341810B (en) Episulfide urea compound and application thereof
CN112074504B (en) Di-heterocyclic nuclear capsid inhibitor and pharmaceutical use thereof
CN115677698B (en) High-efficiency antiviral compound and application thereof
TWI832045B (en) Antiviral 1,3-di-oxo-indene compounds
CN117903110A (en) HBV inhibitors and uses thereof
US20210322362A1 (en) Antiviral 1,3-di-oxo-indene compounds
CN116120219A (en) Polysubstituted pyrrole compound, preparation method thereof and application thereof in preparation of HBV capsid protein inhibitor

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20230329

Address after: 650228 Yuhua campus, Chenggong University Town, Yunnan University for nationalities, Kunming City, Yunnan Province

Applicant after: YUNNAN MINZU University

Applicant after: Yunnan Hengyi Biotechnology Co.,Ltd.

Address before: 650000 room 101-1, floor 9, No. 3 standard plant, biotechnology incubator, high tech Zone, Wuhua District, Kunming City, Yunnan Province

Applicant before: Yunnan Hengyi Biotechnology Co.,Ltd.

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant